SEARCH

SEARCH BY CITATION

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods
  5. Results
  6. Discussion
  7. References

Objective

The aim of this study was to investigate the protective effects of camphene on high-fat diet (HFD)-induced hepatic steatosis and insulin resistance in mice and to elucidate its mechanism of action.

Design and Methods

Male C57BL/6N mice were fed with a normal diet, HFD (20% fat and 1% cholesterol of total diet), or HFD supplemented with 0.2% camphene (CPND) for 10 weeks.

Results

Camphene alleviated the HFD-induced increases in liver weight and hepatic lipid levels in mice. Camphene also increased circulating adiponectin levels. To examine the direct effects of camphene on adiponectin secretion, 3T3-L1 adipocytes were incubated with camphene. Consistent with in vivo result, camphene increased adiponectin expression and secretion in 3T3-L1 adipocytes. In HFD-fed mice, camphene increased hepatic adiponectin receptor expression and AMP-activated protein kinase (AMPK) activation. Concordant with the activation of adiponectin–AMPK signaling, camphene increased hepatic expression of fatty acid oxidation-related genes and decreased those of lipogenesis-related genes in HFD-fed mice. Moreover, camphene increased insulin-signaling molecules activation and stimulated glucose transporter-2translocation to the plasma membrane in the liver.

Conclusions

These results suggest camphene prevents HFD-induced hepatic steatosis and insulin resistance in mice; furthermore, these protective effects are mediated via the activation of adiponectin–AMPK signaling.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods
  5. Results
  6. Discussion
  7. References

Hepatic steatosis is the most frequent cause of abnormal liver function; it can exist either in a benign self-limiting state or in a condition associated with steatohepatitis [1]. Multiple metabolic pathways lead to the development of hepatic steatosis, including enhanced free fatty acid (FFA) release from adipose tissue (i.e., lipolysis), increased de novo lipogenesis, and decreased fatty acid oxidation [2]. Key transcriptional regulators such as liver X receptor (LXR) and sterol regulatory element binding protein-1 (SREBP1c) coordinately control lipogenesis [3]. The concerted actions of LXR and SREBP1c increase the expression of key lipogenic genes, including those for fatty acid synthase (FAS), stearoyl-CoA desaturase 1 (SCD1), and acetyl-CoA carboxylase (ACC) [4]. FAS catalyzes the de novo synthesis of long-chain fatty acids from acetyl-CoA and malonyl-CoA [5]. SCD1 is also important for lipogenesis because it forms double bonds in stearoyl-CoA, resulting in fatty acid elongation [2]. ACC catalyzes the synthesis of malonyl-CoA, which inhibits carnitine palmitoyltransferase-1 (CPT1) and fatty acid entry into the mitochondria, reducing β-oxidation [6].

Insulin resistance is a state in which more insulin is required to obtain the biological effects that are normally achieved by a lower amount of insulin, and is a key feature of liver diseases [7, 8]. Recent studies have provided evidence that biologically active molecules, namely adipocytokines, secreted from adipose tissue directly or indirectly affect insulin sensitivity via the modulation of insulin signaling and the molecules involved in glucose and lipid metabolism [9]. Adiponectin, an adipocytokine, has recently attracted much attention because of its anti-diabetic and anti-atherogenic effects, making it a potential therapeutic target for metabolic diseases [10]. Its beneficial effects are mediated via the direct interaction between adiponectin and its cell surface receptors, leading to the activation of several intracellular signaling pathways—mainly the AMP-activated protein kinase (AMPK)-dependent pathway [7, 8]. Adiponectin-stimulated AMPK activity enhances the ability of insulin to stimulate insulin receptor substrate-1 (IRS-1) tyrosine phosphorylation and increases glucose transporter-2 (GLUT2) translocation from the cytosol to the membrane, increasing insulin sensitivity [11].

