Chronic Lithium Treatment Protects Against Liver Ischemia/Reperfusion Injury in Rats

Authors

  • Anding Liu,

    Corresponding author
    1. Experimental Transplantation Surgery, Department of General, Visceral, and Vascular Surgery, Friedrich Schiller University of Jena, Jena, Germany
    • Experimental Medicine Center, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China
    Search for more papers by this author
    • These authors contributed equally to this work.

  • Haoshu Fang,

    1. Experimental Transplantation Surgery, Department of General, Visceral, and Vascular Surgery, Friedrich Schiller University of Jena, Jena, Germany
    2. Department of Pathophysiology, Anhui Medical University, Hefei, China
    Search for more papers by this author
  • Uta Dahmen,

    1. Experimental Transplantation Surgery, Department of General, Visceral, and Vascular Surgery, Friedrich Schiller University of Jena, Jena, Germany
    Search for more papers by this author
  • Olaf Dirsch

    1. Institute for Pathology, University Hospital of Jena, Jena, Germany
    Search for more papers by this author

  • This project was supported by the German Federal Ministry for Education and Research (BMBF) Virtual Liver Network.

Address reprint requests to Uta Dahmen, M.D., Experimental Transplantation Surgery, Department of General, Visceral, and Vascular Surgery, Friedrich Schiller University of Jena, Drackendorfer Straße 1, 07747 Jena, Germany. Telephone: +49-03641-932 5350; FAX: +49-03641-932 5352; E-mail: uta.dahmen@med.uni-jena.de

Abstract

Lithium has long been widely used in the treatment of bipolar mood disorders. Recent studies have demonstrated that lithium is able to decrease ischemia/reperfusion (I/R) injury in the brain, kidneys, and heart. Because lithium may act on a number of stress and survival pathways, it is of great interest to explore this compound also in the setting of liver I/R injury. In this study, we aimed to evaluate the effects of lithium in a model of liver I/R injury in rats. Chronic treatment with lithium (2 mmol/kg for 3 days before ischemia) decreased I/R injury, whereas acute treatment with a single dose of lithium (2 mmol/kg 1 hour before ischemia) did not confer any protection in a partial hepatic I/R model. Furthermore, rats subjected to chronic lithium treatment had a significantly better survival rate (60%) than saline-treated rats (27%) in a total hepatic I/R survival model. Chronic lithium treatment protected against liver I/R injury, as indicated by lower serum aminotransferase levels, fewer I/R-associated histopathological changes, lower hepatic inflammatory cytokine levels, less neutrophil infiltration, and lower hepatic high-mobility group box expression and serum levels. The mechanism of action of lithium appears to involve its ability to inhibit glycogen synthase kinase 3β activation, modulate mitogen-activated protein kinase activation, inhibit hepatic apoptosis, and induce autophagy. On the basis of these data, we conclude that lithium treatment may be a simple and applicable preconditioning intervention for protecting against liver I/R injury. Liver Transpl 19:762–772, 2013.. © 2013 AASLD.

Ischemia/reperfusion (I/R) injury is triggered when the liver is transiently deprived of oxygen and subsequently reoxygenated. Injury to the liver caused by I/R can occur during liver transplantation, liver resection, and trauma. Liver I/R injury has been implicated as a potent contributor to an increased rate of acute liver failure/graft rejection and chronic liver dysfunction after liver transplantation.[1] Therefore, a reduction of liver I/R injury can contribute to the minimization of postoperative injury to the liver. Several strategies, especially pharmacological approaches, have been devised to reduce liver I/R injury.[2] Although several pharmacological chemicals have been found to decrease I/R injury in animal models, none of them have shown any benefit with respect to graft or patient survival, in part because of the lack of safety and effectiveness.[2]

Lithium has long been widely used in the treatment of bipolar mood disorders.[3] Growing evidence has shown that lithium is a neuroprotective drug for a variety of neurodegenerative diseases.[4] Notably, recent studies have demonstrated that lithium is able to decrease I/R injury to the brain, kidneys, and heart.[5-10] Lithium preconditioning reduces injury and improves neurological function after transient cerebral ischemia.[6, 10] Other investigators have demonstrated that lithium administration reduces the infarct size in myocardial I/R injury.[8, 11] More recently, Talab et al.[5] reported that chronic lithium treatment protected rats against kidney I/R injury. However, no information is available on the possible effects of lithium on liver I/R injury in rats. Because lithium may act on a number of stress and survival pathways, it is of great interest to explore this compound also in the setting of liver I/R injury.

