SEARCH

SEARCH BY CITATION

Abstract

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. REFERENCES
  7. Supporting Information

Mesenchymal stem cell (MSC) therapy can prevent hepatic parenchymal cell loss and promote tissue repair. However, poor MSC engraftment is one of the primary barriers to the effectiveness of cell therapy because culture-expanded MSCs progressively down-regulate C-X-C chemokine receptor type 4 (CXCR4) expression and lose their ability to migrate toward a concentration gradient of stromal cell–derived factor 1a (SDF1a). In this study, we investigated whether a CXCR4-MSC infusion could protect hepatocytes and stimulate regeneration in 50% reduced size liver transplantation (RSLT). Rats that underwent 50% RSLT were randomly divided into 3 groups: a phosphate-buffered solution group (PBS), a green fluorescent protein (GFP)–MSC group, and a CXCR4-MSC group. Rats received 1 mL of PBS with or without a resuspension of GFP-MSCs or CXCR4-MSCs. The factors secreted by MSCs, the graft function, the apoptosis and proliferation of hepatocytes, the efficacy of MSC engraftment, and the expression of SDF1α, albumin (Alb), and cytokeratin 18 (CK18) in engrafted GFP-positive MSCs were assessed. A systemic infusion of GFP-MSCs led to a reduction of the release of liver injury biomarkers and apoptosis of hepatocytes; CXCR4 overexpression did not further reduce the liver injury. However, CXCR4 overexpression enhanced MSC engraftment in liver grafts, improved the effect on the proliferation of hepatocytes, and thus provided a significant 1-week survival benefit. SDF1α expression in grafts was elevated after transplanted CXCR4-MSCs were recruited to the remnant liver. However, engrafted MSCs did not express the markers of hepatocytes, including Alb and CK18, in vivo 168 hours after transplantation. CXCR4 overexpression enhanced the mobilization and engraftment of MSCs into small-for-size liver grafts, in which these cells promoted the early regeneration of the remnant liver not by direct differentiation but perhaps by a paracrine mechanism. Liver Transpl 19:215-225, 2013. © 2012 AASLD.

Abbreviations
Ad-CXCR4

C-X-C chemokine receptor type 4 adenovirus

Ad-null-GFP

null green fluorescent protein adenovirus

Alb

albumin

ALT

alanine aminotransferase

AST

aspartate aminotransferase

CK18

cytokeratin 18

CXCR4

C-X-C chemokine receptor type 4

EGFP

enhanced green fluorescent protein

ELISA

enzyme-linked immunosorbent assay

GAPDH

glyceraldehyde 3-phosphate dehydrogenase

GFP

green fluorescent protein

HGF

hepatocyte growth factor

HPF

high-power field

IL-6

interleukin-6

LT

liver transplantation

mRNA

messenger RNA

MSC

mesenchymal stem cell

PBS

phosphate-buffered solution

PCR

polymerase chain reaction

qRT-PCR

quantitative real-time polymerase chain reaction

RSLG

reduced size liver graft

RSLT

reduced size liver transplantation

SDF1

stromal cell-derived factor 1

TUNEL

terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate nick-end labeling

VEGF

vascular endothelial growth factor.

Liver transplantation (LT) is the only effective therapy for patients with end-stage liver disease; however, the shortage of donor organs limits its widespread application. Reduced size liver transplantation (RSLT), including living donor LT and split LT, has in part alleviated this problem.[1, 2] However, the ischemia/reperfusion injury associated with RSLT is unavoidable and serious, and it impairs remnant liver regeneration.[3-5] Therefore, effective treatment strategies aimed at inhibiting the death of hepatocytes and stimulating the regeneration of hepatocytes would be beneficial.

Recent studies have shown that mesenchymal stem cells (MSCs) from bone marrow have the potential to inhibit the death of hepatocytes and stimulate liver regeneration after acute or chronic liver injury via a paracrine mechanism or to directly differentiate into hepatocytes and repopulate the injured liver.[6-15] In addition to promoting tissue repair directly, MSCs have also been shown to modulate the immune system and attenuate tissue damage caused by excessive inflammation. Therefore, cell therapy based on MSCs may be an effective auxiliary therapy for RSLT. However, only a very small number of systemic transplanted MSCs are retained in the injured tissues, and poor cell engraftment is one of the primary barriers to the effectiveness of cell therapy.[11, 16, 17] This may be due to the decreased ability of the infused cells to respond to homing signals emanating from the injured tissues. Thus, techniques that enhance the recruitment and retention of transplanted MSCs are crucial for replenishing the resident progenitor cell pool and maximizing its regenerative potential.

Stromal cell–derived factor 1α (SDF1α), which is secreted by cells within injured tissues, and its receptor, C-X-C chemokine receptor type 4 (CXCR4), appear to be crucial for the migration of MSCs to certain damaged tissues, including ischemic myocardium, fractured bones, and damaged kidneys and livers.[18-29] MSCs in the bone marrow express high levels of CXCR4. However, CXCR4 expression is markedly reduced during the ex vivo expansion of MSCs.[30] Therefore, the lack of surface expression of CXCR4 by MSCs may lead to low efficiency in the homing of systemic infused MSCs toward the damaged tissues.

Studies have demonstrated that MSCs are increased in peripheral blood and damaged tissues, including damaged livers; moreover, these cells coexpress CXCR4.[26, 31-33] This suggests that mobilized MSCs may participate in tissue repair, and the expression of CXCR4 on the surface of these cells plays an important role in the specific migration to damaged tissues. Using MSC-expressing luciferase and bioluminescence imaging, Granero-Moltó et al.[27] determined that in living animals, MSC migration at the fracture site is exclusively CXCR4-dependent. These in vivo findings were further strengthened by the results of in vitro migration studies showing that cells were attracted to damaged liver tissue, with 90% expressing CXCR4.[26] Therefore, the presence of CXCR4 is essential for the homing of MSCs to injured sites. The up-regulation of CXCR4 expression has improved the engraftment and repopulation of MSCs in several animal models, including ischemic myocardium, irradiated intestines, and acute or chronic liver injury.[21-23, 26, 29, 34] The critical contribution of CXCR4 expression in MSCs to their therapeutic effects is further supported by the fact that the inhibition of CXCR4 by CXCR4 microRNA or treatment with a CXCR4-neutralizing antibody before MSC transplantation significantly reduces the homing of transplanted MSCs to ischemic myocardium or fracture sites and abrogates their therapeutic effects.[21, 25, 35]