Camphene (2,2-dimethyl-3-methylene-bicyclo[2,2,1]heptane)is a bicyclic monoterpene and a constituent of essential oils derived from plants such as rosemary [12], turmeric [13], pine tree [14], and ginger [13]. It is used as a food additive for flavoring as well as in the preparation of fragrances [13]. Recent pharmacological studies have shown that camphene possesses antioxidant [15], anti-inflammatory [16], and antimicrobial properties [17]. In vitro experimental results have demonstrated that incubating human plasma with camphene protects LDL against copper-induced oxidation [15]. In murine macrophage cells, camphene exerts its anti-inflammatory effect by suppressing nitric oxide production and expression of IKK and nuclear NF-kB [16]. In addition, camphene can inhibit or delay the growth of a range of bacteria, micro-fungi, and especially pathogenic fungal strains [17]. Although many studies have investigated the biological activities of camphene, the beneficial health effects of dietary camphene, including reduction of the risk of obesity and metabolic disorders, have never been reported. Therefore, this study investigated the protective effects of dietary camphene against high-fat diet (HFD)-induced hepatic steatosis and insulin resistance in mice. Furthermore, we investigated the potential molecular mechanisms through which camphene exerts its anti-hepatosteatotic effect in HFD-fed mice.

Methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods
  5. Results
  6. Discussion
  7. References

Animal experiments

Male C57BL/6N mice (5-week-old) were purchased from Orient Bio (Seongnam-si, Gyeonggi-do, Korea) (822). The mice were housed in standard cages in a temperature-controlled (21 ± 2.0°C) room with a 12-h light/dark cycle and given ad libitum access to purified water. Before the experiments, all mice were fed a commercial diet for 1 week for acclimation. The mice were then randomly divided into three weight-matched groups (n = 8 per group): ND, HFD, and 0.2% camphene-supplemented diet (CPND) groups (camphene was obtained from Sigma-Aldrich, Steinheim, Germany). The ND was a purified diet based on the AIN-76 rodent diet composition. The HFD was the ND plus 200 g fat/kg (170 g lard and 30 g corn oil) and 1% cholesterol. The CPND was the HFD plus 0.2% (w/w) camphene. The experimental diets were administered for 10 weeks in the form of pellets.

The food intake of the mice was recorded daily, and their body weights were measured weekly. At the end of the experimental period, the mice were anesthetized with diethyl ether following an overnight fast. Blood was drawn from the abdominal aorta into an EDTA-coated tube, and plasma was obtained by centrifuging the blood at 2,000×g for 15 min at 4°C. The entire liver was resected, weighed, snap frozen in liquid nitrogen, and stored at −70°C. The epididymal, retroperitoneal, mesenteric, and perirenal fat-pads were dissected out, weighed, and snap frozen in liquid nitrogen, and stored at −70°C. All experimental procedures were in accordance with established guidelines for the care and handling of laboratory animals and were approved by the Yonsei Laboratory Animal Research Center-Institutional Animal Care and Use Committee (YLARC-IACUC), Yonsei University, Korea.

Biochemical analyses

Plasma concentrations of triglycerides (TGs), total cholesterol (TC), and FFAs were determined enzymatically using commercial kits (Bio-Clinical System, Gyeonggi-do, Korea). Plasma activities of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were analyzed with an automatic analyzer (Express Plus, Chiron Diagnostics, MA). Hepatic lipids were extracted as described by Folch et al. using a chloroform–methanol mixture (2:1 v/v), and the dried lipid residues were dissolved in 2 ml ethanol. The concentrations of cholesterol, TG, and FFAs in the hepatic lipid extracts were measured using commercial kits (Bio-Clinical System). Plasma levels of insulin and adiponectin, and adiponectin secreted into the culture media were assayed using ELISA kits (American Laboratory Products Company, NH).

Histological examination

Liver tissue specimens were fixed in 10% buffered formalin, embedded in paraffin, sectioned into 5-μm thick slices, and stained with hematoxylin and eosin for the histological examination of fat droplets. Steatosis was numerically scored according to semi-quantitative pathological standards.

