The therapeutic potential of human umbilical mesenchymal stem cells from Wharton's jelly in the treatment of rat liver fibrosis

Authors

  • Pei-Chun Tsai,

    1. Institute of Anatomy and Cell Biology, School of Medicine, National Yang-Ming University, Taipei, Taiwan, Republic of China
    Search for more papers by this author
  • Tz-Win Fu,

    1. Department of Laboratory Medicine Medical Research and Education, Taipei Veterans General Hospital, Taipei, Taiwan, Republic of China
    Search for more papers by this author
  • Yi-Ming Arthur Chen,

    1. Institute of Microbiology and Immunology, School of Medicine, National Yang-Ming University, Taipei, Taiwan, Republic of China
    Search for more papers by this author
  • Tsui-Ling Ko,

    1. Department of Anatomy, School of Medicine, Taipei Medical University, Taipei, Taiwan, Republic of China
    Search for more papers by this author
  • Tien-Hua Chen,

    1. Department of Anatomy and Cell Biology, School of Medicine, National Yang-Ming University, Taipei, Taiwan, Republic of China
    Search for more papers by this author
  • Yang-Hsin Shih,

    1. Department of Neurosurgery, Neurological Institute Medical Research and Education, Taipei Veterans General Hospital, Taipei, Taiwan, Republic of China
    2. School of Medicine, Taipei Medical University, Taipei, Taiwan, Republic of China
    Search for more papers by this author
  • Shih-Chieh Hung,

    Corresponding author
    1. Institute of Clinical Medicine, School of Medicine, National Yang-Ming University, Taipei, Taiwan, Republic of China
    2. Stem Cell Laboratory, Medical Research and Education, Taipei Veterans General Hospital, Taipei, Taiwan, Republic of China
    • Stem Cell Laboratory, Medical Research and Education, Veterans General Hospital, 201 Shih-Pai Road, Section 2, Taipei, Taiwan 11217, Republic of China
    Search for more papers by this author
    • These authors contributed equally to this study.

    • Telephone: +886-2-28757396; FAX: +886-2-28757396

  • Yu-Show Fu

    Corresponding author
    1. Department of Anatomy and Cell Biology, School of Medicine, National Yang-Ming University, Taipei, Taiwan, Republic of China
    2. Department of Education and Research, Taipei City Hospital, Taipei, Taiwan, Republic of China
    • Department of Anatomy, School of Medicine, National Yang-Ming University, 155 Li-Nung Street, Section 2, Taipei, Taiwan 112, Republic of China
    Search for more papers by this author
    • These authors contributed equally to this study.

    • Telephone: 011-886-2-28267254; FAX: 011-886-2-28212884


Abstract

We investigated the effect of human umbilical mesenchymal stem cells (HUMSCs) from Wharton's jelly on carbon tetrachloride (CCl4)–induced liver fibrosis in rats. Rats were treated with CCl4 for 4 weeks, and this was followed by a direct injection of HUMSCs into their livers. After 4 more weeks of CCl4 treatment (8 weeks in all), rats with HUMSC transplants [CCl4 (8W)+HUMSC liver] exhibited a significant reduction in liver fibrosis, as evidenced by Sirius red staining and a collagen content assay, in comparison with rats treated with CCl4 for 8 weeks without HUMSC transplants [CCl4 (8W)]. Moreover, rats in the CCl4 (8W)+HUMSC (liver) group had significantly lower levels of serum glutamic oxaloacetic transaminase, glutamic pyruvate transaminase, α-smooth muscle actin, and transforming growth factor-β1 in the liver, whereas the expression of hepatic mesenchymal epithelial transition factor–phosphorylated type (Met-P) and hepatocyte growth factor was up-regulated, in comparison with the CCl4 (8W) group. Notably, engrafted HUMSCs scattered mostly in the hepatic connective tissue but did not differentiate into hepatocytes expressing human albumin or α-fetoprotein. Instead, these engrafted, undifferentiated HUMSCs secreted a variety of bioactive cytokines that may restore liver function and promote regeneration. Human cytokine assay revealed that the amounts of human cutaneous T cell–attracting chemokine, leukemia inhibitory factor, and prolactin were substantially greater in the livers of the CCl4 (8W)+HUMSC (liver) group, with considerably reduced hepatic inflammation manifested by a micro positron emission tomography scan. Our findings suggest that xenogeneic transplantation of HUMSCs is a novel approach for treating liver fibrosis and may be a promising therapeutic intervention in the future. Liver Transpl 15:484–495, 2009. © 2009 AASLD.

Liver fibrosis occurs in response to a variety of chronic injuries, including viral hepatitis, alcohol abuse, drug abuse, metabolic diseases, autoimmune attack of hepatocytes or the bile duct epithelium, and congenital abnormalities.1, 2 Typically, the injury is present for months to years before a significant fibrotic scar accumulates, although the time course may be accelerated in congenital liver diseases. Liver fibrosis is reversible, whereas cirrhosis, the end-stage result of fibrosis, generally is irreversible. Thus, efforts to understand fibrosis focus primarily on events that lead to the early accumulation of a fibrotic scar in the hope of identifying therapeutic targets to slow its progression.

Liver fibrosis is characterized by excessive accumulation of extracellular matrix, with the formation of scar tissue encapsulating the area of injury. Liver fibrosis has many clinical manifestations, including ascites, variceal hemorrhage, and encephalopathy. The prognosis for patients who have the disease is poor, although liver transplantation is a good alternative treatment. Limited numbers of donor livers, however, are available for the millions of patients who need them worldwide.3, 4 Therefore, strategies involving exogenous cell replacement must be considered.