In addition to the importance of CXCR4 in the tissue-specific migration and engraftment of stem cells and the potential of MSCs in liver regeneration therapy, bone marrow–derived MSCs are also easily cultured and expanded in vitro. In the current study, we transduced CXCR4 into rat MSCs through an adenovirus infection, and we examined its effects on the migration and engraftment of MSCs and the feasibility of using the systemic transplantation of CXCR4-expressing MSCs to treat rats undergoing 50% RSLT. Overexpression of CXCR4 in MSCs enhanced the MSC response to SDF1α in vitro and increased their engraftment in reduced size liver grafts (RSLGs). Moreover, overexpression of CXCR4 in MSCs enhanced the cellular release of paracrine factors, including vascular endothelial growth factor (VEGF), hepatocyte growth factor (HGF), and interleukin-6 (IL-6), which contributed to liver regeneration. We detected that most of the engrafted green fluorescent protein (GFP)–labeled MSCs did not express markers of hepatocytes, including albumin (Alb) and cytokeratin 18 (CK18), and this suggested that the resident MSCs did not differentiate into hepatocyte-like cells in vivo 7 days after transplantation.

MATERIALS AND METHODS

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. REFERENCES
  7. Supporting Information

Generation of the Recombinant Adenovirus Vector

The CXCR4 gene sequence was amplified by polymerase chain reaction (PCR) from a pExpress-1 plasmid (Open Biosystems, United States), and the specific primer sequences were GAGGATCCCCGGGTACCGGTCGCCACCATGGAAATATACACTTCGGA and TCACCATGGTGGCGACCGGGCTGGAGTGAAAACTTGAG. After the pDC315–enhanced green fluorescent protein (EGFP) plasmid was digested with AgeI, the PCR product was inserted into the AgeI restriction site with a Clontech In-Fusion PCR cloning kit (Clontech Laboratories, Inc., Mountain View, CA) to produce the recombinant vector pDC315-CXCR4-GFP. The vectors pDC315-CXCR4-GFP and pDC315-EGFP and the adenovirus genomic plasmid pBHGloxdeltaE13Cre were cotransfected into human embryonic kidney 293 cells to obtain the recombinant C-X-C chemokine receptor type 4 adenovirus (Ad-CXCR4) and the null green fluorescent protein adenovirus (Ad-null-GFP), respectively.

Preparation of MSCs and CXCR4 Labeling

MSCs from rat bone marrow were isolated and cultured as previously described.[21] The characteristics of the MSCs are shown in Supporting Fig. 1. Passage 3-4 MSCs were transduced with dilutions of concentrated Ad-CXCR4 or Ad-null-GFP as previously described.[21] Because the recombinant adenovirus expressed both GFP and CXCR4, the transfection efficiency of MSCs with the viral system was evaluated via fluorescence microscopy and flow cytometry 72 hours after the infection.

Migration Assay In Vitro

Cell migration was analyzed with Boyden chambers with 5-μm pore membranes (Corning, Corning, NY) as previously described.[21] In brief, 3 days after the infection, GFP-MSCs or CXCR4-MSCs (1 × 105) in a medium (100 μL) were added to the upper chamber, and a medium (600 μL) with or without SDF1α (0, 10, or 50 ng/mL) was placed in the lower chamber. After incubation for 4 hours, cells that had migrated beneath the surface of the filters were stained with Giemsa stain and counted microscopically.

Animal Experimental Design and Surgical Procedure

Syngeneic male Sprague-Dawley rats (220-280 g; Shanghai Laboratory Animal Center, Shanghai, China) were used as both donors and recipients, and the weight difference between the donors and the recipients was less than 10 g. The study protocol conformed to the guidelines for the care and use of laboratory animals of Shanghai Jiaotong University. The experiments were conducted in 3 groups of rats: (1) a CXCR4-MSC group, (2) an GFP-MSC group, and (3) a phosphate-buffered solution (PBS) control group. Fifty percent orthotopic LT without hepatic arterial reconstruction was performed as previously described.[36] In brief, each reduced graft was composed of the right portion of the median lobe and the right lobe; the infrahepatic inferior vena cava and the portal vein were rebuilt with the 2-cuff technique; and the suprahepatic inferior vena cava was rebuilt end to end with a continuous 7-0 Prolene suture. All surgical procedures were performed by a single operator under the naked eye. Each liver graft was preserved in Ringer's solution at 4°C before implantation. The cold preservation time of the graft was 55 to 65 minutes, and the anhepatic phase lasted 15 to 18 minutes. After restoration of the blood flow, the cuff extensions of the portal vein and infrahepatic inferior vena cava were cut off. The abdominal incision was closed with continuous sutures, and this was followed by an infusion of MSCs (1 × 107 GFP-MSCs or CXCR4-MSCs resuspended in 1 mL of PBS) or 1 mL of PBS into the penile vein. We used 20 animals per group for the sample collection [which were sacrificed at 24, 48, 72, and 168 hours (n = 5 per time point)] and 15 animals per group for the survival analysis. The median lobe of the liver and blood samples were collected. Part of the tissue was fixed, and the remaining tissues and serum samples were stored at −80°C.

Serum Analysis

Alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels were measured with an autoanalyzer (Beckman DXC 600, Beckman Coulter, Inc., Brea, CA).

Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR) and Enzyme-Linked Immunosorbent Assay (ELISA) for Measurements of Cytokines

Total RNA was extracted from MSCs (for VEGF, HGF, and IL-6) or liver tissues (for SDF1α) with TRIzol (Invitrogen, Carlsbad, CA). qRT-PCR was performed as shown in the supporting information. The sequences of PCR primers are listed in Table 1.

