Attenuation of acute phase shear stress by somatostatin improves small-for-size liver graft survival

Authors


Abstract

The major concern of living donor liver transplantation is small-for-size graft injury at the early phase after transplantation. Novel therapeutic strategies should be developed. To investigate the protective effect of somatostatin related to hemodynamic stress on small-for-size liver graft injury, we applied a treatment regimen of low-dose somatostatin in a rat orthotopic liver transplantation model using small-for-size grafts (median, 38.7%; range, 35–42%). Somatostatin was given at 5 minutes before total hepatectomy and immediately after reperfusion in the recipient (20 μg/kg). Graft survival, portal hemodynamics, intragraft gene expression and hepatic ultrastructural changes were compared between the rats with or without somatostatin treatment. Seven-day graft survival rates in the somatostatin treatment group were significantly improved compared to the control group (66.7% vs. 16.7%, P = 0.036). In the treatment group, portal pressure and hepatic surface blood flow were significantly decreased within the first 30 minutes after reperfusion, whereas in the control group, transient portal hypertension and excessive hepatic blood flow were observed. Intragraft expression (both messenger RNA and protein) of endothelin-1 was significantly downregulated accompanied with upregulation of heme oxygenase-1 and A20. Better preservation of liver function was found in the treatment group. Hepatic ultrastructure, especially the integrity of sinusoids, was well protected in the treatment group. In conclusion, low-dose somatostatin rescues small-for-size grafts from acute phase injury in liver transplantation by attenuation of acute-phase shear stress that resulted from transient portal hypertension. Liver Transpl 12:621–627, 2006. © 2006 AASLD.

Therapeutic strategies for attenuation of small-for-size liver graft injury have been investigated recently according to its distinct pattern of hepatic ischemia-reperfusion injury.1–6 Since the severe shear stress that results from transient portal hypertension at the early phase after liver transplantation is the major cause of acute-phase graft failure, treatments focusing on portal decompression should be applied first. In addition to the transient portal hypertension, intragraft overexpression of endothelin-1 (ET-1), which leads to direct sinusoidal contraction,7 is also the therapeutic target. Previously, our pharmaceutical strategy to ameliorate small-for-size liver graft injury using FK409 demonstrated that attenuation of transient portal hypertension is pivotal to rescue the liver graft from acute phase injury.1 However, FK409 has not yet been approved for clinical use. It is therefore necessary to explore the portal decompression function of the currently available drugs.

Somatostatin (SMT), a 14–amino acid polypeptide, has been known as a multifunctional peptide and used for the treatment of acute variceal hemorrhage because of its selective effect in decreasing splanchnic blood flow and portal pressure without significant hemodynamic effects.8–10 The effect of SMT on portal hypertension may be attributed to its reduction of hepatic sinusoidal pressure via a nitric oxide–independent mechanism.11 In addition to its portal decompression function, SMT has also demonstrated its cytoprotective function of intestinal ischemia-reperfusion injury by attenuation of oxidative stress.12, 13 Recently, an in vitro study demonstrated that SMT could partially inhibit rat hepatic stellated cell contraction, which was induced by ET-1, via SMT receptor subtype 1.14 It suggested that SMT might be an alternative treatment to attenuate small-for-size liver graft injury by decreasing transient portal hypertension, as well as ameliorating hepatic sinusoidal contraction, which is induced by ET-1.

In this study, we aimed to probe into the protective mechanism of SMT in a rat liver transplantation model using small-for-size grafts by investigation of the changes of portal hemodynamics and intragraft gene expression related to sinusoidal contraction.

Abbreviations

ET-1, endothelin-1; SMT, somatostatin.

METHODS AND MATERIALS

Animals

Male inbred Lewis rats (180–230 g) were used as donors and recipients. Rats were housed in a standard animal laboratory with free activity and access to water and chow. They were kept under constant environmental conditions with a 12-hour light-dark cycle. The rats were fasted 12 hours before operation. All operations were performed under clean conditions.

Surgical Procedure and Experimental Design

The experiment was conducted in 2 groups of rats: control group (n = 36) and SMT treatment group (n = 36). A rat model of nonarterialized orthotopic liver transplantation without veno-venous bypass was used as described previously.1 The lobe ligation technique was used to reduce the graft size on the backtable. The median lobe of the liver was selected to be the graft, and the median ratio of the graft weight-to-recipient liver weight (graft weight ratio) was 38.7% (range, 35–42%). The graft was stored in cold saline with a target cold ischemic time of 80 minutes.

In the SMT group, 20 μg/kg somatostatin in 1 mL of saline was given intravenously 5 minutes before total hepatectomy and immediately after reperfusion in the recipient. The same amount of saline was given to the control group at the same time points.