The precise mechanisms by which lithium confers protection against I/R injury are still poorly understood. Several mediators and pathways have been implicated; among these, the most studied are the activation of the phosphatidylinositol 3-kinase/Akt[12] and extracellular signal-regulated kinase (ERK) cell survival pathways,[13] the inhibition of glycogen synthase kinase 3β (GSK3β) activity,[14] and the reduction of apoptotic death.[15] Furthermore, lithium induces autophagy by inhibiting inositol monophosphatase.[16] Autophagy is an evolutionarily conserved cellular process for recycling damaged proteins and organelles via lysosomal degradation,[17, 18] and the induction of autophagy is associated with the attenuation of liver I/R injury.[19]

In this study, we aimed to test whether lithium could attenuate cellular injury after liver I/R via its ability to affect intracellular stress and survival signaling pathways.

MATERIALS AND METHODS

Experimental Design

The experiments were designed to investigate whether lithium treatment could protect rats against liver I/R injury. Rats were chronically (for 3 days before ischemia) or acutely (1 hour before ischemia) pretreated with lithium and then subjected to 60 minutes of warm ischemia. Rats were killed after 0.5, 6, 24, or 48 hours of reperfusion. Liver injury, inflammatory cytokines, hepatic neutrophil infiltration, hepatic high-mobility group box (HMGB1) expression and release, phosphorylation of GSK3β, ERK1/2, p38, and c-Jun N-terminal kinase (JNK), apoptosis, and autophagy were analyzed. The effect of lithium on animal survival was evaluated with a model of total hepatic I/R.

Animals

Inbred male Lewis rats, purchased from Charles River Laboratories (Sulzfeld, Germany) and weighing 250 to 320 g, were used in this study. All animals were housed under standard animal care conditions and had free access to water and rat chow ad libitum. All procedures were carried out according to German animal welfare legislation.

Lithium Administration

Lithium chloride (Sigma-Aldrich, St. Louis, MO) was dissolved in a normal saline solution. In the chronic lithium treatment group, rats started treatment with lithium (2 mmol/kg subcutaneously once daily) 3 days before I/R injury, and they were continuously subjected to a daily lithium injection for up to 2 days. In the acute lithium treatment group, rats were treated with a single dose of lithium (2 mmol/kg subcutaneously) 1 hour before ischemia. Normal saline was used instead of lithium as a vehicle control. The conditions of lithium treatment were selected in accordance with previous studies.[6, 10, 20] The dose of lithium (2 mmol/kg) was based on dose titrations in a rat model of cerebral ischemia. The plasma lithium levels of rats injected with 1, 2, or 3 mEq (mmol) of lithium/kg were in the therapeutic range of 0.5 to 1.0 mmol/L at 12 hours.[9]

Partial Hepatic Warm I/R

All procedures were performed under inhalation anesthesia with isoflurane (Sigma Delta, London, United Kingdom; isoflurane concentration = 1.5%-3%, oxygen flow = 0.5 L/minute). After the abdomen was opened with a transversal incision, interlobular ligaments were dissected. For partial (70%) warm ischemia, the left hepatoduodenal ligament containing the hepatic artery, portal vein, and bile duct of the left lateral and median liver lobes was clamped for 60 minutes with a microvascular clamp.

Total Hepatic I/R

Partial (70%) liver ischemia, followed by the resection of nonischemic lobes (30%), was performed as described by Uehara et al.[21] Briefly, under inhalation anesthesia with isoflurane, rats were subjected to partial ischemia for 90 minutes as described previously. After the 90-minute ischemic interval, nonischemic lobes (right and caudate) were removed by hepatectomy. Animals surviving for 7 days after surgery were considered survivors.

Histopathology

Liver tissue was fixed in 4.5% buffered formalin for at least 24 hours. Paraffin embedding was performed with standard techniques. Sections (4 μm) were cut and stained with hematoxylin-eosin. Inflammation and tissue damage were evaluated.

HMGB1 Immunohistochemistry

The HMGB1 immunohistochemical analysis was performed as described previously.[22] After deparaffinization and rehydration, antigen retrieval was performed with a citrate–ethylene diamine tetraacetic acid buffer (10 mM citric acid, 2 mM ethylene diamine tetraacetic acid, and 0.05% Tween 20; pH 6.2) for 20 minutes at 100°C. Then, sections were incubated with an HMGB1 antibody (Abcam, Cambridge, United Kingdom; 1:500) for 1 hour at room temperature, and this was followed by detection with PowerVision polymeric alkaline phosphatase goat-anti-rabbit immunoglobulin G (ImmunoLogic, Duiven, the Netherlands) and with Fast Red (Dako, Glostrup, Denmark) as a substrate.