Table 1. Primers Used for Real-Time PCR
GeneForward PrimerReverse Primer
VEGF5′-TGG TCT TTC GTC CTTT CTT AGA G-3′5′-GAT GGG TTT GTC GTG TTT C-3′
HGF5′-AGGCGAGGAGAAACGCAAA-3′5′-GATCAATCCAGTGTAGCCCCA-3′
IL-65′-GAT TGT ATG AAC AGC GAT GAT G-3′5′-CTC CAG GTA GAA ACG GAA CTC-3′
SDF1α5′-AGAGCCAACGTCAAACATCT-3′5′-CAGGGGTCTACTGGAAAGTC-3′
GAPDH5′-CAAGGTCATCCATGACAACTTTG-3′5′-GTCCACCACCCTGTTGCTGTAG-3′

The concentrations of VEGF, HGF, and IL-6 were measured in supernatants obtained from MSCs, GFP-MSCs, and CXCR4-MSCs, with each grown under 12-hour normoxic conditions with a commercially available ELISA kit (R&D Systems China Co., Ltd., Shanghai, China.) according to the manufacturer's instructions.

For the SDF1α ELISA, liver tissue extracts taken 24, 72, and 168 hours after the operation were prepared with a ProteoJET mammalian cell lysis reagent (Fermentas, Vilnius, Lithuania) and protease inhibitor cocktail. The total proteins in these extracts were quantified with a bicinchoninic acid assay (Pierce, Rockford, IL), and equal protein amounts were assayed for SDF1α according to the manufacturer's instructions.

Western Blotting for Caspase-3

After the total liver protein was isolated and quantified, western blotting for caspase-3 was performed as previously described.[21]

Hepatic Apoptosis Assessment

An in situ cell death detection kit (Calbiochem, Cambridge, MA) was used to detect hepatic apoptosis by terminal deoxynucleotidyl transferase–mediated deoxyuridine triphosphate nick-end labeling (TUNEL), which was followed by rhodamine-labeled lectin lens culinaris agglutinin (Vector Laboratories, Burlingame, CA). Ten random fields were counted in every liver section at 20× magnification. The number of apoptotic nuclei per field was counted, and the results were expressed as TUNEL-positive cells per high-power field (HPF).

Immunohistology of Ki-67

Fixed liver tissues were embedded in paraffin, and 4-μm sections were used for immunohistochemistry. Immunohistochemical staining for Ki-67 (Abcam, Cambridge, United Kingdom) was performed with an ABC staining kit (Vector Laboratories) according to the manufacturer's recommendations. Ki-67–positive cells were quantified via the counting of hepatocytes in 10 random fields with a 40× objective.

Detection of MSCs Migrating Into Liver Grafts

Cryostat sections (15 μm thick) were air-dried, fixed in 4% paraformaldehyde for 10 minutes, and directly assessed for GFP expression and localization with 4′,6-diamidino-2-phenylindole counterstaining under a fluorescence microscope. Ten random fields were counted in every liver section at 40× magnification. The number of MSCs per field was counted, and the results were expressed as migrating MSC cells per HPF.

Determination of the Hepatic Differentiation of Engrafted GFP-Positive MSCs in Remnant Livers 168 Hours After the Operation

Immunofluorescent staining was performed to detect whether the engrafted GFP-positive MSCs expressed markers of hepatocytes, including Alb and CK18. Cryostat sections were fixed in cold acetone and then incubated with a primary sheep anti-rat Alb monoclonal antibody (Bethyl, Montgomery, AL) at a 1:500 dilution or with a primary mouse anti-rat CK18 monoclonal antibody (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) at a 1:200 dilution overnight at 4°C. The sections were then incubated at 37°C for 1 hour with a cyanine 3–conjugated donkey anti-sheep secondary antibody (Jackson ImmunoResearch, West Grove, PA) or a rhodamine-conjugated goat anti-mouse secondary antibody (Invitrogen), respectively, at a dilution of 1:100 in PBS.

Statistical Analysis

Data are expressed as means and standard deviations and were analyzed with a 1-way analysis of variance plus Tukey's post hoc test for multiple comparisons or the Student t test for 2-group paired comparisons. A P value < 0.05 was considered significant.

RESULTS

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. REFERENCES
  7. Supporting Information

CXCR4-Transduced MSCs Are More Responsive to SDF1α In Vitro

Seventy-two hours after transduction, 100% of CXCR4-MSCs were GFP-positive (Fig. 1A,B), and 98.44% of CXCR4-MSCs were CXCR4-positive (Fig. 1C); however, only 8.61% of GFP-MSCs were CXCR4-positive (Fig. 1C). To determine whether an SDF1α-CXCR4 interaction was involved in the stem cell migration, a Transwell migration system was used to study the migration of MSCs transduced with Ad-null or Ad-CXCR4 to a gradient of SDF1α. We observed that the exposure of CXCR4-MSCs to SDF1α for 4 hours caused robust cell migration in a concentration-dependent manner. Cell migration was significantly higher in the CXCR4-MSC group in the presence of SDF1α (10 and 50 ng/mL) versus the GFP-MSC group (Fig. 1D).

image

Figure 1. CXCR4-transduced MSCs are more responsive to SDF1α in vitro. (A) MSCs were transduced with Ad-null or Ad-CXCR4. (B) The transduction efficiency of MSCs was determined via flow cytometry with a GFP marker. (C) The cell surface expression of CXCR4 (the percentage of cells) was determined via flow cytometry 72 hours after the infection. (D) Cell migration. Chemotaxis experiments were performed with Transwells (5-μm pores). Ad-CXCR4 MSCs or Ad-null MSCs (1 × 105) in a medium (100 μL) were added to the upper chamber, and a medium (600 μL) with or without SDF1α (0, 10, or 50 ng/mL) was placed in the bottom chamber. After 4 hours of incubation, the migrating cells were counted. The exposure of Ad-CXCR4-MSCs to SDF1α for 4 hours resulted in strong cell migration in a concentration-dependent manner. Cell migration was significantly higher in the Ad-CXCR4 group in the presence of SDF1α (10 and 50 ng/mL) versus the Ad-null group (P < 0.05). *P > 0.05, null group vs GFP-MSCs group; #P >0.05, 0 ng/mL vs 10 ng/mL or 10 ng/mL vs 50 ng/mL.