Glucose tolerance test

All mice used in this study underwent the intraperitoneal glucose tolerance test (IPGTT) after an 18-h overnight fast. Each mouse was injected intraperitoneally with glucose diluted in distilled water (200 mg/ml) at 2 g/kg body weight. Blood samples from the tail vein were obtained 0, 15, 30, 60, 90, and 120 min after glucose injection. Blood glucose concentrations were determined with a glucometer (Roche Diagnostics, Mannheim, Germany).

Cell culture

Mouse embryo 3T3-L1 fibroblast cells were purchased from the American Type Culture Collection (Manassas, VA). Pre-adipocytes, 3T3-L1 cells, were grown in high-glucose Dulbecco's modified Eagle's medium (DMEM) containing 10% bovine calf serum (BCS), 1% penicillin, and 1% essential amino acid in 100-mm dishes until confluence for 2 days at 37°C in 5% CO2. Pre-adipocytes were then maintained in differentiation medium to differentiate. To induce differentiation, the medium was changed to DMEM supplemented with 10% fetal bovine serum (FBS), 1% penicillin/essential amino acid, 4 μg insulin/ml, 1 μM dexamethasone, and 0.5 mM isobutylmethylxanthine (Sigma-Aldrich, MO). After an additional 48 h (day 2), the medium was changed to 10% FBS/DMEM containing 4 μg insulin/ml. Cells were incubated with medium containing 100 μM camphene in dimethylsulfoxide (DMSO) or an equivalent amount of DMSO alone for 8 days during differentiation. The cell media were replaced and collected every 2 days. The cells were treated with varying doses of camphene (0.1, 1, 10, 50, and 100 μM) for 8 days during differentiation. The cell media were replaced and collected every 2 days. On day 8, cells were washed twice with phosphate-buffered saline, fixed with 10% formalin for 1 h at room temperature and then stained with 5% oil red O in isopropanol for 30 min. Cells were then washed with water and images of each dish were taken using Olympus (Tokyo, Japan) microscope. Stained oil droplets were dissolved in isopropanol and quantified by spectrophotometrical analysis at 600 nm.

RNA extraction and semi-quantitative RT-PCR analysis

Total RNA was extracted from the liver tissues, the epididymal adipose tissues, and 3T3-L1 adipocytes using TRIzol reagent (Invitrogen, CA) according to the manufacturer's instructions. Total RNA (4 μg) was reverse transcribed using a Superscript II kit (Invitrogen) according to the manufacturer's recommendations. The forward and reverse primer sequences are shown in Table 1. The PCR conditions were as follows: initial denaturation at 94°C for 5 min; 27-35 cycles of denaturation at 94°C for 1 min, annealing at 55°C or 60°C for 2 min, extension at 72°C for 2 min; and final extension at 72°C for 10 min. The PCR products were size-fractionated on 2% agarose gel by electrophoresis and visualized by ethidium bromide staining. PCR products were separated and visualized as described above and the band intensities were quantified using Quantity One analysis software (Bio-Rad Laboratories, CA). Data were normalized to that of glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and relative fold-change differences in expression were calculated.

