SEARCH

SEARCH BY CITATION

Abstract

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. REFERENCES

Hepatic ischemia/reperfusion injury (IRI), an exogenous, antigen-independent, local inflammation response, occurs in multiple clinical settings, including liver transplantation, hepatic resection, trauma, and shock. The nervous system maintains extensive crosstalk with the immune system through neuropeptide and peptide hormone networks. This study examined the function and therapeutic potential of the vasoactive intestinal peptide (VIP) neuropeptide in a murine model of liver warm ischemia (90 minutes) followed by reperfusion. Liver ischemia/reperfusion (IR) triggered an induction of gene expression of intrinsic VIP; this peaked at 24 hours of reperfusion and coincided with a hepatic self-healing phase. Treatment with the VIP neuropeptide protected livers from IRI; this was evidenced by diminished serum alanine aminotransferase levels and well-preserved tissue architecture and was associated with elevated intracellular cyclic adenosine monophosphate (cAMP)–protein kinase A (PKA) signaling. The hepatocellular protection rendered by VIP was accompanied by diminished neutrophil/macrophage infiltration and activation, reduced hepatocyte necrosis/apoptosis, and increased hepatic interleukin-10 (IL-10) expression. Strikingly, PKA inhibition restored liver damage in otherwise IR-resistant VIP-treated mice. In vitro, VIP not only diminished macrophage tumor necrosis factor α/IL-6/IL-12 expression in a PKA-dependent manner but also prevented necrosis/apoptosis in primary mouse hepatocyte cultures. In conclusion, our findings document the importance of VIP neuropeptide–mediated cAMP-PKA signaling in hepatic homeostasis and cytoprotection in vivo. Because the enhancement of neural modulation differentially regulates local inflammation and prevents hepatocyte death, these results provide the rationale for novel approaches to managing liver IRI in transplant patients. Liver Transpl 19:945–956, 2013. © 2013 AASLD.

Abbreviations
7AAD

7-amino-actinomycin D

ActD

actinomycin D

ALT

alanine aminotransferase

Bcl2

B cell lymphoma 2

Bcl-xL

B cell lymphoma extra large

BMM

bone marrow–derived macrophage

cAMP

cyclic adenosine monophosphate

CCL

chemokine (C-C motif) ligand

CREB

cyclic adenosine monophosphate response element binding

CXCL

chemokine (C-X-C motif) ligand

DMSO

dimethyl sulfoxide

H2O2

hydrogen peroxide

H-89

N-[2-[[3-(4-bromophenyl)−2-propenyl]amino]ethyl]-5-isoquinolinesulfonamide

H&E

hematoxylin and eosin

HPRT

hypoxanthine-guanine phosphoribosyltransferase

IFN

interferon

IL

interleukin

IR

ischemia/reperfusion

IRI

ischemia/reperfusion injury

LDH

lactate dehydrogenase

LPS

lipopolysaccharide

Ly-6G

lymphocyte antigen 6 complex locus G

MPO

myeloperoxidase

NF-κB

nuclear factor kappa B

PAC1

pituitary adenylate cyclase-activating polypeptide type I receptor

PACAP

pituitary adenylate cyclase activating polypeptide

PBS

phosphate-buffered saline

p-IκBα

phosphorylated inhibitor of nuclear factor kappa B α

PKA

protein kinase A

p-NF-κB

phosphorylated nuclear factor kappa B

ROS

reactive oxygen species

sALT

serum alanine aminotransferase

TLR4

toll-like receptor 4

TNF-α

tumor necrosis factor α

TUNEL

terminal deoxynucleotidyl transferase–mediated deoxyuridine triphosphate nick-end labeling

