SEARCH

SEARCH BY CITATION

Keywords:

  • NOVEL ENTITIES;
  • OSTEOPOROSIS;
  • MENOPAUSE;
  • OSTEOBLASTS;
  • BONE HISTOMORPHOMETRY

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Disclosures
  8. Acknowledgements
  9. References
  10. Supporting Information

We recently reported that extracts made from the stem bark of Ulmus wallichiana promoted peak bone mass achievement in growing rats and preserved trabecular bone mass and cortical bone strength in ovariectomized (OVX) rats. Further, 6-C-β-D-glucopyranosyl-(2S,3S)-(+)-3',4',5,7-tetrahydroxyflavanol (GTDF), a novel flavonol-C-glucoside isolated from the extracts, had a nonestrogenic bone-sparing effect on OVX rats. Here we studied the effects of GTDF on osteoblast function and its mode of action and in vivo osteogenic effect. GTDF stimulated osteoblast proliferation, survival, and differentiation but had no effect on osteoclastic or adipocytic differentiation. In cultured osteoblasts, GTDF transactivated the aryl hydrocarbon receptor (AhR). Activation of AhR mediated the stimulatory effect of GTDF on osteoblast proliferation and differentiation. Furthermore, GTDF stimulated cAMP production, which mediated osteogenic gene expression. GTDF treatments given to 1- to 2-day-old rats or adult rats increased the mRNA levels of AhR target genes in calvaria or bone marrow stromal cells. In growing female rats, GTDF promoted parameters of peak bone accrual in the appendicular skeleton, including increased longitudinal growth, bone mineral density, bone-formation rate (BFR), cortical deposition, and bone strength. GTDF promoted the process of providing newly generated bone to fill drill holes in the femurs of both estrogen-sufficient and -deficient rats. In osteopenic OVX rats, GTDF increased BFR and significantly restored trabecular bone compared with the ovaries-intact group. Together our data suggest that GTDF stimulates osteoblast growth and differentiation via the AhR and promotes modeling-directed bone accrual, accelerates bone healing after injury, and exerts anabolic effects on osteopenic rats likely by a direct stimulatory effect on osteoprogenitors. Based on these preclinical data, clinical evaluation of GTDF as a potential bone anabolic agent is warranted. © 2011 American Society for Bone and Mineral Research


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Disclosures
  8. Acknowledgements
  9. References
  10. Supporting Information

Several lines of evidence show that phytoestrogens can prevent bone loss, which has led to their increased prophylactic use in postmenopausal women.1 In animal models, supplementations of Gingko biloba (Egb 761) and green tea extracts that are rich in flavonols (a subclass of flavonoids), including quercetin (Q), kaempferol, and catechins, have been reported to mitigate the bone deleterious effects of estrogen deficiency.2–4 Q is one of the major and most well-studied flavonols concerning actions on bone cells.5, 6 Q and its dietary analogue, rutin, also have been shown to inhibit ovariectomy (OVX)–induced osteopenia in rats.6–8 However, restoration of lost bone requires the use of bone-forming/anabolic agents.

Anabolic therapy that stimulates the function of bone-forming osteoblasts is the preferred pharmacologic intervention for osteoporosis.9 Parathyroid hormone [PTH(1–34)], the sole clinically used anabolic agent, has been recommended recently by the US Food and Drug Administration to carry a black box warning because it is associated with an increased risk of osteosarcoma in rats. Intermittently administered PTH (iPTH) not only increases bone mass but also improves bone quality and strength by positive effects on the microarchitecture and geometry of bone.10 At the cellular level, iPTH exerts its bone anabolic effect by increasing proliferation and differentiation of osteoprogenitors.11, 12 It converts bone-lining cells to active osteoblasts13, 14 and enhances osteogenic differentiation of mesenchymal stem cells at the expense of adipogenesis.15, 16 Increasing osteoblast survival also may contribute to the anabolic action of iPTH because PTH transiently reduces osteoblast apoptosis both in culture17–20 and in vivo.17, 19

Q has been shown to stimulate differentiation of rat calvarial osteoblasts and MG-63 osteoblast-like cells. The differentiation-promoting effect of Q in osteoblastic cell lines was mediated by estrogen receptors (ERs).7, 21 From these reports, it appears that Q is a promising pharmacophore model for exploration of more potent osteogenic derivatives. Q also has been shown to act as a ligand for the aryl hydrocarbon receptor (AhR), a highly conserved ligand-activated transcription factor belonging to the basic helix-loop-helix.22, 23 Although the role of the AhR in osteoblast biology is not well understood, an available report suggests that expression of the receptor is associated with osteoblast differentiation, and the bone marrow cells (BMCs) of AhR null mice exhibit impaired nodule formation, suggesting the prodifferentiation effect of AhR in osteoblasts.24

In our search for more potent Q analogues with osteogenic effects, we embarked on isolation of bioactive compounds rich in flavonols from a standardized butanolic fraction (BF) derived from the stem bark of Ulmus wallichiana (Himalayan elm). The stem-bark extract of U. wallichiana is known in Indian traditional medicine to accelerate fracture repair.25, 26 Recently, we demonstrated that a BF derived from the total ethanolic extract (TEE) of U. wallichiana increased periosteal bone formation in growing female rats,27 suggesting an osteogenic effect of BF. Initial screening of TEE yielded four compounds that promoted osteoblast differentiation in vitro.28 One of these is 2S,3S-2,3 dihydroquercetin-C-glucoside [IUPAC: 6-C-β-D-glucopyranosyl-(2S,3S)-(+)-3',4',5,7- tetrahydroxyflavonol (GTDF)], which is a novel analogue of Q. In OVX rats, GTDF improved bone biomechanical quality through positive modifications of bone mineral density (BMD) and bone microarchitecture without having a hyperplastic effect on the uterus.29 However, we did not systematically evaluate the bone anabolic effect of GTDF and its mode of action. Accordingly, this study was designed first to assess the osteogenic effects of GTDF in vitro and its molecular mechanism of action. Next, the anabolic effect of GTDF was evaluated in growing rats (modeling-directed growth), bone healing was examined in a rodent model of bone and bone marrow injury and osteoporotic bones by using dynamic and static histomorphometries and biomechanical strength measurements.

Materials and Methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Disclosures
  8. Acknowledgements
  9. References
  10. Supporting Information

Reagents and chemicals

Cell culture medium and supplements were purchased from Invitrogen (Carlsbad, CA, USA). All fine chemicals were purchased from Sigma Aldrich (St. Louis, MO, USA). Human PTH(1–34) was purchased from Calbiochem (Gibbstown, NJ, USA); and 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), 17β-estradiol (E2), and alendronate sodium trihydrate (Aln) were purchased from Sigma Aldrich. The kinase inhibitor used was H-89 dihydrochloride (Sigma) for protein kinas A (PKA). 3',4'-Dimethoxyflavone (DMF), an AhR antagonist, was purchased from Alfa Aesar (Ward Hill, MA, USA). GTDF was purified from the total extract of the stem bark of U. wallichiana as described previously.28

Plasmids

Mammalian expression plasmids for pMTIF2 and VP16ER were described previously.30 Mammalian expression plasmids for AhR, ARNT, and AhR-responsive XRE-luc were kind gifts from Dr Jason Matthews.

In vitro studies

For harvesting cultures from calvaria and bone marrow (BM) of Sprague-Dawley rats, a prior approval from the Institutional Animal Ethics Committee (IAEC) was sought. Euthanasia and disposal of carcasses were performed in accordance with the guidelines laid out by the IAEC for animal experimentation.