Survival Study

Twelve rats in the control and SMT group were used for survival study. Rats that had lived for more than 7 days after transplantation were considered survivors.

Hemodynamic Study

Six rats in each group were used for hemodynamic study. After induction of anesthesia, the ileocolic veins were cannulated by a catheter for measurement of portal pressure. The catheter was connected via the pressure transducers (MLT1050 Blood Pressure, PowerLab System, ADInstruments Pty Ltd., Castle Hill, Australia) and Quad Bridge Amp (ML118 Quad Bridge Amp, PowerLab System, ADInstruments Pty Ltd.) to a multichannel data-recording unit (ML500 PowerLab/800, PowerLab System, ADInstruments Pty Ltd.) for continuous pressure monitoring and recording. Hepatic microcirculation was measured by Laser Doppler (BPM2 Blood Perfusion Monitor, Laserflo BPM2 Vasamedics, St. Paul, MN). All hemodynamic data were analyzed using the PowerLab software system.1

Biochemical Examination

Blood samples were collected from the recipients at 30 minutes, 2 hours, 6 hours, and 24 hours after reperfusion (6 rats for sampling at each time point) for the measurement of serum aspartate aminotransferase and total bilirubin levels (Hitachi 747 Automatic Analyzer, Boehringer Mannheim Gmbh, Mannheim, Germany). Plasma levels of glucagons were detected using Glucagon RIA Kit (Linco Research Inc., St. Charles, MO).

Hepatic Gene Expression Profiles by Real-Time Quantitative Reverse-Transcriptase Polymerase Chain Reaction (PCR)

Liver biopsies were stored at −80°C until total RNA extraction. The total RNA was extracted using Rneasy Midi Kit (Qiagen, GmbH, Hilden, Germany). About 0.5 μg total RNA from each sample was used to perform reverse transcription reaction using TaqMan Reverse Transcription Reagents (Applied Biosystems, Foster City, CA). Reverse transcription product (1 μL) was used to perform real-time quantitative reverse-transcriptase PCR using TaqMan Core Reagent Kit (Applied Biosystems) by the ABI PRISM 7700 Sequence Detection System (Applied Biosystems). The probes and primers of ET-1, heme oxygenase-1, and A20 were designed under the Primer Express software according to the criteria for real-time PCR (Applied Biosystems) (Table 1). The TaqMan Ribosomal RNA Control Reagent (18S RNA probe and primer pair, Applied Biosystems) was used for internal control in the same PCR plate well to normalize the target gene amplification copies. All samples were detected in triplicate, and the readings from each sample and its internal control were used to calculate the gene expression level. After normalization with the internal control, the gene expression levels after reperfusion were calculated as the percentage of the normal liver.

Table 1. Probes and Primer Pairs for Intragraft Gene Detection Using Quantitative Reverse-Transcriptase -PCR
GeneProbePrimer Pairs
ET-1AGACCCCGCAGGTCCAASense: TGATGTCCAGGTGGCAGAAGT Anti-sense: TGCTCCTGCTCCTCCTTGATGGACAAG
HO-1TGCCCCGCTCTACTTCCCTGAGGSense: CGAAACAAGCAGAACCCAGTCT Anti-sense: AGCCCTTCGGTGCAGCT
A20TTTAAAACCATGCACCGATACACGCTGGSense: AACCTACCAATGGGATCATCTATCA Anti-sense: GGCAAAACTGGCATGTTCTGA

Intracellular Expression of ET-1, Inducible Nitric Oxide Synthase by Immunostaining

The paraffin sections of the liver biopsies were immunochemically stained for ET-1, inducible nitric oxide synthase using Dako EnVision system (Dako, Glostrup, Denmark). In brief, after dewaxing, endogenous peroxidase activity was quenched by immersing the sections for 30 minutes in absolute methanol containing 0.3% H2O2. The sections were processed to unmask the antigens by conventional microwave oven heating in 10 mmol/L citric acid buffer (pH 6.0) for 12 minutes. The sections were then treated with 10% normal goat serum for 30 minutes to reduce the background staining, followed by treatment of appropriate primary antibodies (ET-1, Oncogene Research Products; inducible nitric oxide synthase, Transduction Laboratories, Lexington, KY) at 4°C overnight. After washing, the sections were incubated with EnVision secondary antibody (anti-mouse) for 30 minutes at room temperature and then visualized with chromogenic substrate solution for 2 minutes. The slides were examined under light microscope.

