The effects of NOD activation on adipocyte differentiation

Authors


Abstract

Objective:

Obesity is associated with chronic inflammation. Toll-like receptors (TLR) and NOD-like receptors (NLR) are two families of pattern recognition receptors that play important roles in immune response and inflammation in adipocytes. It has been reported that TLR4 and TLR2 activation induce proinflammatory changes that impair adipocyte differentiation. However, the effects of activation of NOD1 and NOD2, the two prominent members of NLR, on adipocyte differentiation have not been studied.

Design and Methods:

3T3-L1 and human adipose-derived stem cells were tested for adipocyte differentiation in the presence or absence of NOD ligand. Adipocyte differentiation was evaluated by the adipocyte markers gene expression and Oil Red O staining for lipid accumulation.

Results:

Activation of NOD1, but not NOD2, by a synthetic ligand dose-dependently suppressed 3T3-L1 adipocyte differentiation as revealed by Oil Red O stained cell morphology, lipid accumulation, and attenuated gene expression of adipocyte markers (PPARγ, C/EBPα, SCD, FABP4, Adiponectin). Activation of NOD1, but not NOD2, induced NF-κB activation, which correlated with their abilities to suppress ligand-induced PPARγ transaction. Moreover, the suppressive effect by NOD1 activation was reversed by IκB super-repressor which blocks NF-κB activation. The suppression by NOD1 ligand C12-iEDAP on adipocyte differentiation was reversed by small RNA interference targeting NOD1, demonstrating the specificity of NOD1 activation. In contrast, activation of NOD1 and NOD2 both significantly suppressed adipocyte differentiation of human adipose-derived adult stem cells, demonstrating the species specific effects of NOD activation. In contrast to enhanced leptin mRNA by LPS and TNFα, NOD1 activation suppressed leptin mRNA in adipocytes, suggesting the differential effects of NOD1 activation in adipocytes.

Conclusions:

Overall, our results suggest that NOD1 represents a novel target for adipose inflammation in obesity.

Introduction

Obesity is a global epidemic that affects both adults and children. Obesity is associated with increased risk of developing chronic diseases such as insulin resistance, diabetes, cardiovascular disease and certain cancers. Obesity results from not only increased adipocyte cell size but also increased adipocyte cell numbers. New adipocytes are generated by a process known as differentiation. During this process, fibroblast-like preadipocytes are differentiated into mature, spherical, and lipid-filled adipocytes. There are more than 100 molecules upregulated in the process, including two families of transcription factors, peroxisome proliferator-activated receptor γ (PPARγ) and CCAAT/enhancer binding protein α (C/EBPα), which control the induction of the differentiation program, genes involved in lipogenesis (e.g., stearoyl-CoA desaturase, adipocyte-specific fatty acid binding protein-4 (FABP4) and adipokines (e.g., adiponectin and leptin) (1, 2).

Accumulating evidence has shown that obesity is associated with chronic inflammation (3, 4). Toll-like receptors (TLR) and nucleotide-oligomerization domain containing protein-like receptor (NLR) are two families of pattern recognition receptors (PRR) that play critical roles in innate immune response and inflammation (5). TLRs are transmembrane receptors composed of extracellular leucine-rich repeat motifs, and a cytoplasmic Toll/interleukin-1 receptor homology domain. So far, 10 and 12 functional TLRs have been identified in humans and mice, respectively (6). NLRs are a family of cytosolic sensors that play important roles in innate immunity and inflammation. These NLRs display a central nucleotide-binding domain, an N-terminal protein interaction domain, and a C-terminal leucine-rich repeat domain (7). Two prominent members of NLRs are NOD1 and NOD2, whose recognition motifs in bacterial peptidoglycan have been mapped. The minimal peptidoglycan structure that NOD1 recognizes is a dipeptide, γ-D-Glu-meso-diaminopimelic acid (iE-DAP) (8) or a tripeptide, L-Ala-γ-D-Glu-meso-diaminopimelic acid (9) derived mostly from Gram-negative bacteria, whereas NOD2 recognizes the minimal peptidoglycan muramyl dipeptide, MurNAc-L-Ala-D-isoGln (muramyl dipeptide (MDP)), from both Gram-positive and Gram-negative bacteria (10, 11). Recognition of the ligand leads to NOD1 or NOD2 oligomerization through the central domain and triggers the interaction of their N-terminal caspase-activating and recruitment domain (CARD) with another caspase-activating and recruitment domain from the downstream adapter molecule receptor-interacting protein 2 (Rip2, also called RICK/CARDIAK) (12). Rip2 activation leads to ubiquitination and degradation of IκB kinase γ (IKKγ), the regulator of the IKK complex (13, 14), and Rip2 itself (15, 16), resulting in activation of IKK complex and nuclear factor-κB (NF-κB) activation. In addition, activation of NOD also leads to activation of MAPK pathways (17, 18, 19), although the molecular links between them are less well characterized. Triggering of the signaling pathways leads to proinflammatory cytokine and chemokine gene expression and other host defense responses (20).