Culture of rat calvarial osteoblasts (RCOs)

For each experiment, about 25 to 30 calvaria were harvested at room temperature from 1- to 2-day-old rats (both sexes). Briefly, an individual calvarium was surgically isolated from the skull, sutures were removed, and adherent tissue material was cleaned by gentle scrapping. With the pooled calvariae, a previously described method of repeated digestion (15 minutes/digestion) of the calvariae with 0.05% trypsin and 0.1% collagenase P was used to release cells.31 After discarding the cells from the first digestion, cells from the next four digestions were pooled and cultured in α modified essential medium (α-MEM) containing 10% fetal calf serum (FCS) and 1% penicillin/streptomycin (complete growth medium). Cultures of RCOs were allowed to reach 80% confluence for the experiments described below.

BrdU cell proliferation assay

For bromodeoxy uridine (BrdU) cell proliferation assay, RCOs at 70% to 80% confluence were trypsinized, and 2000 cells/well were seeded in 96-well in α-MEM supplemented with 10% fetal bovine serum (FBS). Cells then were exposed in the same medium with various concentration of GTDF (1 nM, 100 nM, and 1 µM) for 18 hours. Cell proliferation was measured using BrdU ELISA from Roche (Indianapolis, IN, USA) according to the manufacturer's instructions. For the last 3 hours of the 18-hour stimulation period, the cells were pulsed with BrdU. Absorbance at 370 nm was measured with a microplate reader.

To study the possible mediation of the AhR in the GTDF-induced cell proliferation, DMF (10 µM), an AhR antagonist, was used. RCOs were pretreated with DMF for 30 minutes prior to GTDF treatment, and BrdU incorporation was determined as described earlier.

Apoptosis assay

RCOs were grown to 50% to 60% confluence, followed by serum withdrawal for 2 hours and treatment with GTDF (100 nM) for 24 hours in α-MEM containing 0.5% FBS. Annexin V/PI staining for fluorescence-activated cell sorting (FACS) analysis was carried out according to kit manufacturer's (Sigma) instructions.

ALP assay

For the measurement of alkaline phosphatase (ALP) activity, RCOs at approximately 80% confluence were trypsinized, and 2 × 103 cells/well were seeded onto 96-well plates. Cells were treated with GTDF (100 nM) or vehicle for 48 hours in α-MEM supplemented with 10% charcoal-treated FBS, 10 mM β-glycerophosphate, 50 µg/mL of ascorbic acid, and 1% penicillin/streptomycin (osteoblast differentiation medium). At the end of incubation period, total ALP activity was measured using p-nitrophenylphosphate (PNPP) as substrate, and absorbance was read at 405 nm.32

To study the possible mediation of the AhR in GTDF-induced ALP production, RCOs were treated with DMF for 30 minutes prior to GTDF treatment, and ALP production was determined as described earlier.

Mineralization of RCOs

Mineralization of RCOs was performed following a previously published protocol.33 Briefly, RCOs were seeded onto 12-well plates (25,000 cells/well) in osteoblast differentiation medium. RCOs were cultured with or without GTDF (100 nM) for 21 days with a medium change every 48 hours. At the end of the experiment, cells were washed with PBS and fixed with 4% paraformaldehyde in PBS for 15 minutes. Alizarin red-S stain was used for staining mineralized nodules, followed by extraction of the stain for colorimetric quantification at 550 nm.34

Mineralization of BMCs

RCOs represent membranous bones that do not exhibit osteoporotic bone loss. Therefore, we also studied the effect of GTDF on the mineralization of bone marrow cells (BMCs) from one of the bones (femur) that undergo bone loss under E2 deficiency. For mineralization studies, BMCs from the femurs of 1-month-old female rats (∼40 g each) were isolated and cultured as described previously.34, 35 Briefly, BMCs were flushed out in 20 mL of osteoblast differentiation medium containing 10−7 M dexamethasone (bone marrow differentiation medium). Released BMCs were collected and seeded (2 × 106 cells/well) onto 12-well plates in bone marrow differentiation medium. BMCs were cultured with or without GTDF (100 nM) for 21 days with a medium change every 48 hours. At the end of the experiment, mineralized nodules were stained and quantified as described in the case of RCOs.

Differentiation of osteoclasts and adipocytes

Following our previously published protocol,33, 36 BMC cultures were treated with osteoclast differentiation medium containing receptor activator of nuclear factor κB ligand (RANKL, 30 ng/mL) and monocyte/macrophage colony-stimulating factor (M-CSF, 50 ng/mL) with or without GTDF. Histochemical staining for tartrate-resistant acid phosphatase (TRACP) was performed to quantify osteoclast differentiation.

Following our previously published protocol,33, 36 postconfluent 3T3-L1 cells were treated with differentiation induction medium (10% FBS in Dulbecco's modified Eagle medium containing 1 µg/mL of insulin, 1 µM dexamethasone, and 500 µM isobutylmethylxanthine) with or without GTDF. Oil red O staining was performed to quantify adipogenic differentiation.

Quantitative real-time polymerase chain reaction (qPCR)

SYBR Green chemistry was used to perform quantitative determination of runt-related transcription factor 2 (Runx2), collagen type 1 (Col1), Ahr, cytochrome P450, family 1, subfamily a, polypeptide 1 (Cyp1a1), and the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (Gapdh) from GTDF- and TCDD-treated RCO cDNA following an optimized protocol described previously.33 The design of sense and antisense oligonucleotide primers was based on published cDNA sequences using the Universal ProbeLibrary (Roche Applied Sciences, Indianapolis, IN, USA). Primer sequences are listed in Table 1. cDNA was synthesized with the RevertAid cDNA Synthesis Kit (Fermentas, Austin, TX, USA) using 2 µg of total RNA in 20 µL of reaction volume. For qPCR, the cDNA was amplified using Light Cycler 480 (Roche Molecular Biochemicals, Indianapolis, IN, USA).

Table 1. Primer Sequence of Various Genes Used for qPCR
Gene namePrimer sequenceAmplicon sizeAccession number
Col1F- CATGTTCAGCTTTGTGGACCT94NM_053304
 R- GCAGCTGACTTCAGGGATGT  
Runx2F- CCACAGAGCTATTAAAGTGACAGTG86NM_053470
 R- AACAAACTAGGTTTAGAGTCATCAAGC  
AhrF- CTGCGCAGAATCCCACAT93NM_013149
 R- AAGCGTGCATTGGACTGG  
Cyp1a1F- TGGGGTCCTAGAGAACACTCT74NM_012540
 R- CACAGAAGGCATGATCTAGGT  
GapdhF- TGGGAAGCTGGTCATCAAC78NM_017008
 R- GCATCACCCCATTTGATGTT  
Cell culture and transient transfection-based reporter assays

HepG2 cells were maintained in Dulbecco's modified Eagle medium (DMEM) supplemented with 10% FBS. Transfections were carried out with lipofectamine LTX (Invitrogen). Cells were transfected with 200 ng of XRE or GAL4 luciferase reporters, 100 ng of the internal control (pEGFPC1; Clontech, Mountain View, CA, USA), and 100 ng of the transcription factors indicated in Fig. 2. Total DNA in each transfection was adjusted to 700 ng by adding pcDNA3 empty vector. Four hours after transfections, cells were treated with TCDD (10 nM) or GTDF (100 nM) for 24 hours. Luciferase activity was measured in a GloMax-96 Microplate luminometer (Promega, San Luis Obispo, CA, USA) using Steady-Glo Assay (Promega), and GFP fluorescence was quantified in a fluorimeter (Polar Star Galaxy, BMG Labtech, Ortenberg, Germany). Luciferase values then were normalized with GFP values and were plotted as fold activities over untreated controls.