VPAC

vasoactive intestinal polypeptide receptor

VIP

vasoactive intestinal peptide

WT

wild type

Hepatic ischemia/reperfusion injury (IRI) remains the major challenge in clinical liver transplantation, hepatic resection, trauma, and shock.[1] Two phases of ischemia/reperfusion (IR)-triggered hypoxic cellular stress and inflammation-mediated hepatocellular injury can be distinguished. First, endogenous reactive oxygen species (ROS)–inflicted damage initiates local circulatory disturbances and inflammation, and this leads ultimately to hepatocyte death. Second, the activation of the host innate immune system exacerbates local liver injury. Our group was among the first to document that the activation of sentinel toll-like receptor 4 (TLR4) signaling is required for the mechanism of liver IRI[2] and that IR-triggered TLR4, primarily on Kupffer cells/macrophages, facilitates downstream signature proinflammatory cytokine programs [ie, tumor necrosis factor α (TNF-α), interferon β (IFN-β), and chemokine (C-X-C motif) ligand (CXCL10)].[3, 4]

The immune system and the nervous system maintain active communication, and they mount integrated responses to danger signals through intricate chemical messengers, neuropeptides, and peptide hormones. The innate immune system acts as the first defensive firewall against invading pathogens through the recognition of pathogen-associated molecular patterns, phagocytosis, and the release of proinflammatory mediators.[5] These immune components convey the peripheral message to the brainstem and pre-optic area of the anterior hypothalamus. Then, the regional neural-hormonal-stress response may amplify the local inflammation immune cascade to eliminate pathogens,[6-9] restore host homeostasis, and return to a resting state.[10]

Vasoactive intestinal peptide (VIP), which has 28 amino acids, was first isolated from the gastrointestinal tract as a vasodilator.[11] Later, VIP was recognized as a widely distributed neuroregulator in the central and peripheral nervous system.[12] VIP has shown similarities to other gastrointestinal hormones such as secretin, glucagon, and pituitary adenylate cyclase activating polypeptide (PACAP; 68% identity). VIP conveys its immunoregulatory function almost exclusively through 2 G protein–coupled receptors: VPAC1, which is constitutively expressed by lymphocytes/macrophages, and VPAC2, which is expressed selectively by activated lymphocytes/macrophages.[13] PACAP acts on these same receptors with high affinity, but it also interacts with the highly selective PAC1 receptor,[14] which is also expressed in macrophages.[15] Hepatocytes, on the other hand, constitutively express all 3 receptors: VPAC1, VPAC2, and PAC1.[16]

The widespread distribution of VIP correlates with its involvement in various biological processes. Indeed, VIP peptides inhibit phagocytic activity, the production of free radicals, and the adherence/migration of macrophages and neutrophils.[13] VIP peptides inhibit the production of proinflammatory cytokines/chemokines; down-regulate the expression of inducible nitric oxide synthase and the subsequent release of nitric oxide; and enhance anti-inflammatory interleukin-10 (IL-10), which is produced by activated macrophages, microglia, and monocytes.[17, 18] We recently showed that PACAP-mediated cyclic adenosine monophosphate (cAMP)–protein kinase A (PKA) activation provided protection in a murine model of liver IRI,[19, 20] whereas the ability of VIP to act in this manner is unknown. Experiments for determining this are important for 2 reasons: (1) cytoprotective actions of PACAP are thought to be mediated primarily by the PAC1 receptor,[14] which is highly selective (1000-fold higher affinity) for PACAP,[21] and (2) VIP neuropeptides and long-acting VIP analogues are currently being developed clinically for the treatment of chronic inflammatory lung disorders in sarcoidosis,[22] bronchial asthma/chronic obstructive pulmonary disease,[23] and pulmonary arterial hypertension[24, 25] as well as neuroblastoma and Alzheimer's disease.[26] Although recent studies have implied beneficial effects of the VIP neuropeptide on liver IRI,[27, 28] the underlying mechanisms remain to be determined.

This study examined the putative therapeutic function and mechanisms by which VIP may affect IR hepatocellular insult and contribute to liver homeostasis. Because stress triggers proinflammatory and anti-inflammatory neuropeptides, we first determined endogenous VIP expression in hepatic IRI. We then determined whether exogenous VIP could diminish the proinflammatory response and promote hepatocyte survival in an IR-stressed liver, and we studied its actions in cultured macrophages and hepatocytes. Finally, we examined the dependence of these in vivo and in vitro actions on the cAMP-PKA signaling pathway.