Download figure to PowerPoint

Overexpression of CXCR4 Promotes MSC Secretion of Factors In Vitro

To test our hypothesis that the overexpression of CXCR4 in MSCs enhances the cellular release of paracrine factors that contribute to the homing of stem cells, hepatic cell proliferation, and neovascularization, we examined the expression of several factors with quantitative PCR and ELISA. Genes regulating VEGF, HGF, and IL-6 expression were up-regulated in CXCR4-MSCs in vitro (Fig. 2A). ELISA results also demonstrated that CXCR4-MSCs produced significantly higher VEGF, HGF, and IL-6 protein levels in vitro in comparison with GFP-MSCs (Fig. 2B).

image

Figure 2. CXCR4 overexpression stimulates MSCs to secrete more factors in vitro. (A) qRT-PCR. VEGF, HGF, and IL-6 gene expression in CXCR4-MSCs was increased in comparison with that in GFP-MSCs and MSCs (P < 0.05). No difference was observed between the GFP-MSCs and MSCs (P > 0.05). (B) ELISA. VEGF, HGF, and IL-6 protein levels in the supernatants of the CXCR4-MSC group were significantly up-regulated in comparison with those in the GFP-MSC group and the PBS group (GFP-MSC group vs CXCR4-MSCs group; P < 0.05). No significant difference was observed between GFP-MSCs and MSCs (P > 0.05).*P < 0.05 for the CXCR4-MSC group versus the GFP-MSC group.

Download figure to PowerPoint

GFP-MSC Therapy Inhibits Liver Enzyme Release and Hepatic Apoptosis and Decreases Caspase-3 Levels in RSLGs, but CXCR4 Overexpression Does Not Improve These Protective Effects of MSCs

Twenty-four hours after the operation, the recipients developed liver dysfunction with significantly lower ALT and AST levels in the GFP-MSC group versus the PBS-treated group. However, a CXCR4-MSC infusion did not reduce liver enzyme release in comparison with GFP-MSC therapy (Fig. 3A). In comparison with the levels in the PBS-treated group, the levels of ALT and AST in the GFP-MSC and CXCR4-MSC groups had decreased significantly at 72 and 168 hours, but no difference was found between the GFP-MSC and CXCR4-MSC groups. The levels of ALT and AST in the GFP-MSC and CXCR4-MSC groups were normal at 168 hours (Supporting Fig. 2). Many apoptotic hepatocyte nuclei in liver sections were also observed in the PBS-treated group 24 hours after the operation, and the number of apoptotic hepatocytes decreased after GFP-MSC therapy; however, CXCR4 overexpression did not further reduce hepatic apoptosis (Fig. 3B). Western blotting also showed that an infusion of MSCs decreased caspase-3 expression in RSLGs 24 hours after the operation, but there was no significant difference between the CXCR4-MSC group and the GFP-MSC group (Fig. 3C). These results suggest that an MSC infusion can promote the survival of hepatocytes in RSLGs, and CXCR4 overexpression does not enhance the protective effect of MSCs 24 hours after the operation.

image

Figure 3. GFP-MSC therapy inhibits liver enzyme release and hepatic apoptosis and decreases caspase-3 levels in RSLGs, but CXCR4 overexpression does not improve these protective effects of MSCs. (A) ALT and AST enzyme levels in serum samples collected from normal rats and 24 hours after treatment with PBS, GFP-MSCs, or CXCR4-MSCs (5 rats per group). (B) Images of hepatic apoptosis and quantitative analysis. Liver samples taken after 24 hours were stained via TUNEL (red). Representative 20× images from PBS-treated, GFP-MSC–treated, and CXCR4-MSC–treated rats are shown. (C) Western blotting and semiquantitative analysis of caspase-3 in the 3 groups (P > 0.05 for the GFP-MSC group versus the CXCR4-MSC group, *P < 0.05 for the PBS group versus the GFP-MSC group, and #P < 0.05 for the PBS group versus the CXCR4-MSC group).

Download figure to PowerPoint

CXCR4 Overexpression Improves the Engraftment of MSCs, Up-Regulates the Expression of SDF1α, Enhances Hepatocyte Proliferation in RSLGs, and Improves Animal Survival

To determine whether MSCs overexpressing CXCR4 could be incorporated into liver tissue, rats used in the survival study were killed 1 week after the operation, and the GFP-positive cells were quantitated. The number of positive cells was approximately 3 to 10 cells per 40× field in CXCR4-MSC rats; however, there were only 0 to 2 cells per 40× field in GFP-MSC rats (P < 0.05; Fig. 4A).

image

Figure 4. CXCR4 overexpression improves the engraftment of MSCs, up-regulates the expression of SDF1α, enhances hepatocyte proliferation in RSLGs, and improves animal survival. (A) Migration of MSCs into liver grafts and quantitative analysis of GFP-positive cells. Representative images from GFP-MSC–treated rats and CXCR4-MSC–treated rats are shown. CXCR4 overexpression improved the engraftment of MSCs into the liver grafts. A significant increase in the number of cells migrating into the liver was observed in the CXCR4-MSC group versus the GFP-MSC group (*P < 0.05). (B) SDF1α mRNA and protein levels were up-regulated in CXCR4-MSC–transplanted liver grafts according to quantitative PCR and ELISA, respectively. SDF1α was detected 24 and 72 hours after the operation, and a significant increase at 168 hours was observed in the CXCR4-MSC group versus the GFP-MSC group (P < 0.05). No significant difference was observed between the GFP-MSC group and the PBS group (P > 0.05). (C) Representative images of immunohistochemical staining of Ki-67 at 168 hours from the 3 groups and time lines for Ki-67. An infusion of CXCR4-MSCs promoted hepatic proliferation at 168 hours. The time lines of Ki-67 illustrate that hepatocyte proliferation remained high in the CXCR4-MSC group at 168 hours; however, after reaching its peak at 72 hours, hepatocyte proliferation declined until 168 hours in the other 2 groups. (D) Kaplan-Meier survival analysis of RSLT rats. Seven of 15 PBS-treated rats died, and GFP-MSC therapy did not improve the survival rate of RSLT rats (P > 0.05 for the GFP-MSC group versus the PBS group). However, only 2 CXCR4-MSC–treated rats died. CXCR4 overexpression improved animal survival (*P < 0.05 for the CXCR4-MSC group versus the GFP-MSC group).

Download figure to PowerPoint

Generally, SDF1α increases during tissue damage and subsequently mediates the homing of circulating progenitor cells to injured tissue by binding to its receptor CXCR4 on progenitor cells. However, the expression pattern of SDF1α after CXCR4-positive MSC migration into a damaged liver is unclear. Therefore, we investigated the expression pattern of SDF1α in RSLT after CXCR4-MSC therapy. An ELISA analysis of SDF1α in liver tissues from PBS-injected, GFP-MSC, and CXCR4-MSC rats that underwent transplantation was performed 24, 72, and 168 hours after the operation. Interestingly, SDF1α was significantly elevated 168 hours after CXCR4-MSC engraftment in liver grafts in comparison with 24 and 72 hours, and a significant increase was observed in the CXCR4-MSC group versus the GFP-MSC group (P < 0.05). However, no difference was observed between the GFP-MSC group and the PBS group (P > 0.05; Fig. 4B), and this may have been due to the very small amount of GFP-MSC engraftment in the liver grafts.