3',5'-Cyclic adenosine monophosphate (cAMP) ELISA

When cultures in 24-well plates reached 80% to 90% confluence, complete growth medium was replaced by fresh medium without FBS and preincubated for 1 hour. PTH(1–34) (100 nM) or GTDF (100 nM) was added to the cultures, and incubation was continued for 0, 5, 15, and 30 minutes. The medium then was removed, and the amounts of cAMP in the lysates were determined by an ELISA (Cayman Co., Ann Arbor, MI, USA) following the manufacturer's protocol. Total protein in each well was determined by MicroBCA (Pierce, Rockford, IL, USA) to normalize cAMP data.

siRNA transfection

Twenty-four hours before transfection, RCOs were plated in 6-well plates in medium supplemented with 10% FBS. The cells then were transfected with 50 nM control silencing construct (siC) or siAhR (Dharmacon, Lafayette, CO, USA) using Dharmafect I transfection reagent (Dharmacon) following the manufacturer's instructions. Sixteen hours after transfection, RCOs were treated with TCDD (10 nM) or GTDF (100 nM) for 24 hours, followed by qPCR analysis of osteogenic genes.

Western blotting

Western blotting was performed following previously described protocols.31, 37 RCOs were grown to 60% to 70% confluence, following which they were exposed to compounds for different time periods. The cells then were homogenized with triton lysis buffer (50 mM Tris-HCl, pH 8, containing 150 mM NaCl, 1% Triton X-100, 0.02% sodium azide, 10 mM EDTA, 10 µg/mL of aprotinin, and 1 µg/mL of aminoethylbenzenesulfonyl fluoride), and total proteins were quantified by MicroBCA assay (Pierce). Aliquots of 20 µg of cell lysates were separated on SDS-PAGE under reducing conditions using linear 1.5-mm, 4% to 20% Laemmli minigels (Bio-Rad, Hercules, CA, USA) and then transferred to polyvinylidene difluoride (PVDF) membranes (Millipore, Watford, UK). The membranes were incubated with different antibodies, including anti-rat polyclonal AhR antibody (95 kDa), anti-rat monoclonal proliferating cell nuclear antigen (PCNA) (36 kDa), and anti-rat monoclonal β-actin (42 kDa; Santa Cruz Technologies, Santa Cruz, CA, USA). Western blot signals were detected using the ECL-Plus Western blotting system and Hyblot X-ray film (Amersham Pharmacia Biotech, Pittsburgh, PA, USA).

In vivo studies

Prior approval from the IAEC was sought for OVX, husbandry, and treatment of female Sprague-Dawley rats with the various agents described in this study. Euthanasia and disposal of carcasses were in compliance with the IAEC guidelines.

Studies on the in vivo expression of AhR-responsive genes

Ten 1- to 2-day-old rats were divided into two equal groups and given a subcutaneous injection of either GTDF (5.0 mg/kg per day dose in 50 µL) or equal volume of vehicle (normal saline) for 3 consecutive days. At the end of the treatment, pups were euthanized, and individual calvaria were harvested and cleaned of adherent tissue materials by gentle scrapping. Total RNA was isolated, and qPCR for Cyp1a1 and Runx2 was performed as described earlier.

Twelve female Sprague-Dawley rats (180 to 200 g) were divided into two equal groups, and GTDF (5.0 mg/kg per day dose) or vehicle (gum acacia in distilled water) was administered for 2 consecutive weeks by oral gavage. Bone marrow stromal cells were isolated by red blood cell lysis followed by Ficoll density fractionation of whole bone marrow aspirate.38 RNA was isolated and qPCR performed as described earlier.

Studies on growing rats

Twenty-one-day-old female Sprague-Dawley rats were treated with a 1.0 or 5.0 mg/kg per day dose of GTDF or vehicle (gum acacia in distilled water) for 12 consecutive weeks by oral gavage. Gum acacia with distilled water is used routinely as a thickening agent in pharmaceuticals as vehicle.34 Each animal received intraperitoneal administration of fluorochromes calcein (20 mg/kg) on days 4 and 54 and tetracycline (20 mg/kg) on days 40 and 68, respectively, following a previously published protocol.27 At autopsy, femurs and tibias were dissected and separated from adjacent tissue, cleaned, fixed in 70% ethanol, and stored at 4°C until the measurement of various bone parameters, as described below.

Drill-hole injury in the femur

Sixty adult Sprague-Dawley rats (200 ± 20 g each) were taken for the study, and half were sham-operated (ovary intact) and the other half were ovariectomized bilaterally. Rats were left untreated for 4 weeks for the OVX rats to become completely E2-deficient.2 After 4 weeks, drill-hole injury was created in both sham and OVX groups as described previously.39–42 The front skin of the midfemur in rats was incised straightly and longitudinally at 1 cm in length under anesthesia. After splitting the muscle, we stripped the periosteum to expose the femoral bone surface. A drill-hole injury was made by inserting a drill bit with a diameter of 0.8 mm in the anterior portion of the diaphysis of the bilateral femurs 2 cm above the knee joint. Treatments started from the next day of injury and continued for 2 weeks. For the various treatments, rats were divided into six equal groups (10 rats/group) as follows: sham operated (ovary intact) + vehicle (gum acacia in distilled water), sham operated + 1.0 mg/kg per day GTDF, sham operated + 5.0 mg/kg per day of GTDF, OVX + vehicle, OVX +1.0 mg/kg per day of GTDF, and OVX + 5.0 mg/kg per day of GTDF. Each animal received intraperitoneal administration of fluorochrome calcein (20 mg/kg) 2 days before autopsy. After 2 weeks of the various treatments described earlier, all rats were euthanized and autopsied to collect their femurs for the measurement of bone microarchitectural parameters in the drill hole, as described below. Bones were embedded in an acrylic material. The 50-µm sections were made using an Isomet Bone Cutter (Agra, Utter Pradesh, India), and photographs were taken under the confocal microscope (LSM 510 Meta, Carl Zeiss, Inc., Thornwood, NY, USA) aided with appropriate filters. The intensity of calcein binding, which is an indication of the amount of new mineral deposition, was calculated using Carl Zeiss AM 4.2 image-analysis software.

Studies on OVX rats

Sixty adult Sprague-Dawley rats (200 ± 20 g each) were randomly divided into six equal groups as follows: sham operated (ovary intact) + vehicle (gum acacia in distilled water), OVX + vehicle, OVX + 40.0 µg/kg of parathyroid hormone (PTH; 5 days/week by intraperitoneal injection), OVX + 3.0 mg/kg per day of Aln, OVX + 1.0 mg/kg per day of GTDF, and OVX + 5.0 mg/kg per day of GTDF. Since GTDF had a bone-sparing effect in OVX rats at dosages of 1.0 and 5.0 mg/kg per day,43 we used these dosages for this study. The intraperitoneal dose for PTH (40.0 µg/kg 5 days/week) used in this study was based on previous reports.44, 45 Rats were bilaterally ovariectomized and left untreated for 13 weeks for osteopenia to develop.2 The various treatments described earlier started 13 weeks after the surgery and continued for 12 weeks. For dynamic histomorphometry, each animal received intraperitoneally administered fluorochromes tetracycline (20 mg/kg) on day 60 (8 weeks) and calcein (20 mg/kg) on day 90 (12 weeks) after the commencement of various treatments. After 12 weeks of treatment, all rats were euthanized and autopsied to collect bones (ie, tibias and femurs) for measurement of bone parameters, as described below.

BMCs from tibias and femurs of vehicle- or GTDF-treated rats were harvested, and mineralization was studied as described previously,34 as well as in the preceding section. BMCs then were cultured in bone marrow differentiation medium to induce mineralization for 18 days. Mineralization was quantified as described in the preceding section. Alizarin red S stain was used for staining mineralized nodules, followed by extraction of the stain for quantification.33, 46

Histology of decalcified bones

Femurs were fixed in 4% formaldehyde for 24 hours and then decalcified in 2.5% EDTA for 2 weeks. The epiphyseal segments of femurs from each animal were dehydrated in ascending grades of isopropanol, cleared in xylene, and embedded in paraffin using standard procedures described previously.27 Transverse sections (5 µm) of femurs were stained with hematoxylin and eosin (H&E). Photomicrographs of sections were taken using a Leica DC 300 camera and Lieca IM50 image-acquisition software fitted to a Lieca DMLB microscope.