Adult stem cells, which possess certain characteristics including self-renewal, pluripotency, proliferation, longevity, and differentiation, are a valuable source for transplantation. Adult hematopoietic and nonhematopoietic stem cells have been shown to differentiate into hepatocyte-like cells.5, 6 In a mouse model of liver failure, the systemic injection of bone marrow or bone marrow mesenchymal stem cells into mice rescues the diseased phenotype.7, 8

Human mesenchymal cells from Wharton's jelly of the umbilical cord possess stem cell properties.9-11 These human umbilical mesenchymal stem cells (HUMSCs) are capable of differentiating into neurogenic, osteogenic, chondrogenic, adipogenic, and myogenic cells in vitro.9, 10 We previously have shown that HUMSCs are viable for at least 4 months after being engrafted into the striatum and spinal cord of rats without the need for immunological suppression, suggesting that HUMSCs are a good stem cell source for transplantation.12 The possibility of using HUMSCs to repair liver fibrosis, however, has not yet been evaluated. In this study, we investigated the therapeutic effect of HUMSC transplantation on carbon tetrachloride (CCl4)–induced liver fibrosis in rats. Our study provides new insight into the potential of HUMSCs to restore hepatic function after chronic injuries to the liver.

Abbreviations

[18F]-FDG, 18F-fluorodeoxyglucose; αFP, α-fetoprotein; α-SMA, α-smooth muscle actin; CCL27, chemokine (C-C motif) ligand 27; CCl4, carbon tetrachloride; CTACK, cutaneous T cell–attracting chemokine; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; GOT, glutamic oxaloacetic transaminase; GPT, glutamic pyruvate transaminase; HGF, hepatocyte growth factor; HUMSC, human umbilical mesenchymal stem cell; LIF, leukemia inhibitory factor; MicroPET, micro positron emission tomography; PBS, phosphate-buffered saline; PCR, polymerase chain reaction; PET, positron emission tomography; RT-PCR, reverse-transcription polymerase chain reaction; TGF-β1, transforming growth factor-β1.

MATERIALS AND METHODS

Preparation of HUMSCs

This experiment was approved by the Research Ethics Committee at Taipei Veterans General Hospital. With the written consent of the parents, fresh human umbilical cords were obtained after birth and collected in Hank's balanced salt solution (Gibco 14185-052, Invitrogen, Carlsbad, CA) at 4°C. After disinfection in 75% ethanol for 30 seconds, the umbilical cord vessels were cleared off while still in Hank's balanced salt solution. The mesenchymal tissue (in Wharton's jelly) was then diced into cubes of about 0.5 cm3 and centrifuged at 250g for 5 minutes. After removal of the supernatant fraction, the precipitate (mesenchymal tissue) was washed with serum-free Dulbecco's modified Eagle's medium (Gibco 12100-046, Invitrogen) and centrifuged at 250g for 5 minutes. After aspiration of the supernatant fraction, the precipitate (mesenchymal tissue) was treated with collagenase at 37°C for 18 hours, washed, and further digested with 2.5% trypsin (Gibco 15090-046, Invitrogen) at 37°C for 30 minutes. Fetal bovine serum (SH30071.03, HyClone, Logan, UT) was then added to the mesenchymal tissue to neutralize excessive trypsin. The dissociated mesenchymal cells were further dispersed with 10% fetal bovine serum–Dulbecco's medium and counted under a microscope with the aid of a hemocytometer. These mesenchymal cells (ie, HUMSCs) then were cultured in flasks and collected between the eighth and tenth passages for transplantation into rats. We previously demonstrated that similarly processed HUMSCs expressed high levels of matrix receptors (CD44 and CD105), integrin (CD29 and CD51), and mesenchymal stem cell markers (SH2 and SH3), suggesting that HUMSCs are similar to bone marrow mesenchymal stem cells.11

Animal Model of CCl4-Induced Liver Fibrosis

Male Sprague-Dawley rats (body weight of 250-300 g) were obtained from the Animal Center of National Yang-Ming University (Taiwan). The Animal Research Committee of the College of Medicine at National Yang-Ming University approved the study in accordance with the guidelines for the care and use of laboratory animals.

Rats were treated with a mixture of CCl4 and olive oil (1:1 vol/vol; first at a dose of 0.5 mL of mixture/kg of body weight and then at 1 mL/kg each time thereafter) by a gavage tube twice a week for 8 weeks. The rats were sacrificed 1 day after the eighth or sixteenth CCl4 treatment. The left lobe of each liver was removed for histological examination and western blot assay, whereas the right lobe was freshly frozen for soluble collagen assay, human cytokine array assay, reverse-transcription polymerase chain reaction (RT-PCR), and protein extraction.

Animal Grouping

Rats were divided into 4 groups on the basis of different treatments:

  • 1Normal group: The rats received the same volume of olive oil alone.
  • 2CCl4 (4W) group: The rats were treated with CCl4 for 4 weeks. The animals were sacrificed 24 hours after the last administration (eighth injection) of CCl4.
  • 3CCl4 (8W) group: The rats were treated with CCl4 for 8 weeks. The animals were sacrificed 24 hours after the last administration (sixteenth injection) of CCl4.
  • 4CCl4 (8W)+HUMSC (liver) group: The rats were treated with CCl4 for 4 weeks, and this was followed by HUMSC transplantation into the liver. The animals were sacrificed after 4 more weeks of CCl4 treatment (8 weeks in all).