Morphological Study by Light and Electron Microscopy

Liver biopsies were taken at different time points after reperfusion for light microscopy for hematoxylin & eosin staining. The specimens for electron microscopy were immediately cut into 1-mm cubes and fixed in 2.5% glutaraldehyde in sodium cacodylate-hydrochloride buffer overnight at 4°C for electron microscopy section. The sections would be examined under a transmission electron microscope (Philips EM208, Eindhoven, Holland).1, 6

Apoptotic Cell Detection by Terminal Deoxynucleotide Transferase-Mediated dUTP Nick-End Labeling

The paraffin sections of the liver biopsies at different time points were detected for apoptotic cells by the terminal deoxynucleotide transferase-mediated dUTP nick-end labeling method3 (In Situ Cell Death Detection Kit, Roche Biochemicals, Mannheim, Germany).

Statistical Analysis

Continuous variables were expressed as median and range. Mann-Whitney U test was used for statistical comparison. Significance was defined as P < 0.05. Calculations were made with the help of SPSS computer software (SPSS, Chicago, IL).

RESULTS

Somatostatin Improved 7-Day Graft Survival

Seven-day graft survival rate was significantly improved from 16.7% (2/12) in the control group to 66.7% (8/12) in the SMT group (P = 0.036). Seven rats in the control group died within 48 hours.

Somatostatin Significantly Improved Liver Function Without Affecting Plasma Glucagon Level

Somatostatin treatment significantly decreased the serum levels of alanine aminotransferase and aspartate aminotransferase at 24 hours after liver transplantation (Fig. 1) (alanine aminotransferase, 1,095 [range, 762–1,440] U/L vs. 17,300 [range, 1,610–2,470] U/L, P = 0.021; aspartate aminotransferase, 1,157 [range, 823–1,680] U/L vs. 2,155 [range, 1,730–3,810] U/L, P = 0.021). The serum level of total bilirubin was significantly lower at 6 hours after reperfusion in the SMT group (4 [range, 3–4] μmol/L vs. 7.5 [range, 5–12] μmol/L, P = 0.018) (Fig. 1). There was no difference in plasma levels of glucagon at different time points after reperfusion between the 2 groups (Fig. 1).

Figure 1.

Liver function and plasma glucagon at different time points after reperfusion. (A) Alanine aminotransferase. (B) Aspartate aminotransferase. (C) Total bilirubin. (D) Plasma glucagons. Ctr, control; min, minutes; hr, hours. *P < 0.05.

Somatostatin Attenuated Portal Hemodynamic Force at the Early Phase After Reperfusion

The rats developed portal hypertension during the early phase after liver transplantation in the control group (Fig. 2). Their portal pressure was significantly higher during the first 30 minutes after reperfusion compared to that in the SMT group. Portal pressure in the control group reached the peak of 17.8 cm H2O at 5 minutes after reperfusion and was maintained at a higher level of 12.5 cm H2O at 30 minutes after reperfusion. After SMT treatment, the portal pressure was 10.65 cm H2O (P = 0.019) and 8.4 cm H2O (P = 0.019) at 5 minutes and 30 minutes after reperfusion, respectively. Although there was no statistical difference in the portal pressure during portal vein clamping for graft implantation between the 2 groups, the rats in the control group had a relatively higher portal pressure (C10 is ten minutes after poral vein clamping; 31 [range, 25.8–34] cm H2O vs. 22.7 [range, 21.9–32] cm H2O, P = 0.069). Consistent with the attenuation of portal hypertension by SMT during the first 30 minutes after reperfusion, the higher hepatic microcirculatory flow was decreased in the SMT group, especially during the first 10 minutes after transplantation (5 minutes after reperfusion, 18.5 [range, 12–20.5] mL/min/100 g vs. 22.5 [range, 20–24] mL/min/100 g, P = 0.025; 10 minutes after reperfusion, 17.9 [range, 8.6–21] mL/min/100 g vs. 22 [range, 20–24] mL/min/100 g, P = 0.019).

Figure 2.

(A) Perioperative portal pressure and (B) hepatic microcirculatory flow. Ctr, control; BL, baseline; C0, immediately after portal vein clamping; C2, Two minutes after portal vein clamping; C5: 5 minutes after portal vein clamping; C10, 10 minutes after poral vein clamping; BR, immediately before reperfusion; R0, immediately after portal vein reperfusion; R5, 5 minutes after portal vein reperfusion; R10, 10 minutes after portal vein; R15, 15 minutes after portal vein reperfusion; R20, 20 minutes after poral vein reperfusion; R25, 25 minutes after poral vein reperfusion; R30, 30 minutes after poral vein reperfusion.