Naphthol-AS-D-Chloroacetate Esterase (ASDCL) Staining

Neutrophil infiltration into liver tissue was evaluated with ASDCL staining as reported previously.[23] After staining, slides were visualized with a Virtual slide scanner (Hamamatsu Electronic Press Co., Ltd., Iwata, Japan), and 5 high-power field (HPF) pictures were randomly taken with a magnification of ×200. ASDCL staining–positive neutrophils were counted manually. The result was expressed as the number of ASDCL-positive neutrophils per HPF.

Gel Electrophoresis and Western Blotting

Twenty micrograms of total protein were loaded per well and separated on 12% gels by sodium dodecyl sulfate–polyacrylamide gel electrophoresis. A transfer onto polyvinyldifluoride membranes (GE Healthcare, Buckinghamshire, United Kingdom) was performed. After blocking, the membranes were incubated at 4°C with gentle shaking overnight with primary antibodies: rabbit anti–phospho-GSK3β (Ser9, 1:1000; Cell Signaling Technology, Beverly, MA), rabbit anti-GSK3β (1:1000; Cell Signaling Technology), rabbit anti–phospho-ERK (Thr202/Tyr204, 1:1000; Cell Signaling Technology), rabbit anti-ERK (1:1000; Cell Signaling Technology), rabbit anti–phospho-p38 (Thr180/Tyr182, 1:1000; Cell Signaling Technology), rabbit anti-p38 (1:1000; Cell Signaling Technology), rabbit anti–phospho-JNK (Thr183/Tyr185, 1:1000; Cell Signaling Technology), rabbit anti-JNK (1:1000; Cell Signaling Technology), rabbit anti–caspase-3 (1:1000; Cell Signaling Technology), rabbit anti–caspase-7 (1:1000; Cell Signaling Technology), rabbit anti–light chain 3 (LC3; 1:1000; Abcam), rabbit anti-Sequestosome 1/p62 (1:1000; Cell Signaling Technology), rabbit anti–autophagy-related gene 5 (ATG5; 1:500; Santa Cruz Biotechnology, Santa Cruz, CA), rabbit anti-HMGB1 (1:1000; Abcam), and rabbit anti–glyceraldehyde-3-phosphate dehydrogenase (GAPDH; 1:20.000; Sigma-Aldrich). The membranes were developed with an enhanced chemiluminescence western blotting substrate (GE Healthcare) and exposed to high-sensitivity films (GE Healthcare) for autoradiography.

Enzyme-Linked Immunosorbent Assay (ELISA)

Serum HMGB1 was determined with a commercial ELISA (Shino-Test, Kanagawa, Japan). All procedures were performed according to the instructions of the manufacturer.

Quantitative Polymerase Chain Reaction (PCR)

Total RNA was extracted from liver tissue with the RNeasy kit (Qiagen, Hilden, Germany). Complementary DNA (cDNA) synthesis was performed with a first-strand cDNA synthesis kit (Invitrogen, Carlsbad, CA). The quantitative PCR reaction mixture was prepared with a Brilliant probe–based quantitative PCR master mix (Agilent, Santa Clara, CA) and with primers and probes (Table 1). Equal amounts of cDNA were used for each PCR reaction as described previously.[24] PCR amplification was performed on an Mx3000P quantitative PCR system (Stratagene, La Jolla, CA). The thermal cycling conditions consisted of a 10-minute template denaturation step at 95°C followed by 50 cycles of 95°C for 30 seconds and 60°C for 20 seconds. Normal liver tissue was used as a reference sample to generate the standard curve. The relative quantification of the target messenger RNA (mRNA) expression was calculated and further normalized to hypoxanthine-guanine phosphoribosyltransferase (HPRT).

Table 1. Characteristics of Primers and Probes of Selected Genes
GeneForward PrimerReverse PrimerProbea
  1. a

    Universal ProbeLibrary probes.