It has been reported that various TLRs, NOD1, and NOD2 are expressed in adipocytes and adipose tissues of mice and human origin (21, 22, 23). Activation of TLR4 or NOD1 leads to proinflammatory responses and insulin resistance in adipocytes (23, 24). Moreover, the proinflammatory environment induced by activation of TLR4 or TLR2 leads to suppression of adipocyte differentiation (25, 26).

We have recently reported the role of NOD1 activation by the synthetic ligand in inducing proinflammatory cytokine/chemokine expression and insulin resistance in adipocytes (23). Both NOD1 and NOD2 mRNA were markedly up-regulated upon differentiation of 3T3-L1 and human primary preadipocyte cultures derived from subcutaneous fat. However, the effects of NOD1 and NOD2 activation on adipocyte differentiation have not been studied.

Here we report that the effects of NOD activation on adipocyte differentiation. Activation of NOD1, but not NOD2, suppressed 3T3-L1 adipocyte differentiation; in contrast, activation of NOD1 and NOD2 both suppressed adipocyte differentiation of human adipose-derived adult stem cells (hADSCs).

Methods and Procedures

Reagents

NOD1 synthetic ligand lauroyl-γ-D-glutamyl-meso-diaminopimelic acid (C12-iEDAP) and NOD2 synthetic ligand MDP were purchased from InvivoGen (San Diego, CA). Lipopolysaccharide (LPS) from Escherichia coli 055:B5 (L2880), methylisobutylxanthine, dexamethasone, rosiglitazone, and insulin were from Sigma (St Louis, MO).

Cell culture and induction of adipocyte differentiation

Murine 3T3-L1 fibroblasts (ATCC, Manassas, VA) were grown in Dulbecco's modified Eagle's medium containing 10% calf serum (Hyclone, Logan, UT) in 5% CO2, 37°C environment until they reach confluence. The differentiation was initiated as described (27). Briefly, on the day the cells reach confluence (designated as day 0, D0), cells were treated with differentiation Dulbecco's modified Eagle's medium containing 10% fetal bovine serum (Atlas Biologicals, Fort Collins, CO), 10 µg/ml insulin, 1 µmol/l dexamethasone, and 0.5 mmol/l 3-isobutyl-L-methylxanthine for 3 days. The cells were then grown in maintenance Dulbecco's modified Eagle's medium containing 10% fetal bovine serum and 10 µg/ml insulin for an additional 2 days followed by Dulbecco's modified Eagle's medium containing 10% fetal bovine serum on day 5 (D5) until the cells were fully differentiated on day 7 (D7). hADSCs were purchased from Zen-Bio (Research Triangle Park, NC) and were grown and differentiated according to the manufacturer's instructions. Briefly, the cells were seeded and grown in 60-mm tissue culture dishes in preadipocyte medium until confluence. The differentiation was initiated with adipocyte differentiation medium for 7 days and maintained in adipocyte maintenance medium for additional 7 days. All media used for human primary cell culture were purchased from Zen-Bio. To study the effects of NOD activation on differentiation, the cells were differentiated in the presence or absence of NOD1 ligand C12-iEDAP, NOD2 ligand MDP, TLR4 ligand LPS, or cytokine tumor necrosis factor α (TNFα) during the whole process.

