Diet composition modulates expression of sirtuins and Renin-Angiotensin system components in adipose tissue

Authors

  • Lucinéia de Pinho,

    1. Laboratory of Health Science, Postgraduate Program in Health Sciences, University Hospital–Universidade Estadual de Montes Claros (Unimontes), Montes Claros, Brazil
    Search for more papers by this author
  • João Marcus Oliveira Andrade,

    1. Laboratory of Health Science, Postgraduate Program in Health Sciences, University Hospital–Universidade Estadual de Montes Claros (Unimontes), Montes Claros, Brazil
    Search for more papers by this author
  • Alanna Paraíso,

    1. Laboratory of Health Science, Postgraduate Program in Health Sciences, University Hospital–Universidade Estadual de Montes Claros (Unimontes), Montes Claros, Brazil
    Search for more papers by this author
  • Aristides Batista Maia Filho,

    1. Laboratory of Health Science, Postgraduate Program in Health Sciences, University Hospital–Universidade Estadual de Montes Claros (Unimontes), Montes Claros, Brazil
    Search for more papers by this author
  • John D. Feltenberger,

    1. Laboratory of Health Science, Postgraduate Program in Health Sciences, University Hospital–Universidade Estadual de Montes Claros (Unimontes), Montes Claros, Brazil
    2. Touro University Nevada School of Osteopathic Medicine, Las Vegas, Nevada, USA
    Search for more papers by this author
  • André Luiz Sena Guimarães,

    1. Laboratory of Health Science, Postgraduate Program in Health Sciences, University Hospital–Universidade Estadual de Montes Claros (Unimontes), Montes Claros, Brazil
    Search for more papers by this author
  • Alfredo Mauricio. Batista de Paula,

    1. Laboratory of Health Science, Postgraduate Program in Health Sciences, University Hospital–Universidade Estadual de Montes Claros (Unimontes), Montes Claros, Brazil
    Search for more papers by this author
  • Antônio Prates Caldeira,

    1. Laboratory of Health Science, Postgraduate Program in Health Sciences, University Hospital–Universidade Estadual de Montes Claros (Unimontes), Montes Claros, Brazil
    Search for more papers by this author
  • Ana Cristina de Carvalho Botelho,

    1. Laboratory of Health Science, Postgraduate Program in Health Sciences, University Hospital–Universidade Estadual de Montes Claros (Unimontes), Montes Claros, Brazil
    Search for more papers by this author
  • Maria José Campagnole-Santos,

    1. Institute of Biological Sciences, Departments of Pharmacology and Physiology, Universidade Federal de Minas Gerais, Minas Gerais, Brazil
    Search for more papers by this author
  • Sérgio Henrique Sousa Santos

    Corresponding author
    1. Institute of Biological Sciences, Departments of Pharmacology and Physiology, Universidade Federal de Minas Gerais, Minas Gerais, Brazil
    • Laboratory of Health Science, Postgraduate Program in Health Sciences, University Hospital–Universidade Estadual de Montes Claros (Unimontes), Montes Claros, Brazil
    Search for more papers by this author

  • Disclosure: The authors have no competing interests.

Correspondence: Sérgio H. S. Santos (sergiosousas@hotmail.com)

Abstract

Objective

The aim of this study was to evaluate the expression of RAS components and SIRTs enzymes in the adipose tissue of mice fed diets with different macronutrient composition.

Design and Methods

The body weight, food intake, and energy intake (kcal) were evaluated. Blood parameters (insulin sensitivity, glucose tolerance, total cholesterol, HDL-C triglyceride, and glucose levels) were also assessed. Real-time PCR was performed in epididymal adipose tissue samples to analyze the expression of renin, angiotensinogen (AGT), angiotensin-converting enzyme 1 and 2 (ACE and ACE2), and SIRTs 1-7. Male FVB/N mice were divided into 5 groups (N = 10 each) that were fed with experimental diets for 60 days. Test diets were divided into standard (ST), AIN-93M, high glucose (HG), high protein (HP) and high lipid (HL).

Results

The main results showed that HL diet treatment induced reduction in HDL-C and triglyceride plasma levels; increased ACE (Ang II marker) expression and decreased ACE2 (Ang-[1-7] catalyzer) expression in adipose tissue; and also increased SIRT4 expression.

Conclusion

Diets with high lipid content induced a degenerative state associated with deregulation of adipose tissue enzymes expression.

Introduction

Several studies pointed out an important role of diet composition in metabolic regulation and energy balance [1]. The ideal proportion of dietary macronutrients and the molecular adaptations of the adipose tissue in response to diets with different nutrient levels are matters of discussion [2]. Adipose tissue modulates several physiological processes and is likely associated with metabolic regulation, working as an essential endocrine organ [3].