TNF-αTGAACTTCGGGGTGATCGGGGCTTGTCACTCGAGTTTT#63
IL-6CCTGGAGTTTGTGAAGAACAACTGGAAGTTGGGGTAGGAAGGA#106
iNOSAAAATGGTTTCCCCCAGTTCCAGCTTGTCCAGGGATTCTG#95
IL-1βGCTGACAGACCCCAAAAGATAGCTGGATGCTCTCATCTGG#117
CD11bGGGAGCCCCACACTGATAAGAGGGAGGCCCCAAAATA#71
CD64CCTGTGCAGTTAGAAATCTACAGAGACTTATTCTGCCACGGGTGA#110
HPRTGACCGGTTCTGTCATGTCGACCTGGTTCATCATCACTAATCAC#95

Statistical Analysis

Data were expressed as means and standard deviations. Differences between groups were evaluated for significance with a 1-way analysis of variance. All tests were performed with SigmaStat version 3.5 (Systat-Software, Erkrath, Germany). A P value < 0.05 was considered statistically significant.

RESULTS

Chronic Lithium Treatment Protects Against Liver I/R Injury

To determine whether lithium treatment could attenuate liver I/R injury, lithium was administrated to rats before warm I/R. The treatment with lithium (2 mmol/kg subcutaneously for 3 days before ischemia) did not alter liver function in comparison with the vehicle (saline) used in sham control rats. As demonstrated previously,[25] warm liver I/R resulted in significant increases in serum levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST). After 60 minutes of warm ischemia injury, the serum ALT level was increased as early as 0.5 hours after reperfusion, reached a peak at 6 hours, and decreased thereafter (596 ± 171 IU/L at 0.5 hours, 823 ± 155 IU/L at 6 hours, 221 ± 34 IU/L at 24 hours, and 73 ± 5 IU/L at 48 hours). Chronic lithium treatment did significantly decrease I/R injury, as indicated by the lower liver enzyme levels. The serum levels of ALT were drastically decreased after reperfusion to 392 ± 126, 604 ± 119, 147 ± 34, and 62 ± 9 IU/L at 0.5, 6, 24, and 48 hours, respectively. Similar results were obtained for AST (Fig. 1A).

Figure 1.

Chronic lithium treatment prevents liver I/R injury. Rats were pretreated with lithium (2 mmol/kg) or a vehicle (saline) for 3 days before warm ischemia, and they were continuously subjected to a daily lithium or vehicle (saline) injection for up to 2 days. (A) AST and ALT levels were analyzed as measures of hepatocellular injury. Data are shown as means and standard deviations. (B) Routine histopathology was performed on formalin-fixed liver sections obtained from sham control rats and rats that had undergone 60 minutes of ischemia followed by 6 hours of reperfusion (original magnification ×400). Representative images from 6 rats per group were selected. (C) Animal survival was evaluated with a model of total hepatic ischemia. Rats were pretreated with lithium or a vehicle for 3 days before 90 minutes of warm ischemia. Animals surviving for 7 days after surgery were considered survivors.

Liver histology confirmed the serum aminotransferase estimation of liver injury. Confluent hepatocellular necrosis and sinusoidal dilation were observed 6 hours after reperfusion in the vehicle group. In contrast, slight cytoplasmic vacuolization and sinusoidal dilation were observed in the chronic lithium treatment group (Fig. 1B).

To further confirm the protective roles of chronic lithium medication in hepatic I/R injury, the potential effect of lithium on animal survival was evaluated with a model of total hepatic I/R. In the I/R survival model, vehicle-treated rats had a 7-day survival of 27%, whereas rats subjected to chronic lithium treatment had a 60% survival rate (Fig. 1C). These results indicate that chronic lithium treatment could protect against liver I/R injury.

Surprisingly, acute treatment with a single dose of lithium (2 mmol/kg subcutaneously) 1 hour before ischemia did not confer any protection (Fig. 2). In addition, acute lithium treatment immediately after ischemia also did not reduce liver injury in comparison with a saline treatment 6 hours after reperfusion (data not shown).

Figure 2.

Acute lithium treatment does not reduce liver I/R injury. Rats were treated with a single dose of lithium (2 mmol/kg subcutaneously) 1 hour before ischemia. AST and ALT levels were analyzed as measures of hepatocellular injury. Data are shown as means and standard deviations.

Chronic Lithium Treatment Decreases Production of Inflammatory Mediators

As shown in Fig. 3, after reperfusion (following 60 minutes of warm ischemia), the hepatic mRNA expression levels of tumor necrosis factor α (TNF-α), interleukin-6 (IL-6), IL-1β, and inducible nitric oxide synthase (iNOS) were increased in both the vehicle group and the chronic lithium treatment group. However, the mRNA expression levels of TNF-α, IL-6, IL-1β, and iNOS in the chronic lithium treatment group were significantly lower than those in the vehicle group; there were decreases of approximately 4-, 3-, 4-, and 3-fold, respectively, at 0.5 hours of reperfusion.