Table 1. Primer sequences and PCR conditions
Gene descriptionPrimersSequences (5′[RIGHTWARDS ARROW]3′)Annealing temperature (°C)PCR product (bp)
AdiponectinFCACGTTACTACAACTGAAGAGC56532
RCATTCTTTTCCTGATACTGGTC
LeptinFCTCCAAGGTTGTCCAGGGTT55143
RAAAACTCCCCACAGAATGGG
Adiponectin receptor1 (AdipoR1)FGATTCCTGAGCGCTTCTTCC55190
RACGGAATTCCTGAAGGTTGG
Adiponectin receptor2 (AdipoR2)FTTGATGAAGGGGAGGAGGAC55119
RCAGAATGGCTCAGAGCTCCA
PPARγ2 (PPARγ2)FTTCGGAATCAGCTCTGTGGA55148
RCCATTGGGTCAGCTCTTGTG
CCAAT/enhancer binding proteinα (C/EBPα)FAAGGCCAAGAAGTCGGTGGA55189
RCCATAGTGGAAGCCTGATGC
Adipocyte protein 2 (aP2)FACATGAAAGTGGGAGTG55128
RAAGTACTCTCTGACCGGATG
Liver X receptor (LXRα)FTCCTACACGAGGATCAAGCG55119
RAGTCGCAATGCAAACACCTG
SREBP1c (SREBP1c)FTTGTGGAGCTCAAAGACCTG5594
RTGCAAGAAGCGGATGTAGTC
Stearoyl-Coenzyme A desaturase 1 (SCD1)FTTGTGGAGCTCAAAGACCTG5594
RTGCAAGAAGCGGATGTAGTC
Fatty acid synthase (FAS)FAGGGGTCGACCTGGTCCTCA65132
RGCCATGCCCAGAGGGTGGTT
Acetyl-CoA carboxylase (ACC)FTGATGTCAATCTCCCCGCAGC60353
RTTGCTTCTTCTCTGTTTTCTCCC
Carnitine palmitoyltransferase I (CPT1)FCTCTGCTGGCCGTTGTTGT55120
RGGCAAGTTCTGCCTCACGTA
Glucose-6-phosphate dehydrogenase (G6Pase)FAGAGTTGTACCAGGGTGATG55144
RTATCTTCAGGTAGAAGGCCA
Phosphoenolpyruvate carboxykinase (PEPCK)FCTTGTCTATGAAGCCCTCAG55144
RGGTATTTGCCGAAGTTGTAG
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)FCCCATGTTTGTGATGGGTGT55161
RGTGATGGCATGGACTGTGGT

Western blot analysis

Western blot analysis was performed using total protein extracted from frozen liver samples using homogenizing buffer (100 mM Tris-HCl[pH 7.4], 5 mM EDTA, 50 mM NaCl, 50 mM sodium pyrophosphate, 50 mM NaF, 100 mM orthovanadate, 1% Triton X-100, 1 mM PMSF, 2 mg/ml aprotinin, 1 mg/ml pepstatin A, and 1 mg/ml leupeptin). The tissue homogenates were then centrifuged at 13,000×g for 20 min at 4°C. The protein concentrations of whole tissue extracts were determined by Bradford assay (Bio-Rad, CA). Protein samples (80 mg/lane) were loaded onto a 10% SDS-PAGE gel and then transferred to a nitrocellulose membrane (Amersham, Buckinghamshire, UK). The plasma membrane proteins from excised liver tissues were extracted in homogenizing buffer containing 20 mM HEPES, pH 7.4, 4 mM EDTA, 250 mM sucrose, 2 tablets of protein inhibitor, 1 mM sodium orthovanadate, and 1% Triton X-100. The homogenates were centrifuged at 2,000×g for 1.5 h at 4°C, and the supernatants were centrifuged at 150,000×g for 90 min at 4°C to obtain a membrane preparation. The total protein concentration of both whole-tissue and membrane fraction extracts were determined by Bradford assay (Bio-Rad, Hercules, CA). Equal amounts of protein from total and membrane fractions (40 μg) were separated on a 10% SDS-PAGE gel and subsequently transferred onto nitrocellulose membranes (Amersham, Buckinghamshire, UK). The membranes were blocked with 5% bovine serum albumin in Tris-buffered saline/Tween buffer (10 mM Tris-HCl[pH 7.5], 150 mM NaCl, and 0.05% Tween-20), incubated with primary antibodies overnight at 4°C, and washed four times in Tris-buffered saline with 0.05% Tween 20. The following primary antibodies were used: AMPK, p-AMPK (Thr172), S6K1, p-S6K1 (Thr389), IRS1, p-IRS1 (Ser307), AKT, p-AKT (Thr308), GAPDH, β-actin (Cell Signaling, MA), and GLUT2 (Santa Cruz Biotechnology, Santa Cruz, CA). After washing, the membranes were incubated with secondary antibodies in Tris-buffered saline with 0.05% Tween 20 for 1 h. The blots were then developed using ECL detection according to the manufacturer's instructions (Amersham).