MATERIALS AND METHODS

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. REFERENCES

Animals

Male C57BL/6 wild-type (WT) mice, 8 to 12 weeks old, were purchased from the Jackson Laboratory. The animals were housed in the University of California Los Angeles animal facility under pathogen-free conditions and received humane care according to the criteria outlined in Guide for the Care and Use of Laboratory Animals, which was prepared by the National Academy of Sciences (National Institutes of Health publication 86-23, 1985 revision).

Mouse Warm Liver IRI Model

We used a mouse model of partial warm hepatic IRI.[2] In brief, animals were anesthetized and injected intravenously with heparin (100 U/kg), and the arterial/portal venous blood supply to the cephalad lobes was interrupted with an atraumatic clip for 90 minutes. Sham-operated mice underwent the same procedure, but without vascular occlusion. In the treatment groups, animals were infused intravenously (penile vein) 1 hour before the onset of liver ischemia with a single dose of the VIP neuropeptide (50 nmol/mouse; Phoenix Pharmaceuticals, Burlingame, CA) dissolved in phosphate-buffered saline (PBS). Some recipients were intravenously given the cAMP-PKA inhibitor N-[2-[[3-(4-bromophenyl)−2-propenyl]amino]ethyl]-5-isoquinolinesulfonamide (H-89; 20 nmol/mouse; Sigma-Aldrich, St. Louis, MO) dissolved in dimethyl sulfoxide (DMSO). Mice were sacrificed at various reperfusion time points; liver and serum samples were collected for analysis.

Hepatocellular Damage

Serum alanine aminotransferase (sALT) levels were measured by IDEXX Laboratory (Westbrook, ME). Culture medium alanine aminotransferase (ALT) levels were measured with an ALT kit (Stanbio, Boerne, TX). Untreated hepatocyte lysates were used to determine the total ALT level. Cell death was expressed as the release of ALT from treated cells as a percentage of the total ALT level.

Histopathology

Liver specimens (4 μm), stained with hematoxylin and eosin (H&E), were analyzed blindly. Primary monoclonal antibodies against mouse neutrophils [lymphocyte antigen 6 complex locus G (Ly-6G), 1A8, BD Biosciences, San Jose, CA] and macrophages (CD68, FA-11, AbD Serotec, Raleigh, NC) were used.[29] Liver sections were evaluated blindly via the counting of labeled cells in 10 high-power fields.

Myeloperoxidase (MPO) Activity Assay

The presence of MPO was used as an index of neutrophil accumulation in the liver.[29] One absorbance unit of MPO activity was defined as the quantity of the enzyme degrading 1 mol of peroxide/minute/g of tissue at 25°C.

Quantitative Reverse-Transcription Polymerase Chain Reaction

Quantitative polymerase chain reaction was performed with a Platinum SYBR Green quantitative polymerase chain reaction kit (Invitrogen, Carlsbad, CA) and a Chromo 4 detector (MJ Research, Waltham, MA). Primers for amplifying specific gene fragments were published previously.[20] VIP primer sequences were synthesized by Invitrogen (forward, GAAATACCTGAACTCCATCCTGA; reverse, TTCTCCAGCTCTTCAAGAAAGTC). The expression of target genes was calculated via their ratios to the housekeeping gene hypoxanthine-guanine phosphoribosyltransferase (HPRT).

Western Blots

Western blots were performed with liver proteins (30 μg/sample) and with rabbit anti-mouse B cell lymphoma 2 (Bcl2), B cell lymphoma extra large (Bcl-xL), phosphorylated inhibitor of nuclear factor kappa B α (p-IκBα), phosphorylated nuclear factor kappa B (p-NF-κB) p65, and β-actin monoclonal antibodies (Cell Signaling Technology, Danvers, MA) as described previously.[29]

Terminal Deoxynucleotidyl Transferase–Mediated Deoxyuridine Triphosphate Nick-End Labeling (TUNEL) Assay

DNA fragments in liver sections resulting from oncotic necrosis and apoptosis were detected with the TUNEL method (Klenow FragEL DNA fragmentation detection kit, Calbiochem, La Jolla, CA).[29] TUNEL-positive cells were counted in 10 high-power fields per section under light microscopy (×400).