Animal Surgery

One day after the eighth oral gavage of CCl4 (ie, week 4), the rats were anesthetized with isoflurane and maintained at 37°C with a warming blanket placed under the animals. With aseptic techniques, a 1-cm incision was made caudal to the costal arch on the right flank to expose the right lobe of the liver. With a Hamilton syringe, a single injection of 5 × 105 HUMSCs (about 15 μL) was delivered into the right lobe of the liver under Glisson's capsule. A successful injection of HUMSCs was manifested by a whitish cell pellet that was visible under the capsule. To minimize bleeding from the injection site, the needle was left in place for 5 to 10 minutes before being withdrawn. Then, the overlying skin and muscles were closed and sutured. Rats with HUMSC transplants were housed singly in cages and treated with CCl4 for 4 more weeks. These animals were sacrificed 24 hours after the last (ie, 16th) administration of CCl4.

Examination of the Levels of Glutamic Oxaloacetic Transaminase (GOT) and Glutamic Pyruvate Transaminase (GPT) in Serum

To assay the function of the liver, GOT and GPT in serum were assessed with a biochemistry analyzer (Dimension Integrated Chemistry System, Siemens AG, Munich, Germany) at the Department of Medical Technology of Taipei Veterans General Hospital (Taiwan).

Quantitative Analysis of Liver Fibrosis from Liver Sections

Liver sections cut at 10 μm were fixed with 4% paraformaldehyde in a 0.1 M phosphate buffer for 20 minutes and then washed with a 0.1 M phosphate buffer. Tissue sections were stained with 0.1% Sirius red in a picric acid solution, and this was followed by dehydration; a coverslip was applied with Permount. We quantified the area of liver fibrosis with Sirius red staining, using an Olympus microscope equipped with a charge-coupled device camera. The red area, considered the fibrotic area, was assessed by computer-assisted image analysis with Image-Pro software. The mean of the fibrotic area was obtained from 6 randomly selected regions per section from a total of 6 sections in each rat and was expressed as a percentage.

Double Staining of Anti-Human Specific Nuclear Antigen and Anti-Human Albumin

To assess the distribution and survival of implanted HUMSCs, immunostaining of human-specific nuclear antigen was performed, whereas the sections were double-stained with anti-human albumin antibody to localize hepatocytes differentiated from HUMSCs. Liver sections (10 μm) were fixed with 4% paraformaldehyde in a 0.1 M phosphate buffer for 20 minutes and then washed with a 0.1 M phosphate buffer. Blocking solution was applied for 30 minutes to prevent nonspecific antibody-antigen binding. The liver sections then were reacted with mouse anti-human specific nuclear antigen antibody (1:100, MAB1281, United Chemicon, Rosemont, IL) at 4°C for 18 hours, washed with 0.1 M phosphate-buffered saline (PBS), and reacted with rhodamine-conjugated goat anti-mouse immunoglobulin G (1:50; AP124R, United Chemicon) at room temperature for 1 hour. The sections were then washed with 0.1 M PBS for 5 minutes 3 times, reacted with mouse anti-human albumin antibody (1:100; A6684, Sigma, St. Louis, MO) at 4°C for 18 hours, washed again with 0.1 M PBS for 5 minutes 3 times, reacted with fluorescein-conjugated goat anti-mouse immunoglobulin G (1:50; AP124F, Chemicon) at room temperature for 1 hour, and washed with 0.1 M PBS for 5 minutes 3 times. The liver sections were then covered with a coverslip and observed under a fluorescence microscope. In some liver sections, 3,3′-diaminobenzidine (5 mg of 3,3′-diaminobenzidine and 3.5 μL of 30% H2O2 in 10 mL of 50 mM trishydroxymethylaminomethane buffer) was used as the chromagen to visualize anti-human specific nuclear antigen immunostaining.

Protein Extraction and Western Blot Assay

Liver tissues were rinsed twice with PBS (4°C) and homogenized in a lysis buffer containing 150 mmol/L NaCl, 1.5 mmol/L MgCl2, 5 mmol/L ethylene diamine tetraacetic acid, 1% Triton X-100, 1% Nonidet P40, 10 mmol/L NaF, 1 mmol/L Na3VO4, and a protease inhibitor cocktail (Roche, Indianapolis, IN). The protein concentration of the tissue homogenates was determined with a bicinchoninic acid protein assay kit (Pierce Biotechnology, Rockford, IL). Equal amounts of proteins were loaded onto a 10% acrylamide gel for sodium dodecyl sulfate polyacrylamide gel electrophoresis and immunoblotting with mouse anti–α-smooth muscle actin antibody (1:100; A2547, Sigma) and rabbit anti–mesenchymal epithelial transition factor–phosphorylated type (Met-P) antibody (1:1000; ab5662, Abcam, Inc., Cambridge, MA).

Quantitative Analysis of Liver Fibrosis from Fresh Liver

This assay employed a Sircol soluble collagen assay kit (S1000 Biodye Science, Newtownabbey, United Kingdom) to determine the amount of liver collagen. The right lobe of the liver was taken out and frozen in liquid nitrogen. The tissues (50 mg) were homogenized and then centrifuged in 2.5% pepsin in 0.5 M acetic acid. The supernatant was reacted with the Sircol dye reagent and then centrifuged at 25,000g for 30 minutes. The resulting pellet was mixed with an alkali reagent. The eluted color was read immediately in a spectrophotometer at 540 nm, the wavelength corresponding to the maximal absorbance of Sirius red.