Statistical analysis

Data are presented as means ± SEM. Data describing body weight gains, liver and fat-pad weights, plasma characteristics, hepatic biochemistries, and IPGTT are presented as means ± SEM of eight mice per group. The RT-PCR and Western blot results are means from an n = 8 ± SEM of three independent experiments (n = 2 or 3 per experiment) for each group. The means between groups were compared by one-way ANOVA. P-values less than 0.05 were considered statistically significant. All tests were performed using SPSS 12.0 (SPSS Inc., Chicago, IL).

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods
  5. Results
  6. Discussion
  7. References

Effects of camphene on body weight and plasma lipid levels

After 10 weeks of feeding, the CPND group exhibited significant reductions in body weight (−33%), body weight gain (−58%), and food efficiency ratio (−55%) with no changes in food intake compared to those for the HFD mice (Figure 1A-D). Camphene significantly reduced total visceral fat-pad weight by 52% in mice fed the HFD, and this was attributed to weight decreases in the epididymal (−46%), perirenal (−76%), mesenteric (−57%), and retroperitoneal (−48%) fat depots (Figure 1E). The HFD group exhibited significantly higher plasma TG, FFA, and TC levels than the ND group did. Camphene supplementation significantly attenuated the HFD-induced elevation in plasma TG (−69%), FFA (−86%), and TC levels (−60%) (Figure 1F-H).

image

Figure 1. Effects of camphene on body weight and plasma lipid concentrations in mice fed an HFD. Body weight (A), body weight gain (B), food intake (C), food efficiency ratio [1] (FER = body weight gain for experimental period [g] ÷ food intake for experimental period [g]) (D),visceral fat-pad weights from ND-, HFD-, and CPND-fed mice (E), and plasma levels of triglyceride (F), free fatty acid (G), and total cholesterol (H). Values are presented as mean ± SEM; different letters indicate statistical significance, P < 0.05.

Download figure to PowerPoint

Preventive effect of camphene against HFD-induced hepatic steatosis

Camphene supplementation decreased liver weight by 15% in the HFD group (Figure 2A). Histopathological analyses revealed lower lipid deposition in the livers of the CPND group than the HFD group (Figure 2B). Consistent the histopathological results, the CPND group had significantly lower hepatic steatosis scores than the HFD group did (ND, 1.0; HFD, 3.5; CPND, 1.5) (Figure 2C). Furthermore, the CPND group had significantly lower hepatic TC (−58%), TG (−86%), and FFA (−73%) concentrations than the HFD group (Figure 2D-F). In addition, plasma ALT and AST activities were significantly lower in the CPND group than the HFD group (Figure 2G,H).

image

Figure 2. Effects of camphene on HFD-induced hepatic steatosis in mice. Liver weights (A). Gross examination of liver samples from ND-, HFD-, and CPND-fed mice (B). Representative images of hematoxylin andeosin-stained liver sections (×100 magnification) (B). Steatosis scores (C). Concentrations of hepatic TGs (D), cholesterol (E), and FFAs (F). Plasma ALT (G) and AST (H) activities. Values are presented as mean ± SEM; different letters indicate statistical significance, P < 0.05. [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]