We further determined the effects of CXCR4-MSCs and GFP-MSCs on remnant liver regeneration. Ki-67–positive hepatocytes were quantified in the 3 groups at 48, 72, and 168 hours. No obvious increase in the number of proliferating hepatocytes was observed in the CXCR4-MSC group versus the GFP-MSC and PBS-treated groups at 48 and 72 hours (Supporting Fig. 3). However, CXCR4 overexpression significantly enhanced the effect of MSCs on hepatocyte proliferation at 168 hours. The time lines of Ki-67 illustrate that hepatocyte proliferation remained high in the CXCR4-MSC group at 168 hours; however, after reaching its peak at 72 hours, hepatocyte proliferation declined until 168 hours in the other 2 groups (Fig. 4C).

Moreover, GFP-MSC therapy did not exhibit a significant 1-week survival benefit in comparison with the PBS-treated group. However, a CXCR4-MSC infusion significantly improved animal survival in comparison with the GFP-MSC group and the PBS-treated group. Animals often died 1 to 4 days later in the 3 groups, probably because of liver dysfunction; no animal died because of technical problems (Fig. 4D).

These results show that CXCR4 overexpression in MSCs improved their engraftment in RSLGs and thus perhaps enhanced hepatocyte proliferation in a paracrine manner; it up-regulated the expression of SDF1α in RSLGs and also resulted in reduced mortality for the recipient animals.

Engrafted GFP-Positive MSCs Do Not Differentiate Into Hepatocytes In Vivo 168 Hours After Transplantation

Most of the GFP-labeled cells did not express Alb and CK18 after GFP-MSC or CXCR4-MSC transplantation (Supporting Fig. 4), and this suggests that the resident MSCs did not differentiate into hepatocyte-like cells in vivo 168 hours after transplantation.

DISCUSSION

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. REFERENCES
  7. Supporting Information

In response to liver damage, bone marrow–derived stem cells proliferate and mobilize to the peripheral blood and finally migrate to the damaged liver for participation in regeneration by a direct differentiation process.[6, 11, 12, 26, 36-38] MSCs also can secrete cytokines and growth factors, some of which are known to have antiapoptotic, anti-inflammatory, immunosuppressive, and liver regeneration–promoting effects.[7, 8, 16, 17, 39, 40] Therefore, MSC transplantation may be a feasible alternative to RSLT. For cell transplantation therapy, it is important that cells migrate specifically to damaged tissues. The CXCR4/SDF1α axis is responsible for the mobilization of progenitor stem cell migration to injured tissues, and SDF1α is usually up-regulated in injured tissues.[18-20] In models of liver and kidney injury, bone fractures, and ischemic myocardium, a major fraction of mobilized and engrafted progenitor stem cells coexpress CXCR4.[21-27, 30-33] The transplantation of MSCs overexpressing CXCR4 has also demonstrated significant protection against ovariectomy-induced bone loss[41] and augments myoangiogenesis in infarcted myocardium[21-23, 29]; this suggests that overexpression of CXCR4 contributes to the enhanced efficacy of MSC therapy.

On the basis of these findings, we believe that the expression of CXCR4 in MSCs may be necessary for their recruitment into RSLGs. Our study has confirmed that more CXCR4-MSCs than null MSCs migrate to RSLGs, and the overexpression of CXCR4 in MSCs enhances the MSC response to SDF1α in a dose-dependent manner in vitro. CXCR4 overexpression in MSCs also results in an increased secretion of matrix metalloproteinase 9 under hypoxic conditions,[12, 29] and this assists with their migration and engraftment in liver parenchyma because hypoxic events are localized in RSLT on account of a large amount of sinusoidal endothelial cell loss after ischemia/reperfusion.[3-5, 42, 43]

MSCs have been shown to protect hepatocytes from injury in acute and chronic liver injury models, including LT. In our study, a systemic infusion of GFP-MSCs reduced injury to hepatocytes in RSLGs 24 hours after transplantation. This may have occurred because MSCs secrete many cytokines and growth factors, some of which are known to have antiapoptotic, anti-inflammatory, and immunomodulating effects and thus modulate the immune system and attenuate tissue damage caused by excessive inflammation. However, CXCR4 overexpression in MSCs did not further reduce injury. We speculate that ischemia/reperfusion injury after RSLT is a predominant factor on day 1, and MSCs do not reach the injured liver graft during this period. This is consistent with a study by Yu et al.[11] However, in contrast to GFP-MSCs, MSCs overexpressing CXCR4 have a better ability to promote liver regeneration after RSLT and improve 1-week survival in animals undergoing 50% RSLT. This may be due to several mechanisms, as described next.

First, in our study, CXCR4 overexpression in MSCs increased their engraftment in RSLGs in comparison with null MSCs. CXCR4 overexpression in MSCs can improve SDF1-induced proliferation and survival,[18, 19, 21, 22, 44] and this can result in significantly higher levels of in vivo repopulation in comparison with control cells.

Second, our results demonstrated that SDF1α expression was induced after RSLT and was up-regulated after CXCR4-MSCs were engrafted into RSLGs. Jung et al.[45] also reported that SDF1α expression in the liver was observed after a carbon tetrachloride injection, and it was elevated after CXCR4-positive cells of transplanted bone marrow cells were recruited to the damaged liver. Therefore, it can be postulated that the damaged liver attracts transplanted CXCR4-positive progenitor cells, and these engrafted cells reciprocally promote the expression of SDF1α in grafts. Thus, the repair of liver damage could be facilitated by engrafted CXCR4-MSCs via the up-regulation of liver SDF1α, which leads to more mobilization and homing of CXCR4-MSCs.