Detection of Human Albumin and α-Fetoprotein in the Liver by RT-PCR

Total RNA was freshly isolated from rat livers with Tri Reagent (Sigma), reversely transcribed into complementary DNA with oligo(dT) primer, and amplified by 35 cycles (94°C, 1 minute; 55°C, 1 minute; and 72°C, 1 minute) of polymerase chain reaction (PCR) with 10 pmol of specific primers. On completion of the PCR, products were examined on 2% agarose gel. Rat glyceraldehyde 3-phosphate dehydrogenase (GAPDH) primers were used as an internal standard. Human hepatoma was used as a positive control.

The primer sequence was as follows:

  • Rat GAPDH

  • Sense: GGGATGGAATTGTGAGGGAGATG

  • Antisense: TGATGCTGGTGCTGAGTATGTCGT

  • Human α-fetoprotein

  • Sense: 5′-TGCCAACTCAGTGAGGACAA-3′

  • Antisense: 5′-TCCAACAGGCCTGAGAAATC-3′

  • Human albumin

  • Sense: 5′-TCCACACGGAATGCTGCCATGG-3.

  • Antisense: 5′-AGCGGCACAGCACTTCTCTAGA-3′

Real-Time PCR

Complementary DNA was produced from cellular RNA (5 μg) with a SuperScript II RNase H-reverse transcriptase kit (Invitrogen). Primers for real-time PCR were designed with Primer Express software (version 1.5, Applied Biosystems, Foster City, CA), and the specificity of sequences was verified with the Basic Local Alignment Search Tool (http://www.ncbi.nlm.nih.gov/blast/). Reactions were performed in 10-μL quantities of the diluted complementary DNA sample, primers (100, 200, or 300 nM), and a SYBR green PCR master mix containing nucleotides, AmpliTaq Gold DNA polymerase, and optimized buffer components (Applied Biosystems). Reactions were assayed with an Applied Biosystems Prism 7700 sequence detection system. The primers used for real-time PCR were as follows:

  • Rat hepatocyte growth factor (HGF)

  • Sense: GACATTCCTCAGTGTTCAGAAGTTG

  • Antisense: TGCCTGATTCTGTGTGATCCA

  • GAPDH

  • Sense: 5′-TGGTATCGTGGAAGGACTCA

  • Antisense: 5′-AGTGGGTGTCGCTGTTGAAG

Human Protein Cytokine Array

To elucidate which human cytokines were involved in the repair of liver fibrosis, a human protein cytokine kit (RayBio Human Cytokine Antibody Array C Series 2000, AAH-CYT-2000, RayBiotech, Inc., Norcross, GA) was used. The rat liver was homogenized and centrifuged in a cell lysis buffer at 1500g to remove cell debris. The supernatant was harvested for the assay. The membranes included in the human protein cytokine array kit were blocked with a blocking buffer. One milliliter of the sample supernatant was individually added to the membranes and incubated at room temperature for 2 hours. The membranes then were analyzed according to the manufacturer's instructions.

Micro Positron Emission Tomography (MicroPET)

A static abdominal and pelvic positron emission tomography (PET) scan was performed 45 minutes after an intravenous bolus injection of 10 mCi of sterile 18F-fluorodeoxyglucose ([18F]-FDG). A GE/Scanditronix PET camera (PC4096-15WB, General Electric Co., Uppsala, Sweden) was used to capture positron images. We used a VAX computer (Digital Equipment Corp., Maynard, MA) as the network server at our center and visualized PET images with a VAX workstation. We used DECnet with Pathwork (Digital Equipment) to connect PCs to the VAX so that PET images could be visualized with software running on Windows 3.1 (Microsoft, Redmond, WA). The PET images were analyzed to identify areas of localized [18F]-FDG uptake in comparison with the surrounding tissues. These areas were considered abnormal and suspicious for recurrent lesions.

Statistical Analyses

All data were presented as mean ± standard error. One-way or 2-way analyses of variance were used to compare all means, and the least significant difference was used for the a posteriori test. In all statistical analyses, P < 0.05 was considered significant.

RESULTS

Reduction in Serum GOT and GPT After Direct Transplantation of HUMSCs into Rat Livers with Liver Fibrosis

In the 8-week experiment, the body weight of normal group rats, which were fed only olive oil, increased from 323 ± 4 to 540 ± 8 g (Fig. 1A). The body weight of the rats that were fed CCl4 was lower than that of rats in the normal group, particularly during the fourth to eighth weeks (P < 0.05). Moreover, some rats had serious ascites. Similarly, the body weight of the rats in the CCl4 (8W)+HUMSC (liver) group was significantly lower than that of the normal group (P < 0.05). No statistical difference in body weight was found between the CCl4 (8W) group and the CCl4 (8W)+HUMSC (liver) group, although the weekly increments of the body weight of the latter were significant from the fifth to eighth weeks.

Figure 1.

Suppression of GPT and GOT levels in the serum after HUMSC transplantation. (A) Changes in body weight in all the groups after feeding with CCl4 for 8 weeks [*P < 0.05 versus the normal group at the same time point; #P < 0.05 between the 2 time points in the CCl4 (8W)+HUMSC (liver) group]. Changes in the levels of (B) serum GOT and (C) GPT. The levels of both GOT and GPT increased significantly 4 and 8 weeks after the rats were fed CCl4 in comparison with the normal group. Transplantation of HUMSCs at week 4, however, significantly reduced both GOT and GPT to levels comparable to those of the normal group at week 8 (*P < 0.05 versus the normal group at the same time point; #P < 0.05 between week 4 and week 8 of the same group, paired t test). Abbreviations: CCl4, carbon tetrachloride; GOT, glutamic oxaloacetic transaminase; GPT, glutamic pyruvate transaminase; HUMSC, human umbilical mesenchymal stem cell.