Download figure to PowerPoint

Anti-adipogenic effect of camphene in 3T3-L1 adipocytes

To examine the potential inhibitory effects of camphene on adipogenesis, 2-day post-confluent 3T3-L1 preadipocytes were treated with various concentrations of camphene for 8 days. Macroscopic and microscopic observations of oil red O staining are shown in Figure 3A. With increasing concentrations of camphene in culture media, a significant inhibition of differentiation of preadipocytes to mature adipocytes was observed, and it was evident from reduced fat accumulation in the cells. Camphene at 10, 50, and 100 μM concentrations decreased cellular lipid content by 18%, 29%, and 37%, respectively, when compared with control cell treated with DMSO (Figure 3B). These results indicate that camphene may have efficiently blocked adipocyte differentiation in 3T3-L1 cell line. The effects of camphene on mRNA expressions of adipogenic genes during 3T3-L1 adipocyte differentiation are shown in Figure 3C. The mRNA expressions of C/EBPα (−28%), PPARγ2 (−69%), and aP2 (−45%) in 3T3-L1 adipocytes were significantly reduced by camphene (100 μM).

image

Figure 3. Effect of camphene on 3T3-L1 adipocyte differentiation. Two-day post confluent 3T3-L1 adipocytes were subjected to adipocyte differentiation for 8 days in the presence of DMSO of various concentrations of camphene in DMSO. Eight days after the onset of induction, adipocytes were fixed and stained with oil red O. Microscopic (up; ×200 magnification) and macroscopic (down) images of oil red O-stained adipocytes (A). Cells were harvested, and the lipid accumulation was measured through a spectrophotometer (B). The expression of adipogenic genes were determined by RT-PCR and normalized to that of GAPDH (C). The RT-PCR results are means from an n = 8 ± SEM of three independent experiments (n = 2 or 3 per experiment) for each group, and a representative image is shown in the left panel. *P < 0.05; **P < 0.005. [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]

Download figure to PowerPoint

Effects of camphene on adiponectin expression and secretion in 3T3-L1 adipocytes

To examine the direct effects of camphene on adiponectin expression and secretion, 3T3-L1 adipocytes were incubated with or without camphene (100 μM) for 8 days. On day 2, adiponectin secretion did not differ significantly between camphene-treated adipocytes and control cells treated with DMSO only. Camphene treatment significantly increased adiponectin concentrations in the conditioned media from days 4-8 in a time-dependent manner (Figure 4A). In addition, we analyzed adiponectin mRNA levels in 3T3-L1 adipocytes after 8 days of treatment. Camphene significantly increased adiponectin mRNA expression in adipocytes relative to the controls (Figure 4B). Consistent with in vitro result, camphene significantly increased circulating adiponectin levels and the mRNA expression of adiponectin in the epididymal adipose tissues of mice fed the HFD (Figure 4C,D). Furthermore, the mRNA level of leptin was significantly lower in the CPND-fed mice than in the HFD-fed mice (Figure 4D).

image

Figure 4. Effects of camphene on adiponectin production in 3T3-L1 adipocytes and the mRNA expressions of adiponectin and leptin in the epididymal adipose tissues. 3T3-L1 adipocytes were incubated with or without camphene (100 μM) for 8 days. Cell media were replaced and collected every 2 days, and adiponectin was measured by ELISA (A). Adiponectin mRNA expression was measured by RT-PCR (B). Values are normalized to those of GAPDH mRNA. Plasma adiponectin concentration at the end of experiment (weeks 10) (C). Adiponectin and leptin mRNA expressions were measured by semi-quantitative RT-PCR (D). The RT-PCR results are means from an n = 8 ± SEM of three independent experiments (n = 2 or 3 per experiment) for each group, and a representative image is shown in the left panel; different letters indicates statistical significance, P < 0.05.