3T3-L1CARΔ1 cells, which stably express coxsackie and adenovirus receptor was provided by Dr David J. Orlicky (University of Colorado Health Sciences Center) (28). As previously described (29), this cell line with stable expression of the truncated receptor for coxsackievirus and adenovirus receptor (CAR) has ∼100-fold greater adenoviral infection efficiency, yet with similar insulin response compared to parental 3T3-L1 cells. 3T3-L1CAR Δ1 cells were grown and maintained as described (29).

NF-κB reporter gene assay, transient transfection, and adenovirus transduction

3T3-L1CARΔ1 cells or hADSCs were seeded in 24-well plates and were transduced with adenovirus expressing NF-κB-Luc reporter gene or β-galactosidase (β-gal) for 24 h. The cells were treated with C12-iEDAP, MDP, LPS, or vehicle control for 15 h before the cells were lysed and reporter luciferase activities were measured with GloMax-Multi+ Detection System (Promega, Madison, WI). The luciferase activities were normalized by β-gal activities.

3T3-L1CARΔ1 cells were seeded and transfected with PPRE-Luc reporter gene (Addgene, Cambridge, MA) using Fugene HD transfection reagent (Promega) for 24 h. The cells were either pretreated with C12-iEDAP or LPS followed by cotreatment with PPARγ synthetic ligand rosiglitazone for 15 h before lysis or further transduced with adenovirus expressing IκBα super-repressor (IκBα(SR)) (30) or β-gal for additional 24 h before the treatment and lysis. Reporter luciferase activities were measured and normalized by protein concentrations.

Oil Red O staining and quantification

To quantify lipid accumulation, differentiated cells were fixed with 4% paraformaldehyde overnight, then rinsed with deionized water and stained with Oil Red O solution (60% Oil Red O in isopropanol) for 10 min. After staining, cells were rinsed with deionized water and cell pictures were taken. To quantify the staining, the Oil Red O was eluted using 100% isopropanol for 10 min and measured by OD (absorbance) reading at 500 nm in a spectrophotometer.

RNA preparation and quantitative real-time PCR analysis

At indicated times, total RNA was prepared from adipocytes using Trizol (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. Total RNA abundance was quantified using a NanoDrop ND-1000 Spectrophotometer (NanoDrop Technologies, Wilmington, DE). Reverse transcription was carried out using High-Capacity Reverse Transcription kit (Applied Biosystems, Foster City, CA) according the manufacturer's instructions. mRNA expression of various adipocyte marker genes, and loading control 36B4 were measured quantitatively using gene-specific TaqMan gene expression assays (Applied Biosystems) and were run in a 96-well format using an ABI 7300HT instrument. Cycle conditions were 50°C 2 min, 95°C 15 min, then 40 cycles of 95°C for 15 s/60°C for 1 min.

Small RNA interference

3T3-L1 preadipocytes were stably transfected with ready-made psiRNA expressing shRNA targeting mouse NOD1 or negative control gene luciferase (Invivogen, San Diego, CA). si-mNOD1 sequence: GTGAGGAACTGACCAAGTATA; si-Luc sequence: GACTTACGCTGAGTACTTCGA. Stable individual clones were selected and maintained in zeocin-containing media. NOD1 stable knockdown or negative control clones were screened for basal NOD1 mRNA expression and differentiation capability.

Statistical analysis

All data were presented as means ± SE. Each experiment was repeated at least three times. Within an experiment, measurements were performed in triplicates. Data were Log transformed when appropriate. Statistical analysis was performed using SigmaPlot 11.0 (Systat Software, Chicago, IL). One-way ANOVA or one-way ANOVA with repeated measures was performed followed by multiple comparisons test (Student–Newman–Keuls method) to determine the differences between the treatment groups or time points. The level of significance was set at P < 0.05.

Results

NOD1 activation by the synthetic ligand C12-iEDAP suppressed 3T3-L1 adipocyte differentiation