In the normal group, the levels of serum GOT ranged from 121.30 ± 6.93 to 143.60 ± 5.73 U/L during the period of 8 weeks, whereas the levels of serum GPT were between 38.8 ± 4.64 and 48.60 ± 2.97 U/L (Fig. 1B,C). After 4 weeks of CCl4 treatment, the GOT and GPT levels increased significantly to 2150.22 ± 388.21 and 1536.67 ± 305.89 U/L, respectively (P < 0.05). By continuous feeding with CCl4 until the eighth week, the GOT and GPT levels increased further to 5122.11 ± 998.85 and 3017.78 ± 562.30 U/L, respectively (P < 0.05). In the CCl4 (8W)+HUMSC (liver) group, the levels of serum GOT and GPT were reduced significantly between the fourth week, when HUMSCs were transplanted, and the eighth week (P < 0.05) to a baseline level comparable to that of the normal group.

Suppression of Liver Fibrosis After HUMSC Transplantation

The livers of the rats in the normal group were smooth, lustrous, and reddish on the surface (Fig. 2A). In the rats treated with CCl4 for 4 weeks [CCl4 (4W)], the liver surfaces were coarse and relatively bloodless (Fig. 2B). After 4 more weeks of CCl4 treatment [CCl4 (8W)], the liver surfaces appeared coarser, with numerous small nodules, and were nearly bloodless (Fig. 2C). In the rats of the CCl4 (8W)+HUMSC (liver) group, the liver surfaces were slightly coarse but were more reddish and lustrous (Fig. 2D) than the livers of the CCl4 (4W) and CCl4 (8W) groups.

Figure 2.

Suppression of liver fibrosis after HUMSC transplantation. Representative photographs demonstrate the phenotypes of the fresh livers without fixation in all 4 groups after 8 weeks of experimentation. (A) The liver of the normal group was smooth, lustrous, and reddish. (B) In the rats fed CCl4 for 4 weeks [CCl4 (4W)], the liver surface appeared coarse and relatively bloodless. (C) After 8 weeks of CCl4 treatment [CCl4 (8W)], the liver surface was coarser, with many small nodules, and was nearly bloodless. (D) In the rats receiving HUMSC transplantation [CCl4 (8W)+HUMSC (liver)], the liver surface, though slightly coarse, was more reddish and lustrous than those of the CCl4 (4W) and CCl4 (8W) groups. Photomicrographs show Sirius red staining of liver sections from (E) the normal group, (F) the CCl4 (4W) group, (G) the CCl4 (8W) group, and (H-J) the CCl4 (8W)+HUMSC (liver) group at 72 hours, 2 weeks, and 4 weeks after HUMSC transplantation, respectively. (K) The fibrotic area stained by Sirius red and (L) the amount of soluble collagen in the livers were quantified. The livers of the CCl4 (4W) and CCl4 (8W) groups had significantly high levels of fibrogenesis and collagen, which could be reversed by HUMSC transplants to a baseline level comparable to levels in the normal group [*P < 0.05 versus the normal group; #P < 0.05 between the CCl4 (4W) and CCl4 (8W) groups; scale bar = 100 μm]. Abbreviations: CCl4, carbon tetrachloride; HUMSC, human umbilical mesenchymal stem cell.

To determine the changes in liver fibrosis after the rats were treated with CCl4 and HUMSC transplants, Sirius red was used to identify collagen in the liver tissue slices. The amount of Sirius red–stained collagen fibers was modest in the livers of the normal group (Fig. 2E). The amount of collagen fibers in the liver increased in the CCl4 (4W) group (Fig. 2F) and increased even more in the connective tissue of the interlobular spaces in the CCl4 (8W) group (Fig. 2G). In the rats of the CCl4 (8W)+HUMSC (liver) group, 72 hours after transplantation, the collagen fibers were quite obvious in the liver tissue (Fig. 2H). The collagen fibers gradually decreased after 2 weeks (Fig. 2I) and were reduced to nearly normal levels 4 weeks after transplantation (Fig. 2J).

The Sirius red–stained regions in the liver slices were quantified to determine the percentage of fibrotic areas (Fig. 2K). The results showed that the collagen fibers covered an area of 377.65 ± 78.51 μm2, about 0.07% ± 0.02% of the total liver area in the normal group (Fig. 2K). In the CCl4 (4W) group, the fibrotic area increased significantly to 11258.89 ± 1716.16 μm2, occupying 2.81% ± 0.50% of the total liver area (P < 0.05). In the CCl4 (8W) group, the fibrotic areas of the livers increased more significantly to 39377.04 ± 7704.57 μm2, occupying 9.56% ± 2.03% of the total liver area (P < 0.05; Fig. 2K). In the rats of the CCl4 (8W)+HUMSC (liver) group, the area and percentage of liver fibrosis dropped significantly (P < 0.05) until they approximated those of the normal group (Fig. 2K).