Lastly and most importantly, although MSCs can differentiate into hepatocyte-like cells in vivo, this does not occur until at least 7 days after a systemic infusion, and complete cell differentiation is still a rare event in injured liver tissue.[11, 46] In our study, we also did not find that engrafted GFP-positive MSCs differentiated into hepatocytes in vivo 168 hours after transplantation. However, in animals undergoing 50% or 30% RSLT, death often occurs within 1 to 4 days of the operation. Our laboratory and other investigators[11] have shown a remarkable liver regeneration and survival advantage in a relatively short amount of time after gene-modified MSC administration in 50% or 30% RSLT, and this suggests a role for soluble cues rather than direct differentiation by infused gene-modified MSCs. Similar results have also been observed in models of myocardial infarction[21-23] and partial hepatectomy.[39] On the basis of these results, a paracrine effect of cytokines and growth factors secreted by gene-modified MSCs may be the major pathway for enhancing liver regeneration. Further experiments using an MSC-conditioned medium alone have shown that paracrine factors secreted by MSCs are responsible for hepatocyte proliferation in vitro and liver regeneration in vivo.[7, 8, 17, 40] Testing our hypothesis that CXCR4-MSCs release more paracrine factors that contribute to liver regeneration, our study has demonstrated that overexpression of CXCR4 in MSCs results in an increase in the release of a number of cytokines and growth factors, such as VEGF, HGF, and IL-6, and this is partly consistent with the findings of Huang et al.[47] By activating its receptor c-Met on hepatocytes to induce a strong mitogenic response in hepatocytes, HGF is considered the initiator of liver regeneration.[5, 48, 49] IL-6 functions as a factor optimizing the processes of the early stage of liver regeneration.[5, 48] VEGF can also induce hepatocyte proliferation by binding its receptor to hepatocytes.[5, 50] The latest research shows that VEGF secreted by implanted adipose-derived stem cells plays a crucial role in reducing small-for-size liver graft injuries and subsequently enhancing liver regeneration in a rat 35% LT model.[40] In addition, Huang et al. found that insulin growth factor 1α, a growth factor that stimulates hepatocyte proliferation, is up-regulated after CXCR4 overexpression. These cytokines and growth factors can all stimulate hepatocyte proliferation. Besides promitotic effects on hepatocytes, VEGF, HGF, and insulin growth factor 1α are angiogenic cytokines. Liver regeneration is associated with the formation of new blood vessels.[51] Although MSCs also have the capacity to differentiate into endothelial cells,[52] this phenomenon is not sufficient for the formation of fully functional blood vessels, which requires many well-coordinated steps. CXCR4-MSCs have the capacity to provide strong trophic support for the process of angiogenesis and collateral formation. Generally, the injured liver tissues also release some endogenous HGF, IL-6, and VEGF to promote liver regeneration. However, more proliferating hepatocytes were observed in the CXCR4-MSC group versus the PBS-treated group and the GFP-MSC group. Thus, more genetically modified MSCs were engrafted into RSLGs and caused liver regeneration as a result of a paracrine action during the early stages of liver regeneration.

Unlike myocardial infarction, the liver is not suitable for local cell injection. The transplantation of MSCs is usually performed via an intrasplenic or intravenous route, including the portal vein and peripheral veins (the vena caudalis or penile vein). To simulate the response of endogenous MSCs to liver injury and to detect CXCR4 for the migration and engraftment of MSCs in liver grafts, we selected the penile vein for infusion because it is easily manipulated. However, an injection via peripheral veins in rodents can result in lethal pulmonary emboli, and portal vein injections can obstruct the hepatic sinusoid and aggravate liver necrosis. Therefore, the appropriate number of cells and single cell suspensions are particularly critical to cell therapy.

In conclusion, we have found that the overexpression of CXCR4 in MSCs is extremely effective for their migration and engraftment into RSLGs for liver regeneration, and this may be attributable to the CXCR4-MSC secretion of growth factors. This strategy of exploiting CXCR4-MSC homing for the delivery of secreted factors to promote liver regeneration has significant importance to cell-based therapy for acute liver failure and small-for-size syndrome after split or living LT.