We examined the effects of NOD1 activation on 3T3-L1 adipocyte differentiation by treating 3T3-L1 preadipocytes from initiation (D0) to the end of differentiation process (D7) with or without NOD1 ligand C12-iEDAP. The levels of differentiation were assessed by presence of adipocyte morphology, lipid accumulation, and mRNA expression of adipocyte marker genes. NOD1 activation via C12-iEDAP (10 µg/ml) suppressed 3T3-L1 adipocyte differentiation compared to the control as shown by the Oil Red O stained adipocyte morphology ( Figure 1a). The overall differentiation and lipid accumulation as judged by Oil Red O absorbance was suppressed to ∼40% of the vehicle control (P < 0.01), which was more potent than LPS with the same concentration (10 µg/ml) (Figure 1a and b). Analysis of mRNA expression of marker genes supported the results of cell morphology and Oil Red O staining (Figure 1c). NOD1 activation suppressed mRNA expression of the two master regulators of adipocyte differentiation: PPARγ and C/EBPα starting from D5 and reached the maximal suppression by C12-iEDAP at D7 (P < 0.01). Consequently, the adipocyte marker genes involved in lipid metabolism stearoyl-CoA desaturase and FABP4 were also suppressed by C12-iEDAP at D3 and/or D5 with the maximal suppression at D7 (P < 0.01). Similarly, the adipokine adiponectin mRNA was also suppressed by C12-iEDAP at D7 (P < 0.01). While leptin mRNA was increased by LPS at D7, the differentiated stage, consistent with the report (25), but was suppressed by C12-iEDAP (P < 0.01) (Figure 1c).

Figure 1.

NOD1 activation by lauroyl-γ-D-glutamyl-meso-diaminopimelic acid (C12-iEDAP) suppressed 3T3-L1 adipocyte differentiation. 3T3-L1 cells were differentiated in the presence or absence of C12-iEDAP (10 µg/ml) or lipopolysaccharide (LPS) (10 µg/ml). (a) Oil Red O staining of cell morphology at day 7 (D7) and quantification of (b) Oil Red O absorbance were shown. (c) Relative mRNA expression of adipocyte markers at D0 (initiation of differentiation), D3, D5, and D7 were analyzed by quantitative reverse transcription (RT)-PCR using Taqman gene expression assays. The relative gene expression was normalized to 36B4 gene and expressed as fold of D0 vehicle samples (set at 1). Data are mean ± SE (n = 3). *,#Significant changes with P < 0.05 and P < 0.01, respectively, from the controls.

To confirm the effects of C12-iEDAP, we performed dose response study of C12-iEDAP on adipocyte differentiation. C12-iEDAP dose-dependently suppressed mRNA expression of all the adipocyte genes examined, including leptin ( Figure 2) at D7.

Figure 2.

The effects of NOD1 activation on 3T3-L1 adipocyte differentiation were dose dependent. 3T3-L1 cells were differentiated in the presence of increasing doses of lauroyl-γ-D-glutamyl-meso-diaminopimelic acid (C12-iEDAP) (0, 1, 10 µg/ml). Relative mRNA expression of adipocyte markers at D7 were analyzed by quantitative reverse transcription (RT)-PCR using Taqman gene expression assays. The relative gene expression was normalized to 36B4 gene and expressed as fold of D0 vehicle samples (set at 1). Data are mean ± SE (n = 3).

Adiponectin and leptin are the two most important adipokines that are secreted primarily by adipocytes and play critical roles in modulating whole body homeostasis (31). It has been reported that proinflammatory stimulants suppress adiponectin but increase leptin expression (32, 33). We further examined the effects of C12-iEDAP in differentiated adipocytes on adiponectin and leptin mRNA expression. C12-iEDAP suppressed both adiponectin and leptin mRNA expression in a time- and dose-dependent manner in 3T3-L1 adipocytes ( Figure 3a and b). Similar results were observed by another synthetic NOD1 ligand Tri-DAP (data not shown).

Figure 3.

NOD1 activation suppressed both adiponectin and leptin mRNA in a time-and dose-dependent manner in differentiated 3T3-L1 adipocytes. 3T3-L1 adipocytes (D7) were treated at indicated (a) times and (b) doses with lauroyl-γ-D-glutamyl-meso-diaminopimelic acid (C12-iEDAP). Relative adiponectin and leptin mRNA were analyzed by quantitative reverse transcription (RT)-PCR using Taqman gene expression assays. The relative gene expression was normalized to 36B4 gene and expressed as fold of D0 vehicle samples (set at 1). Data are mean ± SE (n = 3).