The collagen content in the fresh liver was also quantified (Fig. 2L). The results showed that the amount of collagen in the normal group was 8.54 ± 1.03 μg/mg of liver. The collagen content increased significantly in both the CCl4 (4W) and CCl4 (8W) groups to 30.98 ± 2.76 and 53.16 ± 4.83 μg/mg of liver, respectively (P < 0.05). In the rats of the CCl4 (8W)+HUMSC (liver) group, the collagen content dropped to an amount which approximated that of the normal group (P > 0.05).

Inhibition of Liver Inflammation and Enhancement of Liver Regeneration After HUMSC Transplantation

Western blot assays were used to quantify the α-smooth muscle actin (α-SMA) level in the livers (Fig. 3A). The results showed that the α-SMA levels significantly increased to 135% and 147% in the CCl4 (4W) group and the CCl4 (8W) group, respectively, in comparison with the normal group (P < 0.05). The α-SMA level in the CCl4 (8W)+HUMSC (liver) group approximated the level in the normal group (P > 0.05). Such a reduction in α-SMA was significant compared with the amounts in the CCl4 (4W) and CCl4 (8W) groups (P < 0.05; Fig. 3A).

Figure 3.

The alternation of α-SMA, TGF-β1, Met-P, and HGF in rat livers after HUMSC transplantation. The relative density of (A) α-SMA and (C) Met-P was measured from immunoblot assays and normalized by the value of the normal group [lane 1, normal group; lane 2, CCl4 (4W) group; lane 3, CCl4 (8W) group; lane 4, CCl4 (8W)+HUMSC (liver) group]. The levels of (B) TGF-β1 and (D) rat HGF were detected by enzyme-linked immunosorbent assay and reverse-transcription polymerase chain reaction, respectively [*P < 0.05 versus the normal group; #P < 0.05 between the CCl4 (8W) and CCl4 (8W)+HUMSC (liver) groups].Abbreviations: α-SMA, α-smooth muscle actin; CCl4, carbon tetrachloride; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; HGF, hepatocyte growth factor; Met-P, mesenchymal epithelial transition factor–phosphorylated type; TGF-β1, transforming growth factor-β1.

The transforming growth factor-β1 (TGF-β1) levels in the fresh livers were quantified by enzyme-linked immunosorbent assay (Fig. 3B). The results showed that the levels of TGF-β1 in both the CCl4 (8W) and CCl4 (8W)+HUMSC (liver) groups were significantly higher than that in the normal group (P < 0.05). Nevertheless, the level of TGF-β1 was significantly lower in the CCl4 (8W)+HUMSC (liver) group than in the CCl4 (8W) group (P < 0.05; Fig. 3B).

Western blot analyses were used to quantify the Met-P level in the livers (Fig. 3C). The results showed that treatment with CCl4 alone did not change the level of Met-P in comparison with the normal group. In the rats of the CCl4 (8W)+HUMSC (liver) group, however, there was a statistical increase in Met-P levels compared to those of the normal, CCl4 (4W), and CCl4 (8W) groups (P < 0.05; Fig. 3C).

Real-time RT-PCR was used to quantify the relative expression of rat HGF in fresh livers (Fig. 3D). The results showed that there was no statistical difference (P > 0.05) in the rat HGF levels between the CCl4 (8W) group and the normal group. The rat HGF levels of the CCl4 (8W)+HUMSC (liver) group increased significantly compared to those of the normal group and the CCl4 (8W) group (P < 0.05; Fig. 3D).

Localization and Fate of the Transplanted HUMSCs in the Livers

The liver tissue slices of the CCl4 (8W)+HUMSC (liver) group were immunostained with anti-human specific nuclear antigen to localize the grafted HUMSCs. Engrafted HUMSCs were primarily distributed around the central vein, portal triad, and interlobular connective tissue in both the left (Fig. 4A-D) and right (Fig. 4E,F) lobes of the liver. To determine whether these engrafted HUMSCs differentiated into hepatocytes, we double-stained the HUMSCs with anti-human specific nuclear antigen and anti-human albumin antibodies (Fig. 4G-I). We found that the HUMSCs were negative for anti-human albumin staining, and this suggested that these cells had not differentiated into albumin-expressing hepatocytes. HepG2 cells implanted subcutaneously in rats were used as a positive control for human albumin. Immunostaining revealed that human albumin was located in the cytoplasm and extracellular spaces of the HepG2 cells (Fig. 4J). To further confirm the negative immunostaining of anti-human albumin in HUMSCs, we performed RT-PCR to examine the expression of human albumin at the messenger RNA level. The result showed that engrafted HUMSCs did not express human albumin and α-fetoprotein in the rat liver (Fig. 4K), suggesting that these cells did not differentiate into hepatocytes or form tumors.

Figure 4.

Distribution and characterization of HUMSCs in the liver 4 weeks after transplantation. Representative photomicrographs were taken from (A-D) the left and (E,F) right lobes of the liver of the CCl4 (8W)+HUMSC (liver) group. The nuclei of engrafted HUMSCs (black arrows) were darkly immunostained by anti-human specific nuclear antigen antibody and were distributed primarily around the hepatic portal area and the central vein (see the brownish profiles in panels B-F). Panels B-D are magnified images of the boxed areas in panel A. Insets in panels B, C, and E show the nuclei of engrafted HUMSCs in the blue-boxed area at a higher magnification. Double immunofluorescence revealed that (G) the area surrounding the nuclei of engrafted HUMSCs (rhodamine, white arrows) was negative for (H) anti-human albumin (fluorescein). (I) The digitally merged image suggests that HUMSCs did not differentiate into albumin-expressing hepatocytes. (J) As a positive control, HepG2 cells (green arrow, nuclei counterstained with cresyl violet) expressed human albumin in the cytoplasm and extracellular spaces (brown deposit). (K) The results of reverse-transcription polymerase chain reaction further demonstrated that the grafted HUMSCs did not express human albumin or α-fetoprotein at the messenger RNA level [lane 1, positive control-human hepatoma; lane 2, normal group; lane 3, CCl4 (8W) group; lane 4, CCl4 (8W)+HUMSC (liver) group] The scale bar is 100 μm for panels B-F.Abbreviations: αFP, α-fetoprotein; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; HUMSC, human umbilical mesenchymal stem cell.