Measurement of bone parameters

A dynamic histomorphometric study using double fluorochrome labeling of bones was performed following a previously described protocol.31 Briefly, the bones were embedded in an acrylic material for the determination of bone-formation rate/bone surface (BFR/BS) and mineral appositional rate (MAR). Sections 50 µm thick were made using an Isomet bone cutter, and photographs were taken under a fluorescence microscope aided with appropriate filters. BFR/BS and MAR then were calculated according to a previously described method.47

Micro–computed tomographic (µCT, both 2D and 3D) determination of excised bones was carried out using the Sky Scan 1076 µCT scanner (Sky Scan, Ltd., Kartuizersweg, Kontich, Belgium) as described in previously published protocols.2, 29, 43 Femurs and tibias were dissected from the animals after euthanasia, cleaned of soft tissue, and fixed before storage in alcohol. The samples were scanned in batches of three at a nominal resolution (pixels) of 18 µm. Reconstruction was carried out using a modified Feldkamp algorithm using the Sky Scan Nrecon software, which facilitates network-distributed reconstruction carried out on four personal computers running simultaneously. The X-ray source was set at 70 kV and 100 mA, with a pixel size of 18 µm. One hundred projections were acquired over an angular range of 180 degrees. The image slices were reconstructed using the Cone-Beam Reconstruction Software (Version 2.6) based on the Feldkamp algorithm (Sky Scan, Ltd.). The trabecular bone was extracted by drawing ellipsoid contours with the CT analyzer software. Trabecular bone volume (BV/TV, %), trabecular number (Tb.N), and trabecular separation (Tb.Sp, mm) values of the femoral epiphysis and proximal tibial metaphysis were calculated by the mean intercept length method. Trabecular thickness (Tb.Th, mm) was calculated according to the method of Hildebrand and Ruegsegger.48 3D parameters were based on analysis of a marching cubes–type model with a rendered surface. Cortical thickness, cortical area, cortical perimeter, periosteal perimeter, and endosteal perimeter were calculated by 2D analysis of cortical bones of the femur (mid-diaphysis) and tibia-fibula separating point (TFSP). To ensure consistency of cortical parameters, 100 slices were selected in the cortical region, leaving 250 slices as offset (to exclude the trabecular region) from the start of the growth plate as a reference point.

To analyze 3D parameters in fractured femurs, whole bone was scanned, and 600 slices 18 µm thick were placed through the former fracture area. The center of the fracture callus was defined manually as the point where the previous organization of the cortical bone in the fracture area was nearly nonexistent. Twenty five slices of 18 µm were placed above and below. Mineralized tissues in all the specimens were segmented from nonmineralized background using threshold value of 210. The following histomorphometric analyses werecarried out using a direct 3D approach. Tissue volume (TV), bone volume (BV), the BV/TV ratio, strut number (Tb.N, 1/mm), strut thickness (Tb.Th, mm), strut spacing (Tb.Sp. mm), connection density (Conn.Dens), and structure model index (SMI) in the fracture area were recorded.

Statistical analysis

Data are expressed as mean ± SEM unless otherwise indicated. The data obtained in experiments with multiple treatments were subjected to one-way ANOVA followed by post hoc Newman-Keuls multiple comparison test of significance using GraphPad Prism 3.02 software. Qualitative observations have been represented following assessments made by three individuals blinded to the experimental designs.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Disclosures
  8. Acknowledgements
  9. References
  10. Supporting Information

Effect of GTDF on osteoblasts

Figure 1A shows the chemical structure of GTDF (MW = 472). At 50% confluence, RCOs from 1- to 2-day-old rats were treated with increasing concentrations (10 nM to 1 µM) of GTDF, and as shown in Fig. 1B, GTDF concentration-dependently stimulated osteoblast proliferation assessed by BrdU incorporation. Since 100 nM GTDF maximally stimulated RCO proliferation, this concentration was used in the remaining experiments.

thumbnail image

Figure 1. GTDF has osteogenic effect in vitro. (A) Structure of GTDF. (B) RCOs were exposed to increasing concentrations of GTDF for 24 hours, and proliferation was determined by BrdU ELISA. *p < .05; **p < .01; ***p < .001. V = control (cells received vehicle). (C) GTDF exerts antiapoptotic effects in osteoblasts. RCOs were exposed to various treatments for 24 hours. Cells were stained with annexin V/PI, and DNA fragmentation was assessed by flow cytometry using the FL1-H channel (annexin-V) and FL2-H channel (PI) using a Becton Dickinson FACS Calibur (San Jose, CA, USA). Shown are representative dot plots. Quantification of flow cytometry data shown as percent of total cells. *p < .05, **p < .01 compared with control. (D) GTDF treatment of RCOs for 48 hours in osteoblast differentiation medium significantly increased ALP production compared with control. (E) GTDF (100 nM) treatment of RCOs resulted in a time-dependent increase in the mRNA levels of Col1 and Runx2. *p < .05, **p < .01, ***p < .001 compared with 0 hour. (F) GTDF treatment of RCOs and (G) BMCs for 21 days in osteoblast/bone marrow differentiation medium significantly increased mineralized nodules compared with control, as assessed by alizarin red S staining. *p < .05, **p < .01 compared with control. Data presented in every panel are mean ± SEM from three independent experiments.

Download figure to PowerPoint

Apoptosis was induced in RCOs by serum deprivation (0.5% FBS–containing medium), and the effect of GTDF was analyzed by FACS following annexinV/PI staining. Data showed that GTDF protected osteoblasts from apoptosis (Fig. 1C). RCOs cultured in 10% FBS contained 14% total apoptotic cells (early and late apoptotic cells) compared with 56% under apoptotic conditions (Fig. 1C). When GTDF was added to serum-deprived RCO cultures, only 30% of cells were found to be apoptotic (Fig. 1C).

At 80% confluence, RCOs were treated with GTDF, and ALP activity was determined. GTDF stimulated ALP activity compared with control (Fig. 1D). Furthermore, GTDF treatment of RCOs resulted in a time-dependent (0 to 48 hours) increase in the mRNA levels of osteogenic genes, including Col1 and Runx2 (Fig. 1E). Moreover, GTDF induced formation of mineralized nodules in RCOs, as well as BMC cultures (Fig. 1F, G).

GTDF (10−10 to 10−6 M) was found to have no effect on the differentiation of BMC cultures induced by RANKL + M-CSF to osteoclasts or 3T3-L1 preadipocytes to mature adipocytes (Supplemental Fig. S1).