NOD2 activation did not suppress 3T3-L1 adipocyte differentiation

To investigate whether NOD2 activation had similar effects on 3T3-L1 differentiation, we treated the cells with increasing concentrations of NOD2 ligand MDP from D0 to D7. NOD2 activation by MDP up to 100 µg/ml did not suppress differentiation at D7 as judged by Oil Red O stained cell morphology ( Figure 4a) and the absorbance (Figure 4b). mRNA expression of selected marker genes (PPARγ, FABP4, and adiponectin) confirms the lack of suppression on differentiation by NOD2 activation (Figure 4c). Time course analysis revealed that NOD2 activation by MDP at 100 µg/ml only transiently suppressed the differentiation at D3, but the suppression was not maintained through the end of the differentiation process (Figure 4d).

Figure 4.

NOD2 activation by muramyl dipeptide (MDP) did not suppress 3T3-L1 adipocyte differentiation. 3T3-L1 cells were differentiated in the presence of increasing doses of MDP (0, 10, 50, 100 µg/ml). (a) Oil Red O staining of cell morphology at day 7 (D7) and quantification of (b) Oil Red O absorbance were shown. (c) Relative mRNA expression of adipocyte markers at D7 were analyzed. (d) The effects of MDP (100 µg/ml) on mRNA expression of adipocyte markers at D0, D3, D5, and D7 were analyzed. (e) The effects of NOD1 and NOD2 activation on mRNA expression of TLR4, TLR2, NOD1, and NOD2. Relative mRNA expression of NOD1, NOD2, TLR4, and TLR2 were analyzed at D7 when 3T3-L1 cells were differentiated in the presence of lauroyl-γ-D-glutamyl-meso-diaminopimelic acid (C12-iEDAP), MDP, lipopolysaccharide (LPS) or vehicle control. Gene expression was analyzed by quantitative reverse transcription (RT)-PCR using Taqman gene expression assays, normalized to 36B4 gene and expressed as fold of D0 vehicle samples (set at 1). Data are mean ± SE (n = 3). *,#Significant changes with P < 0.05 and P < 0.01, respectively, from the controls.

Stimulation of TLR4 with LPS has been shown to increase TLR2 gene expression in 3T3-L1 adipocytes and primary adipocytes from mice (34). We examined whether exposure of NOD1 ligand or NOD2 ligand during the differentiation induces changes in the gene expression of NOD1 and NOD2 as well as TLR4 and TLR2, which could affect differentiation. The most dramatic effects were observed at D7. C12-iEDAP and MDP both significantly induced NOD2 mRNA (P < 0.01); however, no significant effects on NOD1 mRNA were observed. C12-iEDAP also significantly increased TLR2 mRNA (P < 0.01), but suppressed TLR4 mRNA (P < 0.01) ( Figure 4e). TLR4 activation by LPS increased TLR2 mRNA in 3T3-L1 cells, as reported (34) (Figure 4e).

Since the activation of NOD1, but not NOD2, suppresses 3T3-L1 adipocyte differentiation, to confirm that the suppression by C12-iEDAP on 3T3-L1 differentiation was via NOD1 in our experiments, we generated individual stable 3T3-L1 clones whose NOD1 mRNA has been stably knocked down by small RNA interference targeting NOD1 (shNOD1) to ∼20% of nontransfected control cells (control) ( Figure 5a). Compared with Luc-targeting control cells (shLuc), NOD1 stable knockdown reversed the suppression of C12-iEDAP on differentiation, shown by the PPARγ and C/EBPα mRNA, markers of differentiation (Figure 5b), but had no effects on MDP's effects, confirming that the specificity of the effects of NOD1 activation.

Figure 5.

The effects of lauroyl-γ-D-glutamyl-meso-diaminopimelic acid (C12-iEDAP) on adipocyte differentiation were via NOD1. 3T3-L1 stable knockdown with shRNA targeting NOD1 (shNOD1), nontargeting cells (shLuc) or nontransfected control cells were analyzed for NOD1 mRNA level (a) and were differentiated in the presence of C12-iEDAP, muramyl dipeptide (MDP) or vehicle (b). (b) Relative mRNA expression of adipocyte markers at D5 were analyzed by quantitative reverse transcription (RT)-PCR using Taqman gene expression assays. The relative gene expression was normalized to 36B4 gene and expressed as fold of vehicle treated samples (set at 1). Data are mean ± SE (n = 3). #Significant changes with P < 0.05 from the controls.