Regulation of Intragraft Gene and Protein Expression by Somatostatin

The intragraft gene expression of ET-1 detected by real-time reverse-transcriptase PCR was significantly downregulated by somatostatin treatment during the first 24 hours after liver transplantation (Fig. 3A) (30 minutes, 110% vs. 245% relative to normal liver, P = 0.014; 2 hours, 123% vs. 426% relative to normal liver, P = 0.031; 6 hours, 192% vs. 726% relative to normal liver, P = 0.049; 24 hours, 110% vs. 606% relative to normal liver, P = 0.031). Consistent with the messenger RNA levels of ET-1, lower intragraft protein expression of ET-1 was also found in the SMT group compared to its overexpression in the control group (Fig. 4A). The messenger RNA levels of 2 hepatic protective genes heme oxygenase-1 and A20 were significantly upregulated by somatostatin treatment during the first 24 hours after transplantation (Fig. 3B and 3C) compared to those in the control groups.

Figure 3.

Messenger RNA expression of (A) ET-1, (B) heme oxygenase-1, and (C) A20 at different time points after reperfusion. Ctr, control; min, minutes; hr, hours.

Figure 4.

Intracellular expression of (A) ET-1 and (B) inducible nitric oxide synthase by immunostaining after liver transplantation at 30 minutes (1, 2) and 6 hours (3, 4) after reperfusion in the control group (1, 3) and SMT treatment group (2, 4). The intracellular expression of ET-1 and inducible nitric oxide synthase (brown staining) was much stronger in the control groups at 30 minutes and 6 hours after liver transplantation compared to that in the SMT treatment groups.

Somatostatin Maintained Hepatic Architecture Accompanied With Attenuation of Hepatic Apoptosis

Demonstrated by hemotoxylin & eosin staining, detachment of vascular endothelial cells together with patchy necrosis was present in the control group at 24 hours after reperfusion (Fig. 5A). Lymphocytes infiltration around the portal tract was also observed in the control group at 24 hours after reperfusion (Fig. 5A). On the contrary, the hepatic lobular architecture was well preserved after somatostatin treatment at 24 hours after reperfusion (Fig. 5B). The hepatocytes and portal tracts showed normal morphological features.

Figure 5.

(A, B) Hepatic architecture by hemotoxylin & eosin staining and (C, D) apoptosis by terminal deoxynucleotide transferase-mediated dUTP nick-end labeling assay at 24 hours after liver transplantation in the control group and somatostatin treatment group. The hepatocytes and portal tracts showed normal morphological features (B) in the SMT treatment group. Detachment of vascular endothelial cells together with patchy necrosis was present in the control group at 24 hours after reperfusion (A). Lymphocytes infiltration around the portal tract was also observed in the control group at 24 hours after reperfusion (A). Significantly more apoptotic cells including hepatocytes and sinusoidal endothelial cells were found in the control group compared with the SMT treatment group at 24 hours after reperfusion (C, D)

Apoptosis was compared by terminal deoxynucleotide transferase-mediated dUTP nick-end labeling assay. Significantly more apoptotic cells including hepatocytes and sinusoidal endothelial cells were found in the control group at 24 hours after reperfusion (Fig. 5C). After somatostatin treatment, only a few apoptotic sinusoidal endothelial cells were found at 24 hours after liver transplantation (Fig. 5D).

The hepatic ultrastructure was examined by electron microscopy. In the control group, mitochondrial swelling of hepatocytes and degeneration of cytoplasm of hepatocytes were observed at 2 hours after liver transplantation (Fig. 6A). They were accompanied with an irregular large gap of sinusoidal endothelial cells and loss of microvilli in the space of Disse (Fig. 6A). Twenty-four hours after reperfusion, the integrity of endothelial cells was disrupted (Fig. 6B). On the contrary, the hepatocytes and sinusoidal cells had normal appearance at 2 hours and 24 hours after liver transplantation in the SMT group (Fig. 6C and 6D). At 2 hours after liver transplantation, chromatin in the nucleus appeared normal, most of the mitochondria were elliptical, with well-visualized cristae. There were abundant microvilli in the space of Disse. The endoplasmic reticulum and sinusoidal lining cells were intact.

Figure 6.

Hepatic ultrastructural changes by electron microscopy in the (A, B) control group and (C, D) SMT group at 2 hours (A, C) and 24 hours (B, D) after reperfusion. M, mitochondrial; N, nucleus; arrow, sinusoidal lining cells; *space of Disse.