Caspase-3 Activity Assay

Caspase-3 activity was determined with a caspase-3 cellular activity assay kit (Calbiochem). Liver tissue samples and cell lysis were used according to the manufacturer's instruction.

cAMP/PKA Kinase Activity Assays

The cAMP levels and PKA activity in tissue samples were measured with a cAMP enzyme immunoassay and a PKA kinase activity kit, respectively (Enzo Life Sciences, Farmingdale, NY).

Cell Cultures

Bone marrow–derived macrophages (BMMs), separated from the femurs or tibias of C57BL/6 mice, were cultured (5 × 106/well) with a 10% L929 conditioned medium for 6 days. The cell purity was 94% to 99% CD11b+. BMMs were activated with lipopolysaccharide (LPS; 10 ng/mL; Sigma-Aldrich) in the presence of VIP (10 nM) or a PBS control and were incubated for 24 hours. An H-89 (10 μM) pretreatment 1 hour before LPS was used to block the cAMP-PKA pathway. Cell-free supernatants were assayed for cytokine levels with an enzyme-linked immunosorbent assay (eBioscience, San Diego, CA).

Mouse hepatocytes were isolated via in situ 2-stage collagenase perfusion and were cultured with a complete L-15 medium plus 6.25 μg/mL insulin, 1 μM dexamethasone, and 10% fetal bovine serum for 24 hours before experiments. Hepatocyte viability was 95% to 99%. After pretreatment with VIP (10nM), H-89 (10μM), or DMSO for 1 hour, hepatocyte death was induced with hydrogen peroxide (H2O2; 0.5 mM; Sigma-Aldrich) or TNF-α (10 ng/mL; R&D Systems, Minneapolis, MN) in combination with actinomycin D (ActD; 0.4 μg/mL; Sigma-Aldrich) during 5 hours of incubation. Cells were processed for flow cytometry/caspase-3 activity, and supernatants were assessed for ALT/lactate dehydrogenase (LDH) levels.

LDH Release Assay

Culture medium LDH activity was measured with an LDH kit (Stanbio). Untreated hepatocyte lysates were used to determine the total LDH activity. Cell death was expressed as the release of LDH from treated cells as a percentage of the total LDH activity.

Flow Cytometry

Hepatocytes stained with fluorescein isothiocyanate/annexin V and 7-amino-actinomycin D (7AAD; BD Biosciences, Mountain View, CA) were analyzed on a FACSCalibur cytometer (BD Biosciences). Dead cells were identified as annexin V+7AAD+.

Statistical Analysis

All values are expressed as means and standard deviations. Data were analyzed with an unpaired, 2-tailed Student t test. P < 0.05 was considered to be statistically significant.

RESULTS

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. REFERENCES

Treatment With VIP Ameliorates Liver IRI

First, we determined whether IR triggered endogenous VIP gene expression in mouse livers subjected to 90 minutes of ischemia followed by reperfusion. In comparison with sham controls, VIP messenger RNA levels transiently dropped after ischemia insult (0.5 hours), increased progressively thereafter, and peaked at 24 hours of reperfusion (P < 0.001; Fig. 1A). To test the significance of VIP, separate groups of WT mice were pretreated with the VIP neuropeptide. In contrast to PBS-treated controls, VIP ameliorated liver IRI, as evidenced by reduced sALT levels (634 ± 68 versus 5627 ± 655 U/L, P < 0.001; Fig. 1B) and well-preserved hepatic architecture (minimal sinusoidal congestion and no edema, vacuolization, or necrosis; Fig. 1C).

image

Figure 1. (A) Liver IRI triggers VIP gene expression. Liver samples were harvested from B6 mice that were subjected to either a sham operation or 90 minutes of partial warm ischemia followed by reperfusion (0.5-24 hours). (B,C) Livers in WT mice pretreated with VIP or PBS were subjected to ischemia (90 minutes). At 6 hours of reperfusion, the hepatocellular function was analyzed by (B) sALT levels and (C) liver histology (representative H&E staining). *P < 0.001 (n = 4-5 per group).