Expression of Human Cutaneous T Cell–Attracting Chemokine (CTACK), Leukemia Inhibitory Factor (LIF), and Prolactin in the Fibrotic Liver After HUMSC Transplantation

Liver protein homogenates were prepared from the rats of the normal, CCl4 (8W), and CCl4 (8W)+HUMSC (liver) groups and were incubated with membranes containing an array of 174 human protein cytokine antibodies. Autoradiographs were scanned, and the density of each cytokine at its corresponding position was determined. The relative intensities of each cytokine were normalized to the control spots on the same membrane. Major increases among cytokines are presented graphically in Fig. 5A-F. Human CTACK, LIF, and prolactin were significantly increased in the rat livers of the CCl4 (8W)+HUMSC (liver) group (P < 0.05; Fig. 5G).

Figure 5.

Detection of human cytokines in the liver. Liver homogenates collected from (A,D) the normal group, (B,E) the CCl4 (8W) group, and (C,F) the CCl4 (8W)+HUMSC (liver) group were reacted with an array of 174 human cytokine antibodies on the membranes. (G) The relative intensity of immunoreactivity for CTACK, LIF, and prolactin was measured by densitometry and was significantly higher in the CCl4 (8W)+HUMSC (liver) group in comparison with the intensity of the normal and CCl4 (8W) groups [*P < 0.05 versus the normal and CCl4 (8W) groups]. Abbreviations: CCl4, carbon tetrachloride; CTACK, cutaneous T cell–attracting chemokine; HUMSC, human umbilical mesenchymal stem cell; LIF, leukemia inhibitory factor.

Reduced Liver Inflammation After HUMSC Transplantation to Fibrotic Livers

Rats received an [18F]-FDG injection, and MicroPET was used to detect hepatic inflammation, which is associated with increased metabolic activity. Metabolism of the liver was at the baseline level before CCl4 treatment (Fig. 6A-C). After CCl4 treatment for 4 weeks, the metabolism or inflammation of the rat livers became greater (Fig. 6D-F). Four more weeks after the transplantation of HUMSCs, metabolism in the livers decreased and reverted to the pretreatment level, and this indicated that the inflammatory response had decreased (Fig. 6G-I).

Figure 6.

MicroPET photographs demonstrating reduced inflammation after HUMSC transplantation. Rats were injected with [18F]-FDG and scanned by MicroPET to examine inflammation in the liver (dotted lines), which was associated with increased metabolic rate and [18F]-FDG intake. Photographs from the left to right columns represent coronal sections, horizontal sections, and sagittal sections of the rat, respectively. (A-C) The first row shows the baseline metabolism in the rat before CCl4 treatment. (D-F) The metabolic rate in the liver increased markedly after 4 weeks of CCl4 treatment. (G-I) Four weeks after HUMSC transplantation, the metabolic rate in the liver was restored to the baseline level. Abbreviations: [18F]-FDG, 18F-fluorodeoxyglucose; CCl4, carbon tetrachloride; HUMSC, human umbilical mesenchymal stem cell; MicroPET, micro positron emission tomography.

DISCUSSION

In this study, the percentage of liver fibrosis in the rats of the CCl4 (8W)+HUMSC (liver) group was significantly reduced. Wagers et al.13 showed that transplanted hematopoietic stem cells differentiate at a very low level into hepatocytes in mice without liver dysfunction and that these transplanted cells do not express albumin. Nonome et al.14 demonstrated that transplanted human umbilical cord blood cells differentiate into hepatocyte-like cells in the Fas-mediated, injured liver. They suggested that liver injury and the surrounding environment may be essential for transplanted cells to lodge in the liver and to differentiate into hepatocytes.13, 15-17 Recent studies have suggested that stromal cell–derived factor and its receptor CXCR4 might be important for stem cell recruitment to the liver.18, 19

Previous research has demonstrated that transplanting 1 × 105 bone marrow mesenchymal stem cells into the rat via the tail vein significantly reduces liver fibrosis; however, this treatment reduces only the fibrotic area in the liver from 5.36% ± 0.90% (1 week after transplantation) to 4.16% ± 0.53% (4 weeks after transplantation; P < 0.01).20 In the present study, 5 × 105 HUMSCs were directly transplanted into the liver. We showed a large number of surviving HUMSCs in the liver parenchyma with fibrosis significantly reduced from 9.56% ± 2.03% to 0.13% ± 0.03% 4 weeks after the transplantation. Our findings suggest that the abundance of grafted HUMSCs in the liver is critical for the reduction of liver fibrosis.