Figure 3.

Chronic lithium treatment decreases liver expression of inflammatory mediators after I/R injury. (A) TNF-α, (B) IL-6, (C) IL-1β, and (D) iNOS mRNA expression levels were measured by quantitative PCR in rats that were pretreated with either lithium (2 mmol/kg) or a vehicle (saline). Results are expressed as relative increases in mRNA expression in comparison with normal animals. Data are shown as means and standard deviations (n = 6 per group).

Chronic Lithium Treatment Decreases Neutrophil Infiltration

The number of ASDCL staining–positive neutrophils infiltrating the liver after reperfusion was determined. After 60 minutes of warm ischemia and 24 hours of reperfusion, the number of ASDCL staining–positive neutrophils was increased after I/R injury. Neutrophil infiltration was significantly lower in the rats subjected to chronic lithium treatment versus the saline-injected rats (8 ± 1/HPF for the lithium-treated rats versus 13 ± 4/HPF for the controls, P = 0.009; Fig. 4A,B). The mRNA expression of neutrophil-specific markers (CD64 and CD11b) was examined with quantitative PCR. The mRNA levels for CD64 and CD11b were significantly increased after reperfusion. However, animals that were chronically pretreated with lithium showed minimal increases in hepatic CD64 and CD11b mRNA levels in comparison with vehicle-injected rats after reperfusion (Fig. 4C).

Figure 4.

Chronic lithium treatment decreases neutrophil infiltration after I/R injury. (A) ASDCL staining was performed on liver sections from rats that had undergone 60 minutes of ischemia followed by 24 hours of reperfusion after chronic treatment with either lithium (2 mmol/kg) or a vehicle (saline; original magnification ×400). Representative images from 6 rats per group were selected. (B) The number of ASDCL staining–positive neutrophils infiltrating the liver was determined 24 hours after reperfusion. Data are shown as means and standard deviations (n = 6 per group). (C) The mRNA expression of neutrophil-specific markers (CD64 and CD11b) is shown 24 and 48 hours after reperfusion. Data are shown as means and standard deviations (n = 6 per group).

Chronic Lithium Treatment Decreases I/R-Induced HMGB1 Expression and Release

HMGB1 is a cytokine released early during hepatic I/R.[25, 26] As shown previously, warm liver I/R injury resulted in up-regulation of HMGB1 expression and translocation from the nucleus into the cytoplasm.[25] Nuclear HMGB1 staining in hepatocytes was substantially lost in control rats as early as 0.5 hours after reperfusion, and this indicated HMGB1 release into extracellular space. In contrast, chronic pretreatment with lithium largely prevented this loss of nuclear HMGB1 staining (Fig. 5A). I/R increased hepatic HMGB1 expression in comparison with sham control rats. Notably, rats subjected to chronic pretreatment with lithium exhibited a minimal increase in HMGB1 protein in comparison with vehicle-injected rats (Fig. 5B). Warm I/R injury also caused HMGB1 release in both vehicle-treated rats and rats subjected to chronic lithium treatment. In contrast, rats subjected to chronic lithium treatment showed lower serum HMGB1 levels than vehicle-treated rats; this accounted for an approximately 3-fold decrease 0.5 hours after reperfusion (Fig. 5C).

Figure 5.

Chronic lithium treatment decreases HMGB1 expression and release after I/R injury. (A) Immunohistochemical staining for HMGB1 was performed on liver sections from rats that had undergone 60 minutes of ischemia followed by 0.5 hours of reperfusion after chronic treatment with either lithium (2 mmol/kg) or a vehicle (saline; original magnification ×200). Representative images from 6 rats per group were selected. (B) Hepatic HMGB1 expression in the ischemic liver was assessed with western blot analysis after 0.5 and 6 hours of reperfusion. (C) The release of HMGB1 into serum was quantified with ELISA. Data are shown as means and standard deviations (n = 6 per group).