Download figure to PowerPoint

VIP Suppresses Neutrophil/Macrophage Migration to IR Livers

Liver neutrophil activity (according to an MPO assay) was depressed in mice pretreated with VIP versus controls (0.22 ± 0.10 versus 1.35 ± 0.35 U/g, P < 0.001; Fig. 2A). This correlated with the diminished frequency of neutrophils in the VIP-treatment group (1.75 ± 0.5 versus 28.5 ± 7.6, P < 0.001; Fig. 2B). Macrophage recruitment was also decreased in VIP-treated livers (2.5 ± 1.3 versus 58.0 ± 8.0, P < 0.001; Fig. 2C).

image

Figure 2. Accumulation of neutrophils and macrophages in IR livers after the administration of the VIP neuropeptide (6 hours of reperfusion after 90 minutes of ischemia): (A) MPO levels, (B) Ly-6G+ neutrophils, and (C) CD68+ macrophages in IR liver lobes. *P < 0.001 (n = 4-5 per group).

Download figure to PowerPoint

VIP Differentially Down-Regulates IR-Induced Liver Cytokine/Chemokine Programs

To analyze the immunoregulatory function of the VIP neuropeptide, we assessed hepatic chemokine/cytokine gene expression. The neutrophil/monocyte-derived proinflammatory chemokine [CXCL1, chemokine (C-C motif) ligand 2 (CCL2), and CXCL10] and cytokine (TNF-α, IFN-β, IL-1β, and IL-6) programs were suppressed in VIP-treated animals in comparison with controls (P < 0.001 and P < 0.01; Fig. 3A,C). In contrast, IL-10 levels were selectively elevated after VIP treatment (P < 0.001; Fig. 3B).

image

Figure 3. Quantitative reverse-transcription polymerase chain reaction–assisted detection of cytokines/chemokines in mouse livers (6 hours of reperfusion after 90 minutes of ischemia): (A) CXCL1, CCL2, and CXCL10; (B) IL-10; and (C) TNF-α, IFN-β, IL-1β, and IL-6. The data have been normalized to HPRT gene expression. *P < 0.001 and **P < 0.01 (n = 4-5 per group).

Download figure to PowerPoint

VIP Depresses IR-Mediated Liver Necrosis/Apoptosis

We screened for IR-induced hepatic oncotic necrosis and apoptosis. Indeed, VIP treatment diminished otherwise abundant hepatocellular necrosis/apoptosis, as evidenced by reduced caspase-3 activity (8.8 ± 2.0 versus 20.7 ± 2.1 pmol/minute/mg in PBS, P < 0.01; Fig. 4A) and a decreased frequency of TUNEL-positive cells (2.0 ± 0.8 versus 31.3 ± 5.4 in PBS, P < 0.001; Fig. 4B). Western blot analysis revealed selectively increased expression of Bcl2/Bcl-xL but suppressed phosphorylation of inhibitor of nuclear factor κ B α/nuclear factor kappa B (NF-κB) p65 proteins after VIP treatment in comparison with PBS controls (Fig. 4C).

image

Figure 4. Necrosis/apoptosis in IR livers (6 hours of reperfusion after 90 minutes of ischemia): (A) caspase-3 activity and (B) TUNEL-assisted detection of hepatic necrosis/apoptosis (dark arrows) in ischemic liver lobes and (C) western blot–assisted detection of Bcl2/Bcl-xL, p-IκBα, and p-NF-κB. *P < 0.01 (n = 4-5 per group).