Effect of GTDF on osteoblast signaling

Since Q has been reported to activate both the AhR and the ER,7, 22, 23, 49 we investigated the effect of GTDF on the transactivation of these two nuclear receptors. In the HepG2 (contains endogenous AhR) transactivation assay, GTDF modestly but significantly enhanced an AhR-responsive element containing reporter XRE-Luc activity (Fig. 2A, left panel). Exogenous AhR and its dimerization partner, AhR nuclear translocator (ARNT), further augmented this activity (Fig. 2A, left panel). TCDD, the reference AhR agonist, robustly activated XRE-luc (Fig. 2A). Although it transactivated the AhR, GTDF failed to activate ER interaction with transcription intermediary factor 2 (TIF2), a ligand-dependent ER cofactor in a mammalian two-hybrid interaction assay, whereas E2 caused a robust increase in ER-TIF2 interaction (Fig. 2A, right panel).

thumbnail image

Figure 2. GTDF mediates its osteogenic actions via AhR transactivation and cAMP production. (A) GTDF enhances AhR activity in HepG2 cells. Data represent mean ± SD of three independent experiments. (B) GTDF treatment induced nuclear translocation of the AhR in osteoblasts. RCO cultures were treated with 10 nM TCDD or 100 nM GTDF for the indicated time periods, and cytoplasmic or nuclear extracts were prepared and AhR protein levels were detected by immunoblotting. PCNA and β-actin were used as loading controls for the nuclear [N] and cytoplasmic [C] fractions, respectively. Right panel shows densitometric analysis from three independent blots. (C) GTDF induces AhR and Cyp1a1 transcripts. RCOs in 6-well plates were treated with 10 nM TCDD or 100 nM GTDF for the indicated time periods. qPCR data of the indicated genes represent mean ± SEM of three independent experiments. (D) DMF (an AhR antagonist) abolishes GTDF-stimulated proliferation and differentiation of osteoblasts. BrdU or ALP assay was performed in cells treated with 100 nM GTDF with or without DMF. (E) AhR depletion abolishes GTDF induction of osteogenic genes. RCOs were transfected with 50 nM nonsilencing control siRNA (siC) or siAhR, and after 24 hours, cells were treated with 10 nM TCDD or 100 nM GTDF. qPCR data of the indicated genes represent mean ± SEM of three independent experiments. (F) GTDF enhances mRNA levels of AhR-responsive genes in osteoblastic cells in vivo. Newborn rat pups and adult rats were treated with GTDF or vehicle as described under “Material and Methods.” qPCR data of the indicated genes from calvaria and bone marrow stromal cells are presented. n = 3 rats/group. (G) GTDF does not affect TCDD activation of the AhR. HepG2 cells were transfected with 200 ng of XRE-Luc, 100 ng each of AhR and ARNT expression plasmids, and 100 ng of EGFPC1. Four hours after transfection, cells were treated with indicated doses of compounds. For cotreatment, the cells were treated with DMF or GTDF 30 minutes prior to TCDD treatment, and cells were processed and plotted as in panel A. Data represent mean ± SD of four independent experiments. (H) GTDF enhances cAMP production in osteoblasts. RCOs were treated with GTDF (100 nM) and PTH (100 nM) for the indicated times, and cAMP was measured from the cell lysates. Data represent mean ± SD of three independent experiments. (I) A PKA inhibitor (H-89, 10 µM) abolishes GTDF induction of the mRNA levels of Runx2 and Col1 in calvarial osteoblasts. Data represent mean ± SEM of three independent experiments. (J) Effect of TCDD on AhR protein levels in RCOs (J) or HepG2 cells (K). RCOs or HepG2 cells were treated with 10 nM TCDD or 100 nM GTDF for the indicated time periods, and AhR level was detected by immunoblotting. A representative blot of three independent experiments with similar result is shown. (L) TCDD-mediated loss of AhR protein is irreversible in osteoblasts. RCOs were treated with TCDD for up to 96 hours or pretreated for 24 hours followed by its withdrawal for up to 96 hours. Lysates were collected at each time point, and AhR was detected by immunoblotting. A representative blot of three independent experiments with similar result is shown. *p < .05; **p < .01; ***p < 0.001.

Download figure to PowerPoint

We next investigated whether the observed AhR transactivation by GTDF in HepG2 cells was operative in osteoblasts. GTDF increased nuclear translocation of the AhR within 15 minutes of treatment (Fig. 2B) and time-dependently enhanced AhR and CYP1A1 (a downstream target of AhR) transcripts in RCOs (Fig. 2C). Interestingly, the TCDD-mediated increase in AhR and CYP1A1 transcripts peaked at 6 hours, followed by a decline, whereas the GTDF-mediated increases in both these transcripts were maintained until 48 hours (Fig. 2C). Further, GTDF-mediated increases in proliferation and mineralization of RCOs were blocked by the AhR antagonist DMF (Fig. 2D). GTDF but not TCDD strongly augmented transcripts of Runx2 and collagen type 1 (Col1) in RCOs (Fig. 2E), and depletion of AhR by RNAi abrogated the GTDF augmentation of Runx2 and Col1 transcripts, and as expected, AhR RNAi also abolished TCDD and GTDF induction of AhR and CYP1A1 (Fig. 2E). In addition, GTDF treatments given to 1- to 2-day-old rats or adult rats increased the mRNA levels of Cyp1a1 and Runx2 in the calvaria or bone marrow stromal cells compared with the corresponding vehicle-treated groups (Fig. 2F).

Since GTDF activated the AhR (Fig. 2A, left panel), we next checked whether GTDF was an AhR ligand. GTDF failed to reduce TCDD activation of the AhR even at 50 µM, whereas DMF concentration-dependently reduced activation of the AhR by TCDD (Fig. 2G). These data indicate that GTDF may not be an AhR ligand.

Since cAMP is known to modulate the nuclear translocation and transcriptional activity of the AhR,50 we next checked whether GTDF altered cAMP levels in RCOs. As shown in Fig. 2H, GTDF at 15 minutes maximally stimulated cAMP accumulation in RCOs, and this response was similar to that of PTH treatment. Further, the presence of H-89 (an inhibitor of PKA) attenuated the GTDF-stimulated Runx2 and Col1 mRNA levels in RCOs (Fig. 2I).

AhR null mice exhibited bone loss, and osteoblasts from these mice failed to form nodules in culture. Conversely, TCDD had a deleterious impact on bone by inhibiting osteoblast differentiation.24 To address this discrepancy, we assessed AhR protein levels in the presence of GTDF or TCDD. As shown in Fig. 2J, TCDD but not GTDF markedly reduced AhR levels in RCOs as early as 1 hour, and AhR was undetectable at 6 and 24 hours, whereas in HepG2 cells, AhR levels were diminished after 24 hours (Fig. 2K). In addition, the TCDD-mediated loss of AhR protein appeared to be irreversible because removal of TCDD from the culture medium failed to restore AhR protein even after 96 hours (Fig. 2L).

Effect of GTDF on body weight and bone length of growing rats

GTDF (1.0 and 5.0 mg/kg per day doses) administered to weaned female rats for 12 weeks resulted in no significant differences in the initial and final body weights when compared with controls (rats receiving vehicle) (Supplemental Fig. S2). At both doses, GTDF significantly increased the lengths of femur and tibia compared with controls (Table 2).

Table 2. DXA and Static Cortical Bone Histomorphometric Measurements in Growing Female Rats Supplemented With Vehicle or GTDF for 12 Weeks
ParameterVehicle (Gum-acacia)GTDF (1.0 mg/kg/d)GTDF (5.0 mg/kg/d)
  • a

    p < .05,

  • b

    p < .01,

  • c

    p < .001 compared with vehicle group.

  • *

    p < .05, **p < .01, ***p < .001 between GTDF 1.0 mg/kg/d and GTDF 5.0 mg/kg/d. Each parameter represents pooled data from 10 rats/group, and values are expressed as mean ± SEM. MAR = mineral apposition rate; P-BFR/BS = periosteal bone-formation rate/bone surface; E-BFR/BS = endosteal bone-formation rate/bone surface; B.Ar = cortical mean cross-sectional area; Cs.Th = cortical thickness; T.Ar = periosteal area; T.Pm = periosteal perimeter; B.Pm = cortical bone perimeter; B.Pm.-T.Ar = endosteal perimeter; MMI = mean polar moment of inertia.