It has been reported that proinflammatory cytokine TNFα inhibits adipocyte differentiation through suppression of PPARγ transcriptional activation by TAK1/TAB/NIK kinase-mediated NF-κB activation (35). To study the role of NF-κB in NOD1-mediated suppressive effects on differentiation, we employed 3T3-L1 cells stably transfected with truncated receptor for coxsackievirus and adenovirus receptor (3T3-L1CARΔ1) (28, 29). We confirmed that C12-iEDAP and LPS, but not MDP, activated NF-κB, as determined by NF-κB reporter gene assays (P < 0.01) ( Figure 6a). Moreover, C12-iEDAP and LPS, but not MDP, suppressed the synthetic ligand rosiglitazone-induced PPARγ activation (P < 0.01 and P < 0.05, respectively) (Figure 6b). The suppressive effects by C12-iEDAP and LPS were reversed by IκB super-repressor (IκB(SR)), which contains two amino acid substitutions (S32A/S36A) that prevent phosphorylation and degradation of the protein and blocks the activation of NF-κB in response to proinflammatory stimulations (30) (Figure 6c).

Figure 6.

NOD1 activation suppressed ligand-induced peroxisome proliferator-activated receptor γ (PPARγ) transactivation through nuclear factor-κB (NF-κB) pathway in 3T3-L1 cells. (a) 3T3-L1CARΔ1 cells were transduced with adenovirus containing with NF-κB-Luc reporter gene or β-galactosidase (β-gal) for 24 h. The cells were stimulated with lauroyl-γ-D-glutamyl-meso-diaminopimelic acid (C12-iEDAP), lipopolysaccharide (LPS), muramyl dipeptide (MDP) or vehicle for 15 h before lysis. (b) 3T3-L1CARΔ1 cells were transiently transfected with PPRE-Luc for 24 h. The cells were pretreated with C12-iEDAP, LPS, or MDP for 1 h followed by cotreatment with PPARγ synthetic ligand rosiglitersone (rosi, 2.5 µmol/l) for 15 h before lysis. (c) 3T3-L1CARΔ1 cells were transiently transfected with PPRE-Luc for 24 h and were then transduced with adenovirus containing β-gal or IκBα(SR)) for further 24 h. The cells were pretreated with C12-iEDAP and LPS followed by cotreatment with rosi for 15 h before lysis. The reporter gene assays were performed and the data were normalized. Data are mean ± SE (n = 3). *,#Significant changes with P < 0.05 and P < 0.01, respectively, from the controls.

The effects of NOD activation on adipocyte differentiation of hADSCs

We further examined the effects of NOD activation on adipocyte differentiation of hADSCs. We first examined whether NOD1 and NOD2 can be activated in hADSCs by NF-κB reporter gene assays. Activation of NOD1 (P < 0.01) and TLR4 (P < 0.01), but not NOD2, induced NF-κB activation in hADSCs ( Figure 7a). Next, hADSCs were differentiated in the presence of either C12-iEDAP, MDP, or vehicle control (D0 to D14). In contrast to 3T3-L1 cells, both C12-iEDAP and MDP suppressed the differentiation as judged by Oil Red O stained cell morphology (Figure 7b, and a panel of adipocyte marker genes (Figure 7c). In addition, similar to 3T3-L1 adipocytes, C12-iEDAP suppressed both adiponectin (P < 0.01) and leptin mRNA (P = 0.06) at D14. MDP suppressed adiponectin mRNA (P < 0.05), but had little effect on leptin (P = 0.2). Both LPS and TNFα suppressed adiponectin mRNA (P < 0.01) but increased leptin mRNA (P < 0.01 and P < 0.05, respectively) in adipocytes differentiated from hADSCs (Figure 7c). We also examined the effects of NOD1 or NOD2 activation on mRNA expression of NOD1 and NOD2 as well as TLR4 and TLR2 in hADSCs at D14. Activation of NOD1 by C12-iEDAP did not significantly affect mRNA expression of NOD1, NOD2, TLR4, and TLR2 in hADSCs (Figure 7d). In contrast, NOD2 activation by MDP only significantly decreased its own mRNA expression (P < 0.05) (Figure 7d). Similar to 3T3-L1, LPS also significantly increased TLR2 mRNA in hADSCs (P < 0.01) (Figure 7d).