REFERENCES

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. REFERENCES
  7. Supporting Information
  • 1
    Yeh H, Olthoff KM. Live donor adult liver transplantation. Curr Opin Organ Transplant 2008;13:241-246.
  • 2
    Müller SA, Mehrabi A, Schmied BM, Welsch T, Fonouni H, Engelmann G, et al. Partial liver transplantation—living donor liver transplantation and split liver transplantation. Nephrol Dial Transplant 2007;22(suppl 8):viii13-viii22.
  • 3
    Dahm F, Georgiev P, Clavien PA. Small-for-size syndrome after partial liver transplantation: definition, mechanisms of disease and clinical implications. Am J Transplant 2005;5:2605-2610.
  • 4
    Man K, Lo CM, Ng IO, Wong YC, Qin LF, Fan ST, Wong J. Liver transplantation in rats using small-for-size grafts: a study of hemodynamic and morphological changes. Arch Surg 2001;136:280-285.
  • 5
    Taki-Eldin A, Zhou L, Xie HY, Zheng SS. Liver regeneration after liver transplantation. Eur Surg Res 2012;48:139-153.
  • 6
    Sato Y, Araki H, Kato J, Nakamura K, Kawano Y, Kobune M, et al. Human mesenchymal stem cells xenografted directly to rat liver are differentiated into human hepatocytes without fusion. Blood 2005;106:756-763.
  • 7
    Parekkadan B, van Poll D, Suganuma K, Carter EA, Berthiaume F, Tilles AW, Yarmush ML. Mesenchymal stem cell-derived molecules reverse fulminant hepatic failure. PLoS One 2007;2:e941.
  • 8
    van Poll D, Parekkadan B, Cho CH, Berthiaume F, Nahmias Y, Tilles AW, Yarmush ML. Mesenchymal stem cell-derived molecules directly modulate hepatocellular death and regeneration in vitro and in vivo. Hepatology 2008;47:1634-1643.
  • 9
    Rabani V, Shahsavani M, Gharavi M, Piryaei A, Azhdari Z, Baharvand H. Mesenchymal stem cell infusion therapy in a carbon tetrachloride-induced liver fibrosis model affects matrix metalloproteinase expression. Cell Biol Int 2010;34:601-605.
  • 10
    Abdel Aziz MT, Atta HM, Mahfouz S, Fouad HH, Roshdy NK, Ahmed HH, et al. Therapeutic potential of bone marrow-derived mesenchymal stem cells on experimental liver fibrosis. Clin Biochem 2007;40:893-899.
  • 11
    Yu Y, Yao AH, Chen N, Pu LY, Fan Y, Lv L, et al. Mesenchymal stem cells over-expressing hepatocyte growth factor improve small-for-size liver grafts regeneration. Mol Ther 2007;15:1382-1389.
  • 12
    Piryaei A, Valojerdi MR, Shahsavani M, Baharvand H. Differentiation of bone marrow-derived mesenchymal stem cells into hepatocyte-like cells on nanofibers and their transplantation into a carbon tetrachloride-induced liver fibrosis model. Stem Cell Rev 2011;7:103-118.
  • 13
    Pan GZ, Yang Y, Zhang J, Liu W, Wang GY, Zhang YC, et al. Bone marrow mesenchymal stem cells ameliorate hepatic ischemia/reperfusion injuries via inactivation of the MEK/ERK signaling pathway in rats. J Surg Res 2012;178:935-948.
  • 14
    Kanazawa H, Fujimoto Y, Teratani T, Iwasaki J, Kasahara N, Negishi K, et al. Bone marrow-derived mesenchymal stem cells ameliorate hepatic ischemia reperfusion injury in a rat model. PLoS One 2011;6:e19195.
  • 15
    Li J, Zhang L, Xin J, Jiang L, Li J, Zhang T, et al. Immediate intraportal transplantation of human bone marrow mesenchymal stem cells prevents death from fulminant hepatic failure in pigs. Hepatology 2012;56:1044-1052.
  • 16
    Parekkadan B, Milwid JM. Mesenchymal stem cells as therapeutics. Annu Rev Biomed Eng 2010;12:87-117.
  • 17
    Puglisi MA, Tesori V, Lattanzi W, Piscaglia AC, Gasbarrini GB, D'Ugo DM, Gasbarrini A. Therapeutic implications of mesenchymal stem cells in liver injury. J Biomed Biotechnol 2011;2011:860578.
  • 18
    Lau TT, Wang DA. Stromal cell-derived factor-1 (SDF-1): homing factor for engineered regenerative medicine. Expert Opin Biol Ther 2011;11:189-197.
  • 19
    Liu X, Duan B, Cheng Z, Jia X, Mao L, Fu H, et al. SDF-1/CXCR4 axis modulates bone marrow mesenchymal stem cell apoptosis, migration and cytokine secretion. Protein Cell 2011;2:845-854.
  • 20
    Liu H, Liu S, Li Y, Wang X, Xue W, Ge G, Luo X. The role of SDF-1-CXCR4/CXCR7 axis in the therapeutic effects of hypoxia-preconditioned mesenchymal stem cells for renal ischemia/reperfusion injury. PLoS One 2012;7:e34608.
  • 21
    Zhang D, Fan GC, Zhou X, Zhao T, Pasha Z, Xu M, et al. Over-expression of CXCR4 on mesenchymal stem cells augments myoangiogenesis in the infarcted myocardium. J Mol Cell Cardiol 2008;44:281-292.
  • 22
    Cheng Z, Ou L, Zhou X, Li F, Jia X, Zhang Y, et al. Targeted migration of mesenchymal stem cells modified with CXCR4 gene to infarcted myocardium improves cardiac performance. Mol Ther 2008;16:571-579.
  • 23
    Zhang D, Huang W, Dai B, Zhao T, Ashraf A, Millard RW, et al. Genetically manipulated progenitor cell sheet with diprotin A improves myocardial function and repair of infarcted hearts. Am J Physiol Heart Circ Physiol 2010;299:H1339-H1347.
  • 24
    Lien CY, Chih-Yuan Ho K, Lee OK, Blunn GW, Su Y. Restoration of bone mass and strength in glucocorticoid-treated mice by systemic transplantation of CXCR4 and cbfa-1 co-expressing mesenchymal stem cells. J Bone Miner Res 2009;24:837-848.
  • 25
    Kitaori T, Ito H, Schwarz EM, Tsutsumi R, Yoshitomi H, Oishi S, et al. Stromal cell-derived factor 1/CXCR4 signaling is critical for the recruitment of mesenchymal stem cells to the fracture site during skeletal repair in a mouse model. Arthritis Rheum 2009;60:813-823.
  • 26
    Khurana S, Mukhopadhyay A. Characterization of the potential subpopulation of bone marrow cells involved in the repair of injured liver tissue. Stem Cells 2007;25:1439-1447.
  • 27
    Granero-Moltó F, Weis JA, Miga MI, Landis B, Myers TJ, O'Rear L, et al. Regenerative effects of transplanted mesenchymal stem cells in fracture healing. Stem Cells 2009;27:1887-1898.
  • 28
    Dong F, Harvey J, Finan A, Weber K, Agarwal U, Penn MS. Myocardial CXCR4 expression is required for mesenchymal stem cell mediated repair following acute myocardial infarction. Circulation 2012;126:314-324.
  • 29
    Huang W, Wang T, Zhang D, Zhao T, Dai B, Ashraf A, et al. Mesenchymal stem cells overexpressing CXCR4 attenuate remodeling of postmyocardial infarction by releasing matrix metalloproteinase-9. Stem Cells Dev 2012;21:778-789.
  • 30
    Wynn RF, Hart CA, Corradi-Perini C, O'Neill L, Evans CA, Wraith JE, et al. A small proportion of mesenchymal stem cells strongly expresses functionally active CXCR4 receptor capable of promoting migration to bone marrow. Blood 2004;104:2643-2645.
  • 31
    Piscaglia AC, Campanale M, Gasbarrini A, Gasbarrini G. Stem cell-based therapies for liver diseases: state of the art and new perspectives. Stem Cells Int 2010;2010:259461.
  • 32
    Ratajczak MZ, Kucia M, Reca R, Majka M, Janowska-Wieczorek A, Ratajczak J. Stem cell plasticity revisited: CXCR4-positive cells expressing mRNA for early muscle, liver and neural cells ‘hide out’ in the bone marrow. Leukemia 2004;18:29-40.
  • 33
    Hatch HM, Zheng D, Jorgensen ML, Petersen BE. SDF-1α/CXCR4: a mechanism for hepatic oval cell activation and bone marrow stem cell recruitment to the injured liver of rats. Cloning Stem Cells 2002;4:339-351.
  • 34
    Zhang J, Gong JF, Zhang W, Zhu WM, Li JS. Effects of transplanted bone marrow mesenchymal stem cells on the irradiated intestine of mice. J Biomed Sci 2008;15:585-594.
  • 35
    Shi M, Li J, Liao L, Chen B, Li B, Chen L, et al. Regulation of CXCR4 expression in human mesenchymal stem cells by cytokine treatment: role in homing efficiency in NOD/SCID mice. Haematologica 2007;92:897-904.
  • 36
    Zhao Q, Ren H, Zhu D, Han Z. Stem/progenitor cells in liver injury repair and regeneration. Biol Cell 2009;101:557-571.
  • 37
    Sharma AD, Cantz T, Manns MP, Ott M. The role of stem cells in physiology, pathophysiology, and therapy of the liver. Stem Cell Rev 2006;2:51-58.
  • 38
    Stock P, Brückner S, Ebensing S, Hempel M, Dollinger MM, Christ B. The generation of hepatocytes from mesenchymal stem cells and engraftment into murine liver. Nat Protoc 2010;5:617-627.
  • 39
    Fouraschen SM, Pan Q, deRuiter PE, Farid WR, Kazemier G, Kwekkeboom J, et al. Secreted factors of human liver-derived mesenchymal stem cells promote liver regeneration early after partial hepatectomy. Stem Cells Dev 2012;21:2410-2419.
  • 40
    Ma T, Liu H, Chen W, Xia X, Bai X, Liang L, et al. Implanted adipose-derived stem cells attenuate small-for-size liver graft injury by secretion of VEGF in rats. Am J Transplant 2012;12:620-629.
  • 41
    Cho SW, Sun HJ, Yang JY, Jung JY, An JH, Cho HY, et al. Transplantation of mesenchymal stem cells overexpressing RANK-Fc or CXCR4 prevents bone loss in ovariectomized mice. Mol Ther 2009;17:1979-1987.
  • 42
    Stolz DB, Ross MA, Ikeda A, Tomiyama K, Kaizu T, Geller DA, Murase N. Sinusoidal endothelial cell repopulation following ischemia/reperfusion injury in rat liver transplantation. Hepatology 2007;46:1464-1475.
  • 43
    Li J, Liang L, Ma T, Yu X, Chen W, Xu G, Liang T. Sinusoidal microcirculatory changes after small-for-size liver transplantation in rats. Transpl Int 2010;23:924-933.
  • 44
    Bhakta S, Hong P, Koc O. The surface adhesion molecule CXCR4 stimulates mesenchymal stem cell migration to stromal cell-derived factor-1 in vitro but does not decrease apoptosis under serum deprivation. Cardiovasc Revasc Med 2006;7:19-24.
  • 45
    Jung YJ, Ryu KH, Cho SJ, Woo SY, Seoh JY, Chun CH, et al. Syngenic bone marrow cells restore hepatic function in carbon tetrachloride-induced mouse liver injury. Stem Cells Dev 2006;15:687-695.
  • 46
    Luk JM, Wang PP, Lee CK, Wang JH, Fan ST. Hepatic potential of bone marrow stromal cells: development of in vitro co-culture and intra-portal transplantation models. J Immunol Methods 2005;305:39-47.
  • 47
    Huang W, Zhang D, Millard RW, Wang T, Zhao T, Fan GC, et al. Gene manipulated peritoneal cell patch repairs infarcted myocardium. J Mol Cell Cardiol 2010;48:702-712.
  • 48
    Omura T, Ascher NL, Emond JC. Fifty-percent partial liver transplantation in the rat. Transplantation 1996;62:292-293.
  • 49
    Hua ZY, Song J, Cheng F, Yu Y, Gao Y, Yao A, Wang X. The effect of hepatocyte growth factor on the initiation phase of liver regeneration after cold ischemia in a rat model of small-for-size liver transplantation. Hepatogastroenterology 2012;59:1548-1552.
  • 50
    Bockhorn M, Goralski M, Prokofiev D, Dammann P, Grünewald P, Trippler M, et al. VEGF is important for early liver regeneration after partial hepatectomy. J Surg Res 2007;138:291-299.
  • 51
    Drixler TA, Vogten MJ, Ritchie ED, van Vroonhoven TJ, Gebbink MF, Voest EE, Borel Rinkes IH. Liver regeneration is an angiogenesis-associated phenomenon. Ann Surg 2002;236:703-711.
  • 52
    Oswald J, Boxberger S, Jørgensen B, Feldmann S, Ehninger G, Bornhäuser M, Werner C. Mesenchymal stem cells can be differentiated into endothelial cells in vitro. Stem Cells 2004;22:377-384.