Chronic Lithium Treatment Prevents Acute Dephosphorylation of GSK3β After Liver I/R Injury

It has been reported that lithium reduces ischemia-induced dephosphorylation of GSK3β after I/R injury.[14] We determined whether I/R stimulation could trigger GSK3β phosphorylation/dephosphorylation in rat livers subjected to 60 minutes of warm ischemia followed by various periods of reperfusion. In comparison with the levels in sham controls, phospho-GSK3β/Ser9 levels had rapidly decreased at 0.5 hours, and they remained dephosphorylated throughout the reperfusion phase. In contrast, phospho-GSK3β/Ser9 levels were higher in the chronic lithium treatment group versus the vehicle-treated rats. Treatment with lithium did not affect the total cellular levels of GSK3β (Fig. 6). These data indicate that lithium treatment could prevent acute I/R-induced dephosphorylation of GSK3β.

Figure 6.

Chronic lithium treatment prevents the acute dephosphorylation of GSK3β and modulates MAPK activation after I/R injury. Rats were pretreated with lithium (2 mmol/kg) or a vehicle (saline) for 3 days before warm ischemia, and they were continuously subjected to a daily lithium or saline injection for up to 2 days. Liver samples were harvested at various time points. Western blot analyses for phosphorylated and total GSK3β, ERK, p38, and JNK were performed in the ischemic lobes at various time points after reperfusion.

Chronic Lithium Treatment Modulates Liver I/R–Induced Inflammatory Signaling Pathways

Among the most proximal events in I/R, the best known is the activation of mitogen-activated protein kinases (MAPK).[27] To determine whether chronic lithium pretreatment could influence MAPK activation, we assessed the phosphorylation of ERK, JNK, and p38. After I/R, the phosphorylation of ERK, JNK, and p38 was increased 0.5 hours after reperfusion in the vehicle-injected rats. In contrast, the phosphorylation of ERK was greater in the chronic lithium treatment group versus the vehicle-treated rats. Furthermore, liver I/R–induced JNK and p38 activation was decreased in the rats subjected to chronic lithium treatment. Treatment with lithium did not affect the total cellular levels of ERK, JNK, and p38 (Fig. 6). Thus, these data suggest that lithium could modulate liver I/R–induced inflammatory signaling pathways.

Chronic Lithium Treatment Decreases Hepatic Apoptosis

Apoptosis is a well-recognized contributor to organ damage after liver I/R.[28] It has been reported that lithium decreases apoptotic death.[15] Therefore, we focused our studies on apoptotic protein caspase-3 and caspase-7 expression. As shown in Fig. 7, caspase-3 cleavage was increased in response to liver I/R. Liver I/R–induced caspase-3 cleavage was inhibited by chronic lithium treatment 0.5 and 6 hours after reperfusion in comparison with the vehicle. Furthermore, as with caspase-3, lithium-treated rats demonstrated significantly less hepatic cleaved caspase-7 in comparison with vehicle-injected rats. These data indicate that lithium treatment could inhibit I/R-induced apoptosis.

Figure 7.

Chronic lithium treatment decreases hepatic apoptosis after I/R injury. Rats were pretreated with lithium (2 mmol/kg) or a vehicle (saline) for 3 days before warm ischemia, and they were continuously subjected to a daily lithium or saline injection for up to 2 days. Caspase-3 and caspase-7 cleavage was measured with western blots.

Chronic Lithium Treatment Induces Hepatic Autophagy

Autophagy acts as a cellular adaptive response when cells are under stress.[18] Growing evidence shows that lithium up-regulates autophagy in a number of cell types.[16] To determine whether lithium could induce hepatic autophagy after I/R, western blots were performed for LC3, ATG5, and p62 on livers obtained from rats pretreated with either lithium or saline. After 60 minutes of warm ischemia, LC3-II and ATG5 expression was increased after reperfusion. Notably, liver I/R–induced LC3-II and ATG5 expression was increased by chronic lithium treatment. Then, we examined the levels of p62, which was degraded in autophagolysosomes. In contrast, lithium treatment significantly decreased p62 protein expression after reperfusion in comparison with vehicle-injected rats. Lithium treatment significantly increased LC3-II and ATG5 expression but significantly decreased p62 expression in response to liver I/R, and this indicated that autophagic degradation was instead activated (Fig. 8).

Figure 8.

Chronic lithium treatment modulates autophagic protein expression after I/R injury. Rats were chronically pretreated with lithium (2 mmol/kg) or a vehicle (saline) for 3 days before warm ischemia, and they were continuously subjected to a daily lithium or saline injection for up to 2 days. LC3, ATG5, and p62 protein expression in the ischemic lobes was examined with western blot analysis at various time points after reperfusion.