Adipose tissue contains many components of the renin-angiotensin system (RAS) [4], including angiotensin II (Ang II), a potent pro-inflammatory, pro-oxidant, and pro-thrombotic agent that affects intracellular insulin signaling [5]. The levels of Ang II and of its catalyzer enzyme, the angiotensin-converting enzyme (ACE), are related to obesity and diabetes [6]. ACE/AngII/AT1, RAS arm, is counterbalanced by the angiotensin-converting enzyme 2 (ACE2)/Ang-(1-7)/MAS axis, which improves glucose and fat metabolism thereby decreasing body fat [6, 7]. Also, the seven classes of sirtuins (SIRT1-7) have been included in studies of energy balance, metabolic regulation, inflammation, and obesity [8].

Although RAS components and SIRTs are likely related to obesity, and studies showed similarities when comparing the metabolic effects induced by Angiotensin-[1-7] and Resveratrol (a SIRT activator), the effect of diet composition on the activation of these systems is yet to be studied. In this sense, the aim of this study was to evaluate the relationships between diet composition balance and the expression of RAS and sirtuins in the adipose tissue of mice treated with diets presenting different macronutrient proportions. This study is the first study to investigate the role of dietary macronutrients on the expression of RAS and SIRT components in the adipose tissue. Data on feeding and blood parameters were also assessed.

Methods and Procedures

Fifty male mice, aged 8 weeks, were divided into 5 groups that were fed with experimental diets for 60 days (N = 10 per treatment). The mice of FVB/N lineage were housed in individual cages, under 12h:12h light-dark cycle (lights on from 7:00 to 19:00 h) and at 25.0 ± 2.0°C temperature. Food and water were offered ad libitum.

The experimental diets and their composition (carbohydrate/protein/lipid ratio, calories in kcal/g) were standard diet (ST, 50/42/8, 2.86), AIN-93M diet (76/14/10, 3.69) [9], high-glucose diet (HG, 90/14/10, 3.66), high-protein diet (HP, 76/28/10, 3.65), and high-lipid diet (HL, 76/14/25, 3.84). Experimental diets were formulated as described in previous studies [10]. The ST diet was tested to include a control with less carbohydrate content (2.86 versus 3.69 kcal/g in AIN-93).

Body weight (BW), food intake, and energy intake (food intake in kcal) were recorded every two weeks. At the end of the experiment, insulin sensitivity was tested by determination of glucose levels in tail blood at 0, 15, 30, and 60 min after intraperitoneal injection of 0.75 U insulin/kg BW (Sigma, St Louis, MO, USA). After two days, the mice were subjected to glucose tolerance test by the measurement of tail blood glucose at 0, 15, 30, 60, and 120 min after 12 h of fasting, using Accu-Check (Roche Diagnostics Corp Indianapolis, IN, USA). One week after the tests, when acute effects of glucose and insulin administration had been completely eliminated, the animals were sacrificed.

Blood samples were centrifuged (3,200 rpm for 10 min) and the plasma was separated for the determination of total cholesterol, HDL, and triglycerides, using enzymatic tests (Wiener Lab, Argentina).

The mice were killed and samples of epididymal white adipose tissue (WAT) were collected and stored in dry ice (–80°C) for further evaluation. The WATs were prepared in Trizol reagent (Invitrogen Corp.®, San Diego, CA, USA) and treated with DNAse. Reverse transcription was carried out with M-MLV (Invitrogen Corp.®) using random hexamer primers. Levels of the interested genes were determined by Real Time PCR (SYBR Green reagent) in Step One Plus equipment (Applied Biosystems-EUA).

Gene expression was normalized to the endogenous GAPDH (FW: 5'AACGACCCCTTCATTGACCTC3'; RV: 5'CTTCCCATTCTCAGCCTTGACT3').