Download figure to PowerPoint

cAMP-PKA Pathway Is Essential in VIP Modulation of Liver IRI

Because VIP suppresses macrophage function via cAMP-PKA,[13, 17] we asked whether VIP could trigger cAMP-PKA signaling in our model. We recently found that IR might trigger cAMP expression.[19] Indeed, the administration of VIP increased cAMP levels (895 ± 157 versus 512 ± 88 μmol/g, P < 0.01; Fig. 5A) and PKA activity (10.9 ± 0.7 versus 4.0 ± 0.3 ng/g, P < 0.001; Fig. 5A) in comparison with controls.

image

Figure 5. Functional significance of cAMP-PKA in hepatic VIP regulation. (A) The administration of VIP peptides increased liver cAMP levels and elevated PKA activity. (B-D) The adjunctive use of H-89, a PKA inhibitor, restored liver injury in VIP-pretreated groups. This was evidenced by (B) sALT levels; (C) liver histology (representative H&E staining); and (D) TNF-α, CXCL10, and IL-10 expression. *P < 0.001 and **P < 0.01 (n = 4-5 per group).

Download figure to PowerPoint

We used H-89, a specific PKA inhibitor, to study whether cAMP-PKA activation is essential for VIP-mediated immunomodulation. Adjunctive inhibition of PKA activity exacerbated liver IRI in VIP-pretreated mice, as evidenced by increased sALT levels (7072 ± 1699 U/L with VIP plus H-89 versus 634 ± 68 U/L with VIP, P < 0.001; Fig. 5B) and hepatocellular damage. Livers after combined VIP and PKA inhibition therapy were characterized by extended zonal/panlobular parenchyma necrosis with widespread sinusoidal congestion and severe edema (Fig. 5C) and were comparable to PBS controls. The intrahepatic expression of proinflammatory TNF-α and CXCL10 was uniformly heightened, whereas IL-10 levels diminished after treatment with VIP plus H-89 (Fig. 5D).

VIP Modulates the Macrophage TLR4 Response

TLR4 activation triggers IR-mediated liver inflammation.[2] Because macrophages express all 3 VIP receptors,[13-15] TLR4-targeted regulation may have contributed to VIP effects in our model. We tested whether and how VIP-mediated cAMP-PKA could affect the macrophage TLR4 response. BMM cultures were stimulated with LPS (a TLR4 ligand) in the absence or presence of VIP plus H-89 (a PKA inhibitor) or DMSO (control). VIP depressed otherwise enhanced LPS-induced TNF-α, IL-6, and IL-12p40 expression (P < 0.001; Fig. 6A-C) but increased IL-10 expression (P < 0.001; Fig. 6D). In contrast, H-89–mediated PKA inhibition enhanced TNF-α, IL-6, and IL-12p40 levels in VIP groups (P < 0.001; Fig. 6A-C) in comparison with unmodified VIP cultures. Moreover, IL-10 levels decreased in BMM cultures supplemented with VIP plus H-89 (P < 0.001; Fig. 6D) in comparison with VIP alone.

image

Figure 6. Effects of the VIP neuropeptide on macrophage TLR4 activation in vitro. BMMs were stimulated with LPS in the absence or presence of VIP peptides plus H-89 (a PKA inhibitor) or DMSO (control). The production of (A) TNF-α, (B) IL-6, (C) IL-12, and (D) IL-10 in culture supernatants is shown. *P < 0.001. Representative of n=3/group.

Download figure to PowerPoint

VIP Attenuates Hepatocyte Death

To assess the immunomodulatory function of VIP-induced cAMP-PKA signaling in hepatocytes, we designed a primary hepatocyte culture that mimicked liver IR-mediated hepatocellular damage in vivo. Because both necrosis and apoptosis are essential to the pathophysiology of liver IRI, we used H2O2 to mimic in vivo ROS-triggered hepatocyte necrosis or TNF-α/ActD to induce apoptosis. Native mouse hepatocytes were cultured in the presence of VIP with H-89 (a PKA antagonist) or DMSO (control). The addition of VIP consistently suppressed hepatocyte death (assessed with the fluorescence-activated cell sorting–assisted frequency of annexin V+7AAD+ cells; Fig. 7A) and diminished caspase-3 activity (Fig. 7B) and LDH and ALT release (Fig. 7C,D) in comparison with controls. In contrast, PKA inhibition enhanced hepatocyte death (Fig. 7A) and caspase-3 activity (Fig. 7B). In addition, PKA inhibition increased the release of LDH (Fig. 7C) and ALT (Fig. 7D) in hepatocyte cultures.