DISCUSSION

Since the 1870s, lithium has been used as a mood stabilizer in the treatment of bipolar disorders. Recent studies suggest that lithium has protective properties against I/R injury in several organs.[5-10] However, its role in the pathogenesis of liver I/R injury has not been fully explored. In the present study, we documented that rats chronically pretreated with lithium presented with lower liver enzyme levels, fewer I/R-associated histopathological changes, lower hepatic inflammatory cytokine levels, less neutrophil infiltration, and lower hepatic HMGB1 expression and serum levels. Furthermore, chronic lithium treatment significantly increased survival in the setting of total hepatic I/R. However, acute lithium treatment failed to prevent I/R injury. Our data also suggest that GSK3β-, MAPK-, apoptosis-, and autophagy-mediated mechanisms are the prominent pathways involved in the protective effects of chronic lithium treatment in liver I/R injury.

Our results are different from those for liver I/R injury in mice. A previous study showed that both chronic and acute lithium treatment exacerbated hepatic I/R injury by inhibiting GSK3β/nuclear factor kappa B–mediated protective signaling.[29] The discrepancy between the present report and the previous report could be related to the conditions of lithium treatment. In the previous study, a lower lithium dose of 42.3 mg/kg (1 mmol/kg intravenously) was used to treat mice. Two opposite actions of lithium on endothelial-dependent relaxation also were observed in an isolated rat aorta: a lithium dose of 0.5 mmol/L inhibited endothelial-dependent relaxation, whereas 2 mmol/L potentiated it.[30]

It is well known that the liver damage after hepatic I/R is associated with an inflammatory response.[31] Acute and prolonged inflammatory responses occur after I/R injury, and they are characterized by leukocyte infiltration and activation of resident Kupffer cells as well as the production of inflammatory cytokines. Lithium treatment reduces brain injury by inhibiting inflammation after hypoxia ischemia[10] and intracerebral hemorrhaging[20] in rats. In agreement with these studies, we demonstrated that chronic lithium treatment resulted in lower hepatic inflammatory cytokine levels and less neutrophil infiltration in comparison with saline. Our results are partly different from those of previously published reports, which showed that the incubation of hepatocytes with lithium increased spontaneous iNOS expression.[32] Because lithium-mediated tissue protection results in less cellular injury and less release of inflammatory mediators such as HMGB1, which could up-regulate iNOS expression in liver I/R injury,[26] it is possible that lower iNOS expression results from the lower release of inflammatory mediators after chronic lithium treatment.

Because recent studies have suggested that inflammatory signaling following I/R is activated by the release of HMGB1,[25, 26] we investigated HMGB1 expression and release. HMGB1 is an evolutionarily conserved nuclear protein loosely bound to chromatin. It has a role in binding DNA and regulates transcription.[33] HMGB1 acts as a mediator of inflammation when it is passively released by damaged cells or actively secreted by immune cells.[33, 34] HMGB1 in normal rat livers is mainly present in the nuclei of hepatocytes, whereas HMGB1 is translocated from the nucleus to the cytoplasm and is released into circulation when the liver is subjected to I/R injury.[25, 26] Furthermore, treatment with an antibody neutralizing HMGB1 significantly decreases liver I/R injury.[26] Our results showed that lithium treatment led to lower hepatic HMGB1 expression and serum levels.

The mechanism of action of lithium involves its ability to inhibit GSK3β activation, which plays an important role in liver I/R injury.[35, 36] GSK3, a ubiquitously expressed serine/threonine protein kinase, was initially identified as a regulator of glycogen metabolism.[37, 38] Recent studies have implicated GSK3 as a multifaceted enzyme regulating gene expression, cell division and apoptosis, stem cell maintenance, and differentiation.[39, 40] There are 2 GSK3 isoforms: α and β. The inhibition of GSK3β activity by lithium results directly from binding to the magnesium-sensitive active site of the enzyme[41] and indirectly from the induction of phosphorylation of GSK3β/Ser9 by other kinases.[42] In the present study, we demonstrated that the phosphorylated GSK3β level was reduced in the liver throughout the reperfusion phase, and this indicated that GSK3β was activated by I/R insult. Our results were consistent with previous findings by Fu et al.,[43] who demonstrated that I/R insult induced a significant decrease in phosphorylated GSK3β after reperfusion. However, these data are partly different from those of a previously published report showing that the phosphorylated GSK3β level was reduced by ischemia itself and then rapidly increased with reperfusion.[35] GSK3β is well known to have critical roles in liver I/R injury, and its inactivation represents a protective strategy for I/R injury. GSK3β inhibition ameliorates liver I/R injury by decreasing stress-induced cell death and reducing local inflammation[35] and by reducing apoptosis and enhancing liver proliferation[36] in the setting of liver I/R injury. Our results showed a significant increase in the phosphorylation of GSK3β in liver tissues from rats chronically pretreated with lithium. These data suggest that GSK3β inhibition is involved in the hepatoprotective effect of lithium.