Supporting Information

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. REFERENCES
  7. Supporting Information

Additional Supporting Information may be found in the online version of this article.

FilenameFormatSizeDescription
lt23577-sup-0001-suppinfo.tif1459KSupporting Figure 1: Characterization of isolated mesenchymal stem cells (MSCs). A (Clone growth), B (adipocytic differentiation), C (osteogenic differentiation), and D (surface marker expression).
lt23577-sup-0002-suppinfo.tif1151KSupporting Figure 2: ALT and AST enzyme levels in serum samples at three and seven days after treatment. Compared with PBS group, ALT and AST enzyme levels were lower in GFP-MSCs and CXCR4-MSCs group; and no statistical difference was found between GFP-MSCs and CXCR4-MSCs group (*p < 0.05, PBS group vs GFP-MSCs group; #p < 0.05, PBS group vs CXCR4-MSCs group; p > 0.05, GFP-MSCs group vs CXCR4-MSCs group).
lt23577-sup-0003-suppinfo.tif2115KSupporting Figure 3: Immunohistology of Ki67 at 48h and 72h. Representative images from the three groups are shown. No significant difference was observed in CXCR4-MSCs group compared with GFP-MSCs and the PBS-treated groups at 48 and 72h.
lt23577-sup-0004-suppinfo.tif4196KSupporting Figure 4: Immunofluorescence staining of Alb and CK18 on GFP labeled MSCs. Both Alb and CK18 are not detected on GFP labeled MSCs engrafted in liver tissues 168h after treatment with GFP-MSCs or CXCR4-MSCs. Alb, albumin; CK18, cytokeratin-18; DAPI, 4',6-diamidino-2-phenylindole.
lt23577-sup-0005-suppinfo.doc19KSupporting Information

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.