image

Figure 7. Cytoprotective effects of VIP neuropeptides on hepatocytes in vitro. H2O2 or TNF-α and ActD were used to induce primary murine hepatocyte necrosis/apoptosis in the absence or presence of VIP peptides with H-89 (a PKA inhibitor) or DMSO (control): (A) fluorescence-activated cell sorting–assisted detection of dead annexin V+7AAD+ cells, (B) hepatocellular caspase-3 activity, (C) LDH release, and (D) ALT levels in supernatants. *P < 0.001. Representative of n=3/group.

Download figure to PowerPoint

DISCUSSION

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. REFERENCES

Although VIP neuropeptides regulate macrophage activation and stimulate glucose-induced insulin secretion,[17, 18, 30] their role in innate immunity-driven liver inflammation and IRI remains ill defined. Here we show that (1) VIP was induced in a mouse model of liver warm IR damage, (2) exogenous VIP protected livers against IRI by inhibiting TLR4 activation and improving hepatocyte survival, and (3) VIP-mediated cytoprotection was cAMP-PKA–dependent. These results are consistent with our findings for PACAP neuropeptides in this model.[20]

In the present study, we first found local VIP expression in IR-stressed livers, the levels of which were elevated between 12 and 24 hours of reperfusion. This may imply a regulatory role for intrinsic VIP in liver self-repair. We then asked whether the administration of exogenous VIP would attenuate liver IRI. Because IR-induced liver damage peaks at 6 hours of reperfusion,[29] we focused on this time point to demonstrate the modulatory role of VIP neuropeptides. Strikingly, VIP treatment diminished hepatocellular damage, as evidenced by decreased sALT levels and an amelioration of cardinal features of liver IRI (ie, edema, vacuolization, and necrosis). These findings are consistent with the ability of VIP to prevent transient ischemic brain damage in a rat model of focal cerebral ischemia.[31]

We found increased infiltration by CD68+ macrophages, which was consistent with a preferential proinflammatory chemokine gene expression profile in IR-stressed livers.[1-4] Because VIP therapy suppresses macrophage function,[13, 17, 18] others have suggested that VIP may act as an essential neural immunomodulator in autoimmune diseases.[32] We observed reduced macrophage migration and decreased activation/function along with diminished expression of IRI signature genes [ie, TNF-α, IL-1β, IL-6, CXCL10, and CCL2 (monocyte chemoattractant protein 1]. Indeed, CXCL10, one of the key mediators in the type I IFN pathway downstream of TLR4,[3, 4] may be directly regulated by VIP. In agreement with our in vivo findings, VIP nearly abolished TLR4-mediated proinflammatory cytokine programs in BMM cultures.

The PKA pathway in VIP regulation[17, 18] may modulate multiple intracellular events.[33] We have identified cAMP-PKA activation as a regulator that halts pathological cell recruitment, prevents destructive immune reactions, and promotes hepatocyte survival.[19] This implies that PKA activation may raise defensive thresholds against the IR inflammatory response. Indeed, VIP treatment enhanced hepatic cAMP levels and augmented PKA activity, whereas PKA inhibition restored a proinflammatory profile in VIP-treated BMM cultures. Strikingly, in vivo PKA antagonism restored liver IRI pathology in otherwise IR-resistant VIP-treated hosts.