In addition to its ability to inhibit GSK3β, lithium treatment alters MAPK signaling.[13] MAPK activation contributes to the inflammatory response following hepatic I/R.[27] The activation of ERK after redox stress is protective in hepatocytes.[44] We demonstrated that lithium pretreatment significantly increased the phosphorylation of ERK1/2 in comparison with saline-injected rats. Our results are consistent with previous findings showing that lithium treatment increases ERK activity, and they suggest that lithium's neuroprotection is partly dependent on the activation of the ERK cell survival pathway.[13, 45] It has been demonstrated that lithium-induced neuroprotection is associated with the inhibition of glutamate-induced increases in JNK and p38 activity[46] and with trophic deprivation–induced increases in JNK activity.[47] In agreement with these studies, we demonstrated that lithium decreased I/R-induced JNK and p38 activation. Conversely, JNK activation is deleterious even in hypoxic hepatocytes, and the inhibition of JNK activation decreases both necrosis and apoptosis in liver I/R.[21] Taken together, these data suggest that the modulation of MAPK activation is also involved in the hepatoprotective effects of lithium.

Apoptotic cell death has a prominent role in the evolution of organ damage after liver I/R.[28] Recent studies have demonstrated that lithium prevents I/R-induced apoptotic cell death.[15] Our results demonstrated that lithium treatment inhibited apoptotic cell death, as indicated by decreasing I/R-induced caspase protein cleavage. This finding was partly supported by lithium's inhibition of GSK3β and JNK activation in liver I/R. GSK3β and JNK activation has been shown to be critical for the mitochondrial permeability transition.[21, 48] The mitochondrial permeability transition contributes to pH-dependent hepatocellular necrosis and apoptotic cell death following I/R by releasing proapoptotic proteins such as cytochrome c and apoptosis-inducing factors.[49] Together, these data suggest that lithium-mediated hepatoprotective effects may involve multiple antiapoptotic mechanisms.

We next examined autophagy, which is another signaling pathway influenced by lithium.[16] Autophagy is a highly conserved, regulated cellular process by which cytoplasmic constituents, including organelles, are broken down and recycled through a lysosomal degradation pathway.[17, 18] During liver I/R injury, autophagy is induced in the liver and mainly shows prosurvival activity: it allows the cell to cope with nutrient starvation and anoxia.[19] In this study, we demonstrated that autophagy was induced in ischemic livers after reperfusion. Pretreatment with lithium significantly increased autophagy and decreased liver injury, and this suggests that the induction of autophagy accounts in part for the hepatoprotective effects of lithium.

In summary, we have documented that lithium, when it is chronically administered before ischemia, can ameliorate liver I/R injury. The mechanism of action of lithium appears to involve its ability to inhibit GSK3β activation, modulate MAPK activation, inhibit hepatic apoptosis, and induce autophagy. On the basis of these data, we conclude that lithium treatment may represent a simple and applicable strategy for protecting against liver I/R injury, and it may be promising in the setting of transplantation.

ACKNOWLEDGMENT

The authors thank Stephanie Lange for excellent animal care.

Abbreviations
ALT

alanine transaminase

ASDCL

naphthol-AS-D-chloroacetate esterase

AST

aspartate aminotransferase

ATG5

autophagy-related gene 5

cDNA

complementary DNA

ELISA

enzyme-linked immunosorbent assay

ERK

extracellular signal-regulated kinase

GAPDH

glyceraldehyde-3-phosphate dehydrogenase

GSK3β

glycogen synthase kinase 3β

HMGB1

high-mobility group box 1

HPF

high-power field

HPRT

hypoxanthine-guanine phosphoribosyltransferase

IL

interleukin

iNOS

inducible nitric oxide synthase

I/R

ischemia/reperfusion

JNK

c-Jun N-terminal kinase

LC3

light chain 3

MAPK

mitogen-activated protein kinase

mRNA

messenger RNA

PCR

polymerase chain reaction

TNF-α

tumor necrosis factor α

Ancillary

Advertisement