We noticed that bleeding must be controlled to a minimum level during transplantation to enhance the curative effect of grafted HUMSCs. This result is in line with previous observations by Bruns et al.,21 who transplanted 2.5 × 105 liver cells into the lower part of the liver with the use of fibrin gel to stop the bleeding. Previous experiments showed that hemorrhaging may activate platelet-derived growth factor, which induces the activation and proliferation of hepatic stellate cells, leading to increased liver inflammation.22

Hepatic stellate cells play a central role in the pathogenesis of hepatic fibrosis.23, 24 When activated, hepatic stellate cells transform into myofibroblast-like cells expressing α-SMA along with several key phenotypic changes, which collectively increase extracellular matrix accumulation. As such, the expression of α-SMA in the liver is an indicator for the activation of hepatic stellate cells and consequent liver fibrogenesis.2, 25 In the present study, levels of α-SMA in the fresh liver significantly decreased after HUMSC transplantation (Fig. 3A). This finding may account for the reduced fibrogenesis in the HUMSC-grafted liver.

Paracrine and autocrine stimulation by TGF-β1 promotes the activation of hepatic stellate cells. TGF-β1 stimulates the production of extracellular matrices and suppresses matrix degradation by inhibiting matrix metalloproteinases, thereby facilitating the deposition of extracellular matrix in the liver.23, 24, 26, 27 Furthermore, TGF-β1 suppresses the growth, structure, and function of surrounding hepatocytes.28, 29 In our experiment, HUMSC transplantation reduced the level of TGF-β1, and this indicated a decrease in the activation of hepatic stellate cells and thus a reduction in inflammation (Fig. 3B).

As shown in this study, direct transplantation of HUMSCs into the rat liver can reduce liver fibrosis to the same level as that seen in the normal group. Reduced fibrosis in the HUMSC-grafted liver is accompanied by increased expression of Met-P, which promotes the phosphorylation of cellular mesenchymal epithelium transition (c-Met), the membrane receptor for HGF. Thus, our results suggest a possibility of increased binding between HGF and its receptor c-Met in the liver after HUMSC transplantation. When HGF is generated in a mass amount, it leads to liver cell proliferation to fill up the lost space.30

Previous studies have demonstrated that umbilical cord blood cells can differentiate into hepatocyte lineage cells in the original primary culture system in vitro5 and into functionally mature hepatocytes in vivo.7, 15, 16 Likewise, bone marrow mesenchymal stem cells can be induced in vitro to express markers of differentiated hepatocytes.6, 31 Administration of bone marrow mesenchymal stem cells has been shown to reduce fibrogenesis in the chronically injured liver.8 In our study, HUMSCs survived and scattered in the liver 4 weeks after transplantation; however, they did not differentiate into albumin-expressing or α-fetoprotein–expressing hepatocytes (Fig. 4). Therefore, the effect of HUMSCs on reducing fibrogenesis most likely relies on bioactive factors or cytokines released from the grafted HUMSCs to trigger liver regeneration rather than on the differentiation of these cells into hepatocytes.

Convergent evidence has shown that multipotent bone marrow mesenchymal stem cells can inhibit the function of various immune cells by undefined paracrine mediators in vitro, although controversy exists about the identity of the responsible mediators.32-36 Mesenchymal stem cell–derived molecules, including chemotactic cytokines or chemokines, can modulate the immune response by altering leukocyte migration and thus are an effective therapeutic modality for inflammatory liver diseases.37 Similarly, bone marrow mesenchymal stem cells can secrete many cytokines and growth factors such as HGF,38 which shows antiapoptotic activity in hepatocytes and plays an essential part in the regeneration of the liver,39 and nerve growth factor,40 which can induce apoptosis in cultured hepatic stellate cells.41 In the acute phase of ischemic injury, moreover, bone marrow mesenchymal stem cells used for cellular cardiomyoplasty produce soluble molecules that inhibit hypoxia-induced apoptosis of cardiomyocytes.42, 43 Taken together, these studies suggest that mesenchymal stem cells can independently modulate the immune response and affect cellular viability through paracrine effects.

In the HUMSC-grafted liver, the expression of human CTACK, LIF, and prolactin was up-regulated, as evidenced by our results of the human cytokine array. Omori et al.44 suggested that LIF is related to liver regeneration because the interaction of LIF-LIF receptors is involved in the division of oval cells to hepatic cells. Van Thiel and colleagues45 proposed that the ability of liver regeneration is closely related to age and sex hormones. Francavilla et al.46 suggested that estrogen can effectively increase liver regeneration both in vivo and in vitro.

As for prolactin, Makowka et al. found that serum prolactin is increased in rats subjected to a two-thirds partial hepatectomy and cyclosporine treatment. Such an increased expression of prolactin is associated with enhanced liver functionality and liver cell regeneration.47, 48 Therefore, prolactin is widely considered to be a hepatotrophic hormone.49

A previous study has shown that intradermal injection of CTACK/chemokine (C-C motif) ligand 27 (CCL27) into the periphery of skin wounds significantly enhances the migration of bone marrow–derived keratinocytes. This enhanced migration can be inhibited by an antibody that neutralizes CTACK/CCL27, and this suggests a promotive role for CTACK/CCL27 in cell migration.50 In our study, therefore, increased expression of CTACK by engrafted HUMSCs may have facilitated the migration of HUMSCs or stem cells of the host, resulting in their extensive distribution in the hepatic connective tissue.

In conclusion, sufficient amounts of HUMSCs in rat livers can secrete cytokines, reduce the activation of hepatic stellate cells, enhance liver cell repair, and effectively cure liver fibrosis.

Acknowledgements

We are grateful to Dr. Jung-Yu C. Hsu for a critical reading of the manuscript and valuable suggestions. We also thank Deborah Airo for her helpful remarks and editorial assistance.

Ancillary