Bone length
 Femur (cm)2.64 ± 0.0372.75 ± 0.029a2.75 ± 0.028a
 Tibia (cm)3.12 ± 0.0383.25 ± 0.026a3.25 ± 0.024a
Growth plate height
 Femur (µm)359.9 ± 4.4379.7 ± 4.7b380.8 ± 4.7b
 Tibia (µm)305.8 ± 4.0320.8 ± 4.2a322.0 ± 4.2a
Dynamic histomorphometric measurements at femur diaphysis
 MAR (4–40)2.17 ± 0.273.29 ± 0.20b3.16 ± 0.29a
 (µm/d)   
 MAR (40–54)0.87 ± 0.141.59 ± 0.18b1.80 ± 0.18a
 (µm/d)   
 MAR (54–68)0.80 ± 0.091.65 ± 0.18a2.15 ± 0.17a*
 (µm/d)   
 P-BFR/BS (4–40)601.7 ± 71.7903.1 ± 54.6b848.0 ± 80.1b
 (µm3/µm2/yr)   
 P-BFR/BS (40–54)283.7 ± 45.5518.4 ± 59.4b572.9 ± 56.3a
 (µm3/µm2/yr)   
 P-BFR/BS (54–68)282.3 ± 31.3574.8 ± 63.5b733.04 ± 55.8c*
 (µm3/µm2/yr)   
 E-BFR/BS (4–40)177.3 ± 19.5315.4 ± 34.1a455.2 ± 37.0a*
 (µm3/µm2/yr)   
 E-BFR/BS (40–54)1131.2 ± 141.21554.4 ± 91.1a1574.8 ± 226.9a
 (µm3/µm2/yr)   
 E-BFR/BS (54–68)533.2 ± 87.9891.1 ± 97.9b1135.0 ± 106.8a
 (µm3/µm2/yr)   
DXA measurements for BMD
 Femur, global (g/cm2)0.145 ± 0.0030.167 ± 0.002c0.159 ± 0.003a
 Femur midshaft (g/cm2)0.139 ± 0.0040.163 ± 0.003c0.152 ± 0.004
 Tibia, global (g/cm2)0.130 ± 0.0020.145 ± 0.004b0.141 ± 0.004a
 Tibia, proximal (g/cm2)0.117 ± 0.0030.131 ± 0.004a0.138 ± 0.006b
 Tf.Sp. (g/cm2)0.143 ± 0.0060.160 ± 0.002b0.161 ± 0.004a
Static cortical bone histomorphometric measurements at femur diaphysis
 B.Ar (mm2)2.39 ± 0.1032.93 ± 0.056c2.86 ± 0.064c
 Cs.Th (µM)0.281 ± 0.0080.322± 0.007b0.318 ± 0.001b
 T.Ar (mm2)6.17 ± 0.237.11 ± 0.07b6.69 ± 0.15a
 T.Pm (mm)9.49 ± 0.18410.2 ± 0.05b9.93 ± 0.11a
 B.Pm (mm)16.97 ± 0.31718.08 ± 0.136a17.56 ± 0.143a
 B.Pm.-T.Ar (mm)10.80 ± 0.10810.97 ± 0.07510.86 ± 0.122
 MMI3.94 ± 0.3005.37 ± 0.088c4.93 ± 0.170b
Static cortical bone histomorphometric measurements at TFSP
 B.Ar (mm2)2.19 ± 0.1132.75 ± 0.073c2.41 ± 0.101a
 Cs.Th (µM)0.154 ± 0.0230.240 ± 0.021c0.222 ± 0.015b
 T.Ar (mm2)6.71 ± 0.1637.83 ± 0.148b7.37 ± 0.138c
 T.Pm (mm)10.48 ± 0.16113.0 ± 0.135c12.3 ± 0.218c
 B.Pm (mm)19.2 ± 0.5920.5 ± 0.197c20.1 ± 0.136c
 B.Pm.-T.Ar (mm)12.49 ± 0.42712.27 ± 0.34312.73 ± 0.234
Biomechanical strength of femur
 Elastic modulus (N/mm2)44.38 ± 1.3150.75 ± 2.53a53.13 ± 1.75a
 Maximum load (N)20.48 ± 0.9327.57 ± 1.67b31.63 ± 1.41c*

Effect of GTDF on bone formation and mineralization in growing rats

Compared with controls, GTDF at both doses increased MAR at the femur diaphysis (cortical bone) in a time-dependent fashion: approximately 50% between 4 and 40 days and approximately 100% between 40 and 54 days. At a later point, that is, between 54 and 68 days, GTDF dose-dependently increased MAR. Compared with controls, GTDF at both doses increased periosteal (P) and endocortical (E) BFR/BS at all time points studied. A dose-dependent effect of GTDF was observed in E-BFR/BS between 4 and 40 days and in P-BFR between 54 and 68 days (Table 2).

Effect of GTDF on cortical BMD and histomorphometry of long bones in growing rats

The effects of GTDF treatment on BMD and static histomorphometric parameters of cortical bones are described in Table 2. DXA analysis shows that GTDF at both doses increased BMD of both femurs and tibias compared with control rats.

Static histomorphometric measurements at the site of femur mid-diaphysis show that compared with controls, GTDF at both doses significantly increased cortical mean cross-sectional area (B.Ar), periosteal area (T.Ar), periosteal perimeter (T.Pm), cortical thickness (Cs.Th), cortical bone perimeter (B.Pm), and mean polar moment of inertia (MMI). In the TFSP, GTDF treatment at both doses significantly increased B.Ar, Cs.Th, T.Ar, T.Pm, and B.Pm compared with control (Table 2).

Effect of GTDF on biomechanical strength

Biomechanical strength of the femur was evaluated by three-point bending. GTDF treatment at both doses increased the elastic modulus and dose-dependently increased maximum load compared with the control group (Table 2).

Effect of GTDF on bone regeneration in the drill holes in rats

Figure 3A shows that compared with controls (rats receiving vehicle), GTDF at both doses increased mineral deposition (measured from the intensity of calcein labeling in the drill hole) by approximately 70% in the sham group. OVX rats treated with vehicle had approximately 25% less mineral deposition than the sham + vehicle group. However, GTDF at both doses increased mineral deposition in OVX rats compared with OVX rats treated with vehicle.

thumbnail image

Figure 3. GTDF promotes bone regeneration in the drill holes in sham-operated (ovary intact) and OVX rats. (A) Representative confocal images (×100) of calcein labeling shown in the drill holes of various groups 2 weeks after injury. (Right panel) Quantification of the mean intensity of calcein label. (B) Representative µCT images from the center of the bony hole (upper panel). µCT analysis showing BV/TV (%), Tb.N (1/mm), Tb.Th (mm), Tb.Sp (mm), Conn.D (1/mm3), and SMI. All values are expressed as mean ± SEM (n = 10 rats/group). *p < .05; **p < .01; ***p < .001.

Download figure to PowerPoint

Assessment of internal microstructure of the mineralized tissue in the bony hole was analyzed by 3D µCT (Fig. 3B). OVX significantly reduced BV/TV and Tb.Th but had no effect on Tb.N, Tb.Sp, Conn.D, and SMI when compared with the sham-operated group. At the drill-hole site, GTDF treatment of either sham-operated or OVX rats at both doses resulted in higher BV/TV, Tb.Th, Tb.N, and Conn.D and increased Tb.Sp and SMI compared with the respective vehicle-treated groups (Fig. 3B).

Effect of GTDF on body weight of OVX rats

Body weight of the OVX + vehicle group was significantly higher than that of the sham-operated group. Body weights of OVX rats treated with GTDF, iPTH, or alendroante were not significantly different from those of the OVX + vehicle group (Supplemental Fig. S3).