Figure 7.

Activation of NOD1 and NOD2 both suppressed adipocyte differentiation of human adipose-derived adult stem cells. (a) Human adipose-derived adult stem cells (hADSCs) were transduced with adenovirus containing nuclear factor-κB (NF-κB)-Luc reporter gene and β-gal for 24 h. The cells were treated with lauroyl-γ-D-glutamyl-meso-diaminopimelic acid (C12-iEDAP), muramyl dipeptide (MDP) or lipopolysaccharide (LPS) for 15 h before lysis. Reporter gene assays were performed. Luciferase activities were normalized by the β-galactosidase (β-gal) activities. (b–d) hADSCs were differentiated in the presence of C12-iEDAP, MDP, LPS, tumor necrosis factor α (TNFα), or vehicle for 14 days. Oil Red O stained cell morphologies at D14 were shown (b). (c) Relative mRNA expression of adipocyte genes at D0 (initiation of differentiation), and D14 were analyzed by quantitative reverse transcription (RT)-PCR using Taqman gene expression assays. (d) Relative mRNA expression of NOD1, NOD2, TLR4, and TLR2 were analyzed at D14. The relative gene expression was normalized to 36B4 gene and expressed as fold of either D0 vehicle or vehicle (set at 1). Data are mean ± SE (n = 3). *,#Significant changes with P < 0.05 and P < 0.01, respectively, from the controls.

Discussion

Accumulating evidence has shown that obesity is associated with chronic inflammation (3, 4). Two families of PRR, TLR and NLR, NOD1 and NOD2 in particular, have been shown to play critical roles in inflammation in adipocytes (21, 22, 23). A proinflammatory environment induced by activation of TLR4 or TLR2, leads to the suppression of adipocyte differentiation (25, 26). Here we show that activation of NOD1, but not NOD2, suppresses 3T3-L1 differentiation whereas activation of NOD1 and NOD2 similarly suppress the adipocyte differentiation of hADSCs.

Our results support the notion that a proinflammatory environment impairs adipocyte differentiation. Interestingly, NOD1 and NOD2 activation also suppress adipocyte differentiation of mesenchymal stem cells derived from human umbilical blood (36). Since inflammation inhibits adipocyte differentiation but promotes endothelial cell differentiation, it has been suggested that as a major influence in adipose tissue microenvironment in the obese state, inflammation could serve as signal mediating the competition between adipocytes and endothelial cells for the limited source of adipose-derived stem cells, which have the potential to be differentiated into multiple lineages of progenitor cells including adipocytes, endothelial cells, fibroblasts (37). By suppressing adipocyte differentiation, NOD activation could favor adipose-derived stem cells differentiation into endothelial cells leading to enhanced angiogenesis in adipose tissue. Further studies are needed to elucidate the role of NOD activation in adipose inflammation in obesity.

NOD1 and NOD2 activation also affect adipokine expression during and/or post adipocyte differentiation. Similar to TLR4 activation and TNFα, activation of NOD1 and NOD2 (in hADSCs) suppressed adiponectin mRNA expression. In addition, NOD1 activation also suppressed leptin mRNA. Our result that NOD1 activation suppresses rather than increases leptin mRNA is in contrast to the notion that proinflammatory stimulants (e.g., LPS or TNFα) increase leptin expression (32). Leptin is a pleiotropic molecule that regulates not only food intake and metabolic and endocrine functions, but also immunity, inflammation and hematopoiesis (31, 32). The most well known role for leptin is the regulation of appetite, as either the absence of leptin or a mutation in leptin receptor genes induces a massive hyperphagia and obesity in animal models and humans (32). Leptin deficiency causes dysregulation of the immune and inflammatory response observed in the animals with absence of leptin or mutation of leptin receptor (32). Moreover, leptin levels are also increased by inflammatory stimulants, such as LPS and TNFα, in experimental animals (32). It has been suggested that an increase in leptin expression may mediate the anorexia of inflammation (38). The fact that NOD1 activation suppresses rather than increases leptin expression suggests the differential effects of NOD1-mediated inflammation in adipocytes, compared to TLR4 and the classical cytokine TNFα. The role of NOD1 activation in adipose inflammation and whole body homeostasis needs to be elucidated further.