The genes of interest and respective primers were: Renin (FW:5'GCTCTGGAGTCCTTGCACCTT3'; RV:5'TTGAGCGGGATGCGTTCAA3'); AGT (FW:5'GACGTGACCCTGAGCAGTCC3'; RV:5'TGAGTCCCGCTCGTAGATGG3'); ACE (FW:5'CTCAGCCTGGGACTTCTACAAC3'; RV:5'CTCCATGTTCACAGAGGTACACT3'); ACE2 (FW:5'GGCTCCTTCTCAGCCTTG3'; RV:5'TTCATAAAAGGCAGACCATTTG3'); SIRT1 (FW:5'CCTTGGAGACTGCGATGTTA3'; RV:5'GTGTTGGTGGCAACTCTGAT3'); SIRT2 (FW:5'GCAGTGTCAGAGCGTGGTAA3'; RV:5'CTAGTGGTGCCTTGCTGATG3'); SIRT3 (FW:5'TACAGGCCCAATGTCACTCA3'; RV:5'ACAGACCGTGCATGTAGCTG3'); SIRT4 (FW:5'TCCCGGCAAAACCGGACTGT3'; RV:5'TCCCGGCAAAACCCGACTTT3'); SIRT5 (FW:5'GACTCAAGACGCCAGAATCC3'; RV:5'CAGAGGATGTTCCCACCACT3'); SIRT6 (FW:5'CTGGTCTGGAACTCACTGCT3'; RV: 5'CGGGTGTGATTGGTAGAGAG3'); and SIRT7 (FW:5'GGCACTTGGTTGTCTACACG3'; RV:5'GTGATGCTCATGTGGGTGAG3').

Data on insulin sensitivity and glucose tolerance were evaluated by two-way ANOVA; the other parameters were analyzed by one-way ANOVA. Statistical differences, considered at an error probability of 0.01 and 0.05, were contrasted by student's t-test.

Results

Average weight gain was significantly lower in HG (22.15 ± 1.65 g) than in AIN-93M (25.03 ± 2.47), HP (24.29 ± 2.93), and HL (24.70 ± 2.65) (Figure 1A). Mean food intake (per BW) was significantly higher in ST (0.13 ± 0.03) than in HL (0.09 ± 0.02) (Figure 1B). Food intake per BW was higher in AIN-93M (0.37 ± 0.09), HP (0.40 ± 0.14), and HG (0.38 ± 0.07) than in the ST group (0.27 ± 0.07, in kcal), with HL showing intermediary values (0.36 ± 0.08) (Figure 1C). The mass of epididymal white adipose tissue was significantly lower in ST (0.01 ± 0.01) than in the AIN-93M (0.03 ± 0.00) and HP (0.02 ± 0.01) (Figure 1D). The mass retroperitoneal white adipose tissue was not significantly affected by the treatments as shown in Figure 1E.

Figure 1.

Feeding and adipose tissue formation in mice-fed standard (ST), AIN-93M, high-glucose (HG), high-protein (HP), and high-lipid (HL) diets (N = 10 per treatment). (A) Weight gain; (B) food intake for g; (C) food intake for kcal; (D) epididymal adipose tissue; (E) retroperitoneal adipose tissue. *P < 0.05; **P < 0.01 (one-way ANOVA).

Mice from HL had significantly lower HDL-C values (64.32 ± 24.69, in mg/dL) compared with AIN-93M (118.25 ± 45.13), and the other treatments showed intermediary values (ST = 90.98 ± 23.90; HP = 110.95 ± 44.30; HG = 110.27 ± 25.22) (Figure 2A). Also, triglyceride levels were lower in HL (73.20 ± 32.61, in mg/dL) than in HG (151.00 ± 56.03), HP (152.50 ± 47.97), and AIN-93M (150.00 ± 55.47) (Figure 2B), but all the groups were similar to ST (106.02 ± 47.58).

Figure 2.

Blood parameters of mice fed the experimental diets: standard (ST), AIN-93M, high glucose (HG), high protein (HP), and high lipid (HL) (N = 10 per treatment). (A) HDL-C levels; (B) triglyceride levels; (C) cholesterol levels; (D) glucose levels; (E) insulin sensitivity curve; and (F) glucose tolerance curve. *P < 0.05; **P < 0.01 (one-way ANOVA).

Total cholesterol (Figure 2C), glucose levels (Figure 2D), insulin sensitivity (Figure 2E), and glucose tolerance (Figure 2F) were similar among the treatments.

The expression of mRNA for ACE was significantly higher in HL (2.03 ± 0.69, in arbitrary unit) than in ST (0.71 ± 0.40) and AIN93-M (0.61 ± 0.56) (Figure 3A), and these groups were similar to HP (1.40 ± 0.97) and HG (1.11 ± 0.71). For ACE2, the expression was significantly higher for treatments AIN-93M (1.45 ± 0.60) and HG (1.46 ± 0.33) than HL (0.70 ± 0.45), and ST (1.09 ± 0.45) and HP (1.09 ± 0.45) exhibited intermediary values (Figure 3B). The expression for renin (ST = 103.63 ± 38.96; AIN-93M = 99.96 ± 25.88; HP = 85.24 ± 32.66; HG = 100.74 ± 39.69; HL = 92.40 ± 34.54) (Figure 3C) and AGT was similar among the treatments (ST = 103.63 ± 38.96; AIN-93M = 99.96 ± 25.88; HP = 85.24 ± 32.66; HG = 100.74 ± 39.69; HL = 92.40 ± 34.54) (Figure 3D).