Effect of GTDF on bone formation and mineralization in osteopenic rats

At the end of various treatments, BMCs harvested from the long bones of either the OVX + vehicle or the OVX + Aln group had significantly decreased mineralized nodules compared with sham-operated group. OVX rats treated with either GTDF (at both doses) or iPTH had nodule formation comparable with that of the sham-operated group (Fig. 4A). Histologic examination of cross sections of the femur epiphysis showed comparable morphology of osteocytes, the characteristic cells of bone that maintain the matrix, and postosteocytes or bone-lining cells between the sham, OVX, and OVX + GTDF (5.0 mg/kg per day dose) groups (Supplemental Fig. S4). In the bone marrow, no major cytomorphologic difference was apparent in cellularity, marrow space, and clusters of hematopoietic cells (ie, myeloid and erythroid) admixed with megakaryocytes between the groups (Supplemental Fig. S4).

thumbnail image

Figure 4. GTDF has an anabolic effect in osteopenic bones. (A) Oral GTDF supplementation to OVX rats increases mineralized nodule formation in BMCs assessed by alizarin red S staining. **p < .01, ***p < .001 compared with OVX + vehicle. (B) GTDF supplementation increases mineralization and bone formation in OVX rats. Dynamic histomorphometric parameters (MAR and BFR) at the femur mid-diaphysis calculated from the double fluorochrome labeling experiments in various groups. **p < .01, ***p < .001 compared with OVX + vehicle. (C) GTDF supplementation restores the trabecular microarchitecture of the femur epiphysis. Representative µCT images of the femur epiphysis of various experimental group (upper panel). µCT analysis of various trabecular parameters, including BV/TV, Tb.Sp, Tb.N, Tb.Th, Tb.Pf, SMI, and Conn.D are presented in the lower two panels. All values are expressed as mean ± SEM (n = 10 rats/group). *p < .05, **p < .01, ***p < .001 compared with OVX + vehicle or as indicated. (D) GTDF supplementation has a significant restorative effect on the trabecular microarchitecture of the tibial metaphysis. Representative µCT images (upper panel) and quantification of trabecular parameters are shown in the lower two panels. All values are expressed as mean ± SEM (n = 10 rats/group). *p < .05, **p < .01, ***p < .001 compared with OVX + vehicle or as indicated.

Download figure to PowerPoint

Figure 4B shows dynamic histomorphometric data of cortical bone (ie, femur mid-diaphysis) in various groups. The OVX group had significantly lower periosteal MAR and BFR compared with the sham-operated group. Comparison of the GTDF or iPTH treatment group with the sham-operated group revealed no significant differences in MAR and BFR. The Aln treatment had no significant effect on MAR and BFR.

Effect of GTDF on trabecular microarchitecture in osteopenic rats

In gross observation by 3D µCT, deterioration of the trabecular architecture owing to destruction of the trabecular bone of femurs and tibias was readily observed in OVX + vehicle group compared with numerous and well-developed trabeculae in the sham + vehicle group (representative photographs in Fig. 4C, D). Trabecular response to GTDF treatment of OVX rats was quantified at the femur epiphysis and tibial proximal metaphysis, and the values were compared with those of iPTH and Aln (Fig. 4C, D). Femoral data show (Fig. 4C) that compared with the sham-operated group, the OVX + vehicle group had reduced BV/TV, Tb.N, Tb.Th, and Conn.D and increased Tb.Sp, Tb.Pf, and SMI. Comparison of the GTDF or iPTH treatment group with the sham-operated group revealed no significant differences in BV/TV, Tb.N, Tb.Th, Tb.Pf, Conn.D, and SMI. Tb.Sp was increased in the GTDF or iPTH treatment groups compared with the sham-operated group but decreased compared with the OVX + vehicle group. Compared with the sham-operated group, the Aln treatment group had no significant difference in Tb.Th; had decreased BV/TV, Tb.N, and Conn.D; and had increased Tb.Sp, Tb.Pf, and SMI. However, compared with the OVX + vehicle group, the Aln treatment group had increased BV/TV, Tb.N, Tb.Th, and Conn.D and decreased Tb.Sp.

Tibial trabecular data (Fig. 4D) show that compared with the sham-operated group, the OVX + vehicle group had significantly reduced BV/TV, Tb.N, Tb.Th, and Conn.D and increased Tb.Sp, Tb.Pf, and SMI. Compared with the sham-operated group, the GTDF treatment group had no significant difference in Conn.D; had decreased BV/TV, Tb.Th, and Tb.N; and had increased Tb.Sp, Tb.Pf, and SMI. However, when compared with the OVX + vehicle group, the GTDF treatment group had increased BV/TV, Tb.N, and Conn.D and decreased Tb.Sp, Tb.Pf, and SMI. Comparison of the GTDF treatment group with the OVX group revealed no significant difference in Tb.Th. Compared with the sham-operated group, the iPTH treatment group had no significant differences in Tb.Th and Conn.D; had reduced BV/TV and Tb.N; and had increased Tb.Sp, Tb.Pf, and SMI. When comparison was made with the OVX + vehicle group, the iPTH treatment group exhibited increased BV/TV, Tb.Th, Tb.N, and Conn.D and decreased Tb.Sp, Tb.Pf, and SMI. Compared with the sham-operated group, the Aln treatment group revealed a decrease in BV/TV, Tb.N, Tb.Th, and Conn.D and an increase in Tb.Sp, Tb.Pf, and SMI. When comparison was made with the OVX + vehicle group, the Aln treatment group exhibited an increase in Tb.N and a decrease in SMI.

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Disclosures
  8. Acknowledgements
  9. References
  10. Supporting Information

In this article we demonstrated the osteogenic effects of GTDF, a novel analogue of Q. Our data indicate that GTDF, by stimulating osteoblast proliferation, survival, and differentiation, acts as an osteogenic agent. GTDF had no effect on the differentiation of osteoclasts or adipocytes from their precursor cells, suggesting an osteoblast-specific effect. At the molecular level, the osteogenic effects of GTDF appear to be mediated by AhR. Using different in vivo model systems, we demonstrate that GTDF enhances modeling-directed bone growth and increases bone healing after drill-hole injury. Further, GTDF restores bone in osteopenic OVX rats. An outline of the effects of GTDF on signaling, function, and gene expression of osteoblasts leading to the possible bone anabolic action is shown in Fig. 5.

thumbnail image

Figure 5. Schematic diagram outlining the mechanism of GTDF action on osteoblasts leading to a bone anabolic effect. GTDF by an unknown mechanism (?) stimulates cAMP production, leading to nuclear import of AhR and binding of the AhR/ARNT heterodimer to the XRE and transcription of AhR target genes in osteoblasts.

Download figure to PowerPoint

At nanomolar concentrations, GTDF induced an in vitro osteogenic effect in contrast to widely reported micromolar concentrations of Q required for stimulating osteoblast functions,21, 51, 52 suggesting that GTDF is a more potent analogue of Q. Recently, we have demonstrated that quercetin-6-C-β-D-glucopyranoside (QCG), a naturally occurring rare analogue of Q from U. wallichiana, exhibited a stronger osteogenic effect over Q.53 It, however, remains to be investigated whether C-glucoside conjugation (similar in QCG and GTDF) or a different stereochemistry of the flavonol (as in the case of GTDF) is responsible for the enhanced osteogenic effect of Q.

Q has been shown to signal through both the ER and the AhR.7, 22, 23, 49 Although the AhR remains largely unexplored with respect to skeletal effect, increased AhR expression in differentiating osteoblasts of rodents and reduced ability of BMCs derived from AhR null mice to form bone nodules suggested its positive impact on osteoblast differentiation.24 We showed that GTDF transactivated the AhR but not ERs, and moreover, by employing pharmacologic inhibition of the AhR or AhR-silencing methodologies, we demonstrated that the AhR was vital for mediating the osteogenic effects (ie, osteoblast proliferation, differentiation, and expression of osteogenic genes) of GTDF. In addition, GTDF treatment of newborn and adult rats resulted in increased expression of AhR target genes, including Cyp1a1 and Runx2 (Fig. 2E) in calvaria and bone marrow stromal cells, suggesting that GTDF signals via the AhR in osteoblasts in vivo. Additional studies will be needed to evaluate the possibility of AhR activation by GTDF in other organs/cells.