DISCUSSION

The distinct hepatic ischemia-reperfusion injury of small-for-size liver grafts was characterized by progressive sinusoidal damage that resulted from severe hepatic shear stress induced by transient portal hypertension, as well as overexpression of vasoconstrictive genes at the early phase after transplantation. Currently, surgical interventions for portal decompression applied clinically include splenic artery ligation15–17 and portocaval shunting.18 However, the decrease of portal pressure by these extra surgical procedures during liver transplantation has been irreversible. The overportal decompression might result in portal vein hypoperfusion or even thrombosis. On the other hand, pharmaceutical treatment targeting at the attenuation of portal hemodynamic force has significantly improved liver graft function, as shown in an animal study.4 The reversible effect of the drug therapy for transient portal hypertension makes it feasible for clinical application postoperatively without extra risks if an appropriate dose is given. However, up to now, no drug has been applied clinically to reduce portal pressure during liver transplantation.

SMT, a widely used clinical drug, has been demonstrated to significantly attenuate portal hypertension in laboratory and clinical studies. However, the effect of SMT on liver transplantation using small-for-size grafts has not been studied. In the present study, we investigated the portal decompression function of SMT in a rat liver transplantation model using small-for-size grafts.

Our study demonstrated that perioperative treatment by low-dose SMT significantly attenuated portal hemodynamic force during the early phase after reperfusion. To decrease the portal pressure after portal vein clamping during liver implantation, we applied the first dose of SMT before total hepatectomy in the recipient. The trend of lower portal pressure was obvious after SMT treatment during portal vein clamping, although no statistical difference was found. The administration of SMT immediately posttransplantation significantly attenuated the transient portal hypertension. However, different from the previous studies,19 SMT did not inhibit the secretion of glucagon at the first 24 hours after reperfusion. The significant downregulation of intragraft expression of vasoconstriction gene ET-1 was found to be starting early, at 30 minutes after reperfusion in the SMT treatment group. Therefore, the portal decompression function of SMT was probably ascribed to the reduction of hepatic sinusoidal pressure resulted from attenuation of ET-1-induced sinusoidal contraction14 as well as the decrease of portal blood inflow at the acute phase after liver transplantation. Furthermore, the upregulation of heme oxygenase-1, which is related to intracellular homeostasis and vasodilation,20 might be also important to ameliorate the acute phase hemodynamic force and subsequent inflammatory responses.21 Consistently, the intragraft protein expression of the inflammatory cytokine inducible nitric oxide synthase22 was also remarkably inhibited after SMT treatment. The overexpression of antiapoptotic gene A2023 was present during the first 24 hours after reperfusion in the SMT treatment group. Similarly, the sinusoidal cells were well protected from apoptosis, which was considered as a critical mechanism of graft injury in liver transplantation. Furthermore, the well maintenance of the integrity of hepatic sinusoids by attenuation of transient portal hypertension was pivotal for hepatic microcirculation.24 In essence, the rats treated by SMT had significantly longer survival with well preservation of liver function and normal hepatic architecture.

As SMT has already been widely used for patients with liver cirrhosis and variceal hemorrhage because of its effective function of portal decompression, it might have a great potential in the attenuation of transient portal hypertension at the early phase after reperfusion in liver transplantation using the graft from a live donor, which probably is small-for-size for the recipient. From the results of the current animal study, the effect of portal decompression by SMT was mainly found after the posttransplant treatment. Therefore, SMT may be given postoperatively when the portal pressure is higher in clinical setting. It may also be used to supplement surgical inflow modulation. In addition to its effect on portal hemodynamics, recent studies also demonstrated that SMT induced apoptosis in hepatoma cell lines and suppressed tumor metastasis.25, 26 With its therapeutic effect on ischemia-reperfusion injury, SMT might also be beneficial for living donor liver transplantation for liver cancer patients to attenuate small-for-size graft injury, as well as to prevent tumor recurrence. To explore the feasibility of the clinical application of SMT in living donor liver transplantation for patients with hepatocellular carcinoma, further studies should be conducted to investigate the precise mechanism.

In conclusion, SMT rescued small-for-size liver grafts from acute phase ischemia-reperfusion injury by significant attenuation of shear stress resulted from transient portal hypertension and excessive hepatic blood flow. The possible mechanism of its portal decompression during the early phase after liver transplantation might be partially attributed to the reduction of portal blood inflow and the downregulation of ET-1, which induced direct sinusoidal constriction and then increased hepatic sinusoidal pressure.

Acknowledgements

The authors thank Dr. Joseph Lee and his staff in the Division of Clinical Biochemistry, The University of Hong Kong, for performing the liver enzyme assay; and Bosco Yau, Amy Wong, and W. S. Lee of the Electron Microscope Unit for their assistance in performing electron microscopy.

Ancillary