Figure 3.

Expression of components of the rennin-angiotensin system in epididymal adipose tissue of mice fed standard (ST), AIN-93M, high-glucose (HG), high-protein (HP) and high-lipid (HL) diets (N = 10 per treatment). (A) Angiotensin-converting enzyme (ACE); (B) angiotensin-converting enzyme 2 (ACE2); (C) rennin; and (D) angiotensinogen (AGT). *P < 0.05; **P < 0.01 (one-way ANOVA).

The expression of SIRT4 was higher in HL (0.85 ± 0.47) and HP (0.29 ± 0.32) than in HG treatment (0.29 ± 0.85) (Figure 4A), and ST (0.50 ± 0.42) and AIN-93M (0.41 ± 0.35) had intermediary values. The expression of the other SIRTs did not differ among the treatments.

Figure 4.

Sirtuin expression in epididymal adipose tissue of mice-fed standard (ST), AIN-93M, high-glucose (HG), high-protein (HP), or high-lipid (HL) diet (N = 10 per treatment). (A) SIRT1; (B) SIRT 2; (C) SIRT3; (D) SIRT4; (E) SIRT5; (F) SIRT6; and (G) SIRT7. *P < 0.05; **P < 0.01 (one-way ANOVA).

Discussion

The main finding of this study shows that diet composition is strongly related to adipose tissue modulation of RAS and SIRT4 expressions. High-fat diet increases the deleterious enzyme ACE and decreases the benefits from enzyme ACE2. In addition, we demonstrated that fat-rich diet affect the plasma lipid profile of mice, reducing HDL-C. This diet also increases the expression of SIRT4.

The most caloric diet (HL) promoted satisfactory weight gain and food intake for kcal, although food intake was lower. In contrast, the ST diets, which had the lowest caloric density, were consumed at high amounts. Mice from HG treatment had normal food consumption and food intake per kcal but low weight gain. It appears that mice balanced between energy intake and food intake since the WAT formed in the different treatments were similar.

The HL diet was based on soybean oil, which is rich in polyunsaturated fatty acids (PUFA). PUFA decrease hepatic VLDL secretion and also decrease triglyceride levels [11], as observed in HL-fed mice. However, the consumption of diets with high PUFA content increases fat oxidation and decreases HDL-C levels. Therefore, fat sources and the profile of dietary fatty acids can be more significant in the determination of the fat profile of the animal than the amount to fat intake.

The HL diet increased ACE expression compared with ST and AIN93-M, reinforcing the pro-inflammatory effects of this diet. ACE converts Ang I into Ang II, which induces adipocyte hypertrophy [12, 13], commonly observed in obese individuals. Ang II produced in adipose tissues likely plays a modulatory role in fat metabolism, mediating the relationship between obesity and hypertension [7]. A limitation of this study was that Ang II and Ang-(1-7) levels were not determined directly because of restrictions to perform radioimmunoassay. However, the measurement of ACE and ACE2 expressions is reliable to determine Ang II and Ang-(1-7).

It was determined that changes in the adipose tissue can regulate RAS. As shown in earlier studies, ACE can be considered an environmental factor that modulates body response to the lipid-rich diet (HL) [14]. The level of ACE2, which counterbalances RAS action, was higher in the WAT from mice of AIN-93M and HG treatments than of HL treatment. Recent studies showed the pivotal role of ACE2/Ang-(1-7)/Mas axis on the obesity prevention and in the lipid/glucose metabolism improvement, decreasing adipose proinflammatory markers [5-7]. The present findings reinforce the potential use of diet for regulating the RAS system.

SIRT4 was the only sirtuin affected by the treatments. SIRT4 is associated with the balance between fat and glucose metabolism and participates in the inhibition of insulin production in pancreatic β cells [15]. We found higher SIRT4 expression in HL and HP than in HG, indicating that excess fat and protein in the diet can compromise insulin activity and complicate diabetes cases. We have not detected effects of the dietary treatments on insulin sensitivity, but this issue should be studied for a longer experimental period.

In conclusion, the results obtained showed that high-fat diet can modulate the SIRT4 and RAS profile in adipose tissue pointing to a strong participation of these systems on the obesity-related disorders.

Acknowledgments

This work was supported by individual grants to SHS and MJC-S from Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq), Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) and Fundação de Amparo a Pesquisa do Estado de Minas Gerais (FAPEMIG) and by Pronex Project Grant/2010 (FAPEMIG/ CNPq).

Ancillary