The species-specific effects of NOD activation on adipocyte differentiation have been noted. While NOD1 activation suppressed adipocyte differentiation of both 3T3-L1 and hADSCs, NOD2 activation only suppressed adipocyte differentiation of hADSCs. The differential effects may be due to the differences in NOD2 expression levels between murine 3T3-L1 and human ADSCs. We have found that the relative NOD2 mRNA expression (relative to 18S) in hADSCs was more than twofold of that of 3T3-L1 cells (data not shown), which may render hADSCs more sensitive to NOD2 ligand MDP. In addition, we showed C12-iEDAP induced robust upregulation of NOD2 and TLR2 mRNA in 3T3-L1 cells but had minimal effects on mRNA expression of these receptors in hADSCs. In contrast, MDP induced up-regulation of NOD2 mRNA in 3T3-L1, but suppressed it in hADSCs. These results further demonstrate the species specific cellular responses upon NOD activation in adipocytes.

The mechanisms underlying the effects of inflammation on adipocyte differentiation have been suggested (37). It has been shown that TNFα suppresses adipocyte differentiation by suppressing the master transcriptional factor PPARγ mRNA and transcriptional activity through NF-κB pathway. We showed that NOD1 activation by C12-iEDAP suppressed mRNA of PPARγ and C/EBPα in both 3T3-L1 and hADSCs. NOD2 activation by MDP also suppressed mRNA expression of these two transcriptional factors in hADSCs; however, MDP only transiently suppressed mRNA of these two transcriptional factors at day 3 in 3T3-L1 cells, which did not result in suppression of differentiation in the end. Moreover, we confirmed that C12-iEDAP and LPS, but not MDP, induced NF-κB activation as determined by NF-κB reporter gene assays, which were correlated with their abilities to suppress ligand-induced PPARγ transactivation in 3T3-L1 cells. We further demonstrated that the suppressive effects by C12-iEDAP and LPS on PPARγ transactivation were reversed by IκB super-repressor which blocks IκB degradation and NF-κB activation. Together, these results demonstrate that NOD1 activation, similar to TLR4 activation, suppresses PPARγ activity (mRNA and transactivation) in 3T3-L1 cells. Moreover, inflammation could affect adipocyte differentiation through suppressing insulin signaling in adipocytes. We have reported that NOD1 activation led to impaired insulin signaling in adipocytes (23). Therefore, it is conceivable that NOD1 activation could suppress adipocyte differentiation through suppression of insulin signaling. Furthermore, NOD1 activation by C12-iEDAP induced mRNA expression of NOD2 and TLR2, but decreased TLR4 mRNA; therefore, NOD1 activation could suppress differentiation by modulating the activation of other PRRs (e.g., TLR2 and NOD2) through modulating their mRNA expression. Further studies are needed to elucidate the molecular mechanisms underlying NOD1-mediated effects on adipocyte differentiation.

Interestingly, even though NOD2 activation by MDP suppressed adipocyte differentiation, it did not activate NF-κB, as determined by NF-κB reporter gene assays, in hADSCs. Therefore, the mechanisms by which MDP suppressed adipocyte differentiation of hADSCs need to be explored further. It has been reported that activation of NOD2 as well as NOD1 induced autophagic response to invasive bacteria, independent of NF-κB activation (39), suggesting that NOD2 can mediate cellular responses that are independent of NF-κB pathway. Moreover, autophagy, a process that is responsible for the clearance of damaged or old organelles, and large protein aggregates in the cytosol, has been shown to regulate adipose mass, adipocyte differentiation and the balance between white and brown fat in mice (40). It is possible that MDP could induce NOD2-mediated autophagy thereby affecting adipocyte differentiation in hADSCs. Further studies are needed to unravel the mechanisms underlying the effects of NOD2 activation on adipocyte differentiation and whether NOD-mediated autophagy is involved in the process.

Overall, our results suggest that NOD1 and NOD2 may represent novel targets for adipose inflammation in obesity. Understanding the role of NOD proteins in adipose tissue and whole body homeostasis may provide novel strategies for obesity prevention and treatment.

Acknowledgements

The work was supported by University of Tennessee faculty start-up fund to L.Z.

Ancillary