Activation of the AhR by GTDF in mediating osteoblast differentiation appears to involve stimulation of cAMP production, the second messenger that is responsible for AhR's nuclear import and the resulting transcriptional regulation.50 Understanding the mechanism by which GTDF stimulates cAMP production will require additional studies. Incidentally, activation of the PKA-cAMP pathway by GTDF in osteoblasts is reminiscent of PTH action.54, 55 PTH, via activation of the PKA pathway, stimulates the expression and activity of Runx2, and this effect is required for its bone anabolic function.56 Interestingly, despite being a strong AhR activator, TCDD inhibits osteoblast differentiation and promotes bone loss in mice.24, 57 Our data help to explain this apparent discrepancy by revealing that TCDD exposure causes rapid and irreversible loss of AhR protein, resulting in an inhibitory impact on osteoblast function. In contrast, GTDF appears to exert an anabolic effect by transactivation of the AhR as well as sustained augmentation of AhR protein levels in osteoblasts.

Maximizing peak bone mass at maturity may reduce the risk of skeletal fragility in old age.58, 59 GTDF treatment of growing female rats increased the lengths and growth plate heights of both femurs and tibias compared with controls. Linear bone growth is mediated by growth plate chondrocytes that undergo cell division in the proliferating zone and cell differentiation in the hypertrophic zone.60 Presently, we have no data to suggest whether increased growth plate height as a result of GTDF treatment was due to its effect on the proliferating or the hypertrophic zone. In addition to length gain, cortical bones during the growth increase in width by apposition of subperiosteal bone. GTDF treatment resulted in significant increases in the width and mass of femurs and tibias, as shown by increased periosteal circumference, larger cross-sectional area, and a thicker cortex compared with control rats. BFR/BS measurement represents the formation phase of the bone-remodeling cycle. Time-dependent increases in P- and E-BFR/BS in the femurs of GTDF-treated rats appears to contribute to a greater cortical thickness over controls. However, net bone gain was not located in the endosteal surface because B.Pm.-T.Ar remained comparable between the GTDF-treated and untreated groups. Consistent with the greater cortical apposition and thickness that will confer more strength in bending, the femurs of GTDF-treated rats exhibit better elastic and strength properties over the untreated group. MMI (bone tension strength) is an architectural surrogate of bone strength that is particularly influenced by the increase in periosteal size.61 Complementing our direct assessment of bone strength, the increase in MMI of the GTDF-treated rats further suggested stronger femurs than in the untreated rats. Taken together, these data suggest that GTDF promotes modeling-directed bone accretion.

We studied the effect of GTDF on the bone-healing process in a drill-hole injury model of long bone.39–42 This model seems suitable for analyzing the healing process quantitatively and useful for investigating osteoblast differentiation in vivo.39, 41 Fluorochrome labeling study shows that compared with the sham-operated group, bone regeneration in the drill hole was diminished in OVX rats, which could be due to the reduced osteoblast function under E2 deficiency. The same study showed that GTDF treatment of either sham-operated or OVX rats significantly augmented the process of filling up by newly generated bone in the drill hole. This finding was complemented by several µCT parameters (Tb.Th, Tb.N, Conn.D, and Tb.Sp) that indicated a more compact assembly and preferred platelike structure (low SMI) of the newly formed bone of GTDF-treated rats. Together these data indicate that GTDF accelerates the bone-healing process after bone and bone marrow injury of long bones.

We further demonstrated that GTDF exerted an osteogenic effect in osteopenic OVX rats. Dynamic measures of bone formation at the femur mid-diaphysis revealed that GTDF treatments increased MAR and BFR, and these values were similar to those in iPTH treatment, suggesting that GTDF stimulated periosteal apposition in osteopenic rats. Increases in bone formation and mineralization appear to be attributed to the increase in differentiation of bone marrow progenitor cells to osteogenic lineage in GTDF-treated rats without affecting the morphology of osteocytes or bone lining cells. As expected, Aln, a suppressor of resorption, failed to increase periosteal apposition in OVX rats.

The preservation of trabecular microarchitecture significantly contributes to bone strength and may reduce fracture risk beyond BMD.62 Thus restoration of microarchitecture parameters is necessary to evaluate the true impact of anabolic treatment on the quality of trabecular bone because trabecular bone is lost more readily owing to ovariectomy in rats.63 All femoral trabecular parameters in the iPTH group were comparable with those in the sham-operated group, suggesting a complete restoration of trabecular bone by iPTH in osteopenic rats. GTDF treatment had a dose-dependent effect on femoral trabecular parameters wherein all but Tb.Pf were comparable with those of the sham-operated group, suggesting a substantial restoration of the lost epiphyseal trabecular bone in osteopenic rats. Unlike femurs, iPTH or GTDF treatment had a partial restorative response in tibial parameters, which could be due to the lesser cancellous bone mass in the tibia metaphysis compared with the femur epiphysis at the start of treatment.64 The stability of trabecular bone is importantly dependent on structural parameters determined by Conn.D, SMI, and Tb.Pf. OVX results in higher SMI and Tb.Pf values. Tb.Pf reflects the connectedness of the trabecular plates to rods, wherein more concave surfaces represent a well-connected spongy lattice. The effects of GTDF on the structural parameters representing trabecular stability in femurs and tibias were comparable with those of iPTH. Together our data show that restoration of the trabecular microarchitecture of osteopenic rats that received GTDF treatment was more or less comparable with that of those receiving iPTH treatment, which suggested a substantial anabolic effect of GTDF.

Aln, an antiresorptive agent, has been shown not only to prevent bone loss but also to maintain BMD in osteopenic rats.65–67 Here, because we investigated the potential restorative of effect of GTDF on osteoporotic bone, an Aln treatment group was included to demonstrate that restoration of trabecular bone by GTDF was beyond that of the suppressive effect on bone loss by Aln. Indeed, trabecular responses of femurs and tibias in the GTDF-treated rats were significantly better than in the Aln treatment group, further confirming the osteogenic effect of GTDF in OVX-induced osteopenia.

In conclusion, the result of this study demonstrate that GTDF stimulates osteoblast growth and differentiation via the AhR, promotes modeling-directed bone growth in growing rats, accelerates bone healing following injury, and exerts an anabolic effect on osteoporotic bone that is comparable with that of iPTH by stimulatory effect on osteoblast differentiation of osteoprogenitors. Given the lack of uterine estrogenicity and prolonged systemic bioavailability in rats,43 these findings that GTDF exerts bone anabolic effect at a favorable oral dose of 5.0 mg/kg per day makes it an attractive alternative anabolic strategy for the development of new treatments for postmenopausal osteoporosis. It also appears from our data that the AhR is a molecular target amenable to pharmacologic manipulation toward bone anabolic effect.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Disclosures
  8. Acknowledgements
  9. References
  10. Supporting Information

This study was supported by a grant from the Ministry of Health and Family Welfare (Grant-in-Aid), Government of India. Funding from the Indian Council of Medical Research, Government of India (NC), and the Department of Biotechnology, Government of India (SS) is acknowledged. Research fellowship grants from the Department of Biotechnology (KS, KK), University Grants Commission (JSM, JAS), and Council of Scientific and Industrial Research (RK, GS, PR), Government of India, are also acknowledged. We thank Dr Jason Matthews (University of Toronto, Toronto, Ontario, Canada) for the kind gift of plasmids.

Authors' roles: Conceived and designed the experiments: KS, SS, NC. Performed the experiments: KS, JSM, GS, JAS, KK, KR. Analyzed the data: KS, SS, NC. GTDF isolation: PR, RM. Wrote the paper: KS, SS, NC.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Disclosures
  8. Acknowledgements
  9. References
  10. Supporting Information

Supporting Information

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Disclosures
  8. Acknowledgements
  9. References
  10. Supporting Information

Additional Supporting Information may be found in the online version of this article.

FilenameFormatSizeDescription
jbmr_434_sm_SuppFigs.doc17598KSupplemental Figures

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.