TLR4-mediated innate immune activation progresses through myeloid differentiation factor 88–dependent and/or Toll-interleukin 1 receptor domain-containing adapter inducing interferon-beta (TRIF)-dependent pathways.[34] Our previous studies have indicated that signaling via TRIF/IFN regulatory factor 3 rather than myeloid differentiation factor 88 is instrumental for downstream NF-κB activation, IR inflammation, and hepatocellular damage.[2, 4] We have shown that cAMP-PKA activation may directly inhibit NF-κB by modulating p65 phosphorylation, stabilizing/elevating IκB, and regulating the transactivation/stability of NF-κB complexes.[19] The cAMP-PKA signaling cascade may also indirectly enhance the phosphorylation of cyclic adenosine monophosphate response element binding (CREB), which has a higher affinity for CREB-binding protein, and result in competitive sequestration of p65/CREB-binding protein complexes in IR livers.[19] Here we show that VIP-induced cAMP-PKA activation decreased the phosphorylation/proteolytic degradation of the IκB subunit, suppressed the phosphorylation of NF-κB p65 and downstream proinflammatory programs, yet augmented IL-10, and all of these things enhanced hepatocyte survival. In agreement with the in vivo data, we found that PKA activation diminished the proinflammatory cytokine profile in LPS-activated BMM cultures.

Activated neutrophils (polymorphonuclear neutrophils (PMNs)) generate ROS to promote tissue damage in the second phase of liver IRI.[1] In contrast to the increased neutrophil infiltration/MPO activity in controls, livers in VIP-conditioned mice showed decreased Ly-6G+ neutrophil infiltration and MPO activity and depressed levels of CXCL1 (Kupffer cells (KC)), the key neutrophil chemoattractant. Because neutrophil activity can be enhanced by macrophage-produced cytokines, VIP can also exert its regulatory function during liver IRI through proinflammatory cytokine/chemokine networks.

Both necrosis and apoptosis are responsible for IR hepatocyte damage.[35] Death receptor activation, mitochondrial Ca2+ loading, and ROS promote the mitochondrial permeability transition and lead to hepatocellular swelling, rupture of the plasma membrane, and release of cytochrome C, which ultimately result in adenosine triphosphate depletion–dependent oncotic necrosis and caspase-dependent apoptosis.[1] Hepatocyte oncotic necrosis and apoptosis, which proceed via DNA degradation, can be detected with a TUNEL assay.[35] Interestingly, VIP treatment inhibited necrosis/apoptosis, as evidenced by the decreased frequency of TUNEL-positive cells and caspase-3 activity in IR livers. VIP enhanced the hepatic expression of Bcl2/Bcl-xL, and this suggested PKA activation–mediated cytoprotection by antinecrotic/apoptotic proteins. It is plausible that neural immunomodulation prevents hepatocellular damage by modifying the proapoptotic/antiapoptotic ratio, maintaining mitochondrial integrity, or promoting adenosine triphosphate generation. To distinguish between necrosis and apoptosis in hepatocyte cultures, we employed H2O2 to mimic in vivo ROS-triggered necrosis or TNF-α to induce apoptosis. VIP supplementation diminished hepatocyte death, reduced caspase-3 activity, and ameliorated ALT/LDH release in both culture systems. These results, in agreement with our in vivo data, reinforce the immunomodulatory role of VIP in depressing NF-κB in nonparenchymal and parenchymal liver compartments with resultant improvements in hepatocellular function. Moreover, PKA inhibition exacerbated hepatocyte death, and this confirms that neural regulation at the hepatocyte level is cAMP-PKA–dependent.

In conclusion, this study is the first to reveal the mechanisms of the exogenous VIP neuropeptide for attenuating liver IRI by depressing macrophage function and improving hepatocyte survival in a cAMP-PKA–dependent manner. Harnessing immunoregulatory and cytoprotective mechanisms via VIP may be essential to the maintenance of hepatic homeostasis in vivo through the minimization of local organ damage and the promotion of IL-10 cytoprotection. Because VIP is being developed into a therapeutic principle for humans,[22-26] this very important peptide should also be considered as a novel therapy for targeting IR-triggered hepatic inflammation and damage in liver transplant patients.

REFERENCES

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. REFERENCES