Download figure to PowerPoint

Modulation of the expression of genes involved in lipid metabolism

To investigate the molecular mechanism by which camphene reduces hepatic steatosis, we examined the effects of camphene on hepatic genes involved in lipogenesis. The hepatic expression of adiponectin receptors 1 and 2 (adipoR1 and adipoR2, respectively) were significantly higher in the CPND group than the HFD group (Figure 5A). In addition, western blot analysis revealed that AMPK phosphorylation was significantly higher in the livers of the CPND group than the HFD group (Figure 5B). On the other hand, S6K1 phosphorylation was significantly lower in the livers of the CPND group than the HFD group (Figure 5C). In addition, the CPND group mRNA expression of lipogenic transcription factors (i.e., LXRα and SREBP1c) and their target genes (i.e., FAS, SCD1, and ACC) were reduced (Figure 5A).

image

Figure 5. Effects of camphene on the expression of hepatic genes controlling lipogenesis and fatty acid oxidation. The expression of lipogenic genes were determined by RT-PCR and normalized to that of GAPDH (A). Representative Western blot and quantification of AMPK and S6K1 phosphorylation and corresponding total protein expressions in mice (B and C). Values are presented as mean ± SEM; different letters indicate statistical significance, P < 0.05.

Download figure to PowerPoint

Camphene-mediated improvement of HFD-induced insulin resistance

To determine the effect of camphene on glucose tolerance in HFD-fed mice, we performed the IPGTT after 8 weeks of dietary supplementation. Blood glucose levels were significantly lower in the CPND group than the HFD group at all time points following glucose injection (Figure 6A). In addition, the area under the glucose concentration–time curve was significantly lower (38%) in the CPND group than in the HFD group (Figure 6B). These results demonstrate that the CPND-fed mice had significantly greater glucose tolerance than the HFD-fed mice. Fasting plasma glucose and insulin levels were measured at the end of the feeding period. Lastly, camphene supplementation attenuated the HFD-induced elevation in plasma glucose (−30%) and insulin levels (−37%) (Figure 6C,D).

image

Figure 6. Effects of camphene on glucose tolerance in HFD-fed mice. Time course changes in plasma glucose levels after intraperitoneal glucose injection (2 g/kg body weight) (A). Corresponding areas under the curve over 2 h (B). Fasting plasma glucose and insulin levels at the end of the feeding period (C and D). Values are presented as mean ± SEM; different letters indicate statistical significance, P < 0.05.

Download figure to PowerPoint

Effect of camphene on insulin signaling pathways in the liver

To elucidate the mechanism of camphene-mediated improvement in insulin resistance, we analyzed the expression of intracellular insulin signaling molecules in the liver. Western blot analysis revealed that IRS-1 serine phosphorylation was lower in the livers of the CPND group than in the HFD group (Figure 7A). Moreover, insulin-stimulated AKT phosphorylation was significantly lower in the livers of the CPND group than the HFD group. Plasma membrane GLUT2 protein levels were significantly higher in the CPND group than the HFD group (Figure 7B). However, there was no significant difference between the CPND and HFD groups with respect to total (i.e., cytosol and plasma membrane) GLUT2 protein content. These results indicate that camphene supplementation increased GLUT2 translocation in the livers of HFD-fed mice. To determine whether camphene supplementation affects the expression of genes involved in glucose metabolism in the liver, we examined the mRNA expression of G6Pase and PEPCK, which are involved in gluconeogenesis. The results show that the mRNA expression both G6Pase and PEPCK were significantly lower in the livers of the CPND group than the HFD group (Figure 7C).

image

Figure 7. Effects of camphene on the expression of insulin signaling molecules in HFD-fed mice. Representative western blot and quantification of IRS-1 and AKT phosphorylation and plasma membrane GLUT2 protein and corresponding total protein expression in mice (A-C). The mRNA expression of gluconeogenesis-related genes (i.e., G6Pase and PEPCK) were determined by RT-PCR and normalized to that of GAPDH in the liver (D). Values are presented as mean ± SEM; different letters indicate statistical significance, P < 0.05.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods
  5. Results
  6. Discussion
  7. References

Camphene is pharmacologically safe and is listed as a “generally recognized as safe” compound according to the US Food and Drug Administration. In our preliminary study, camphene supplemented to the HFD at 0.05, 0.1, and 0.2% levels for 28 days resulted in a dose-dependent reduction in the body weight of mice (−7%, −10%, and −17%, respectively) (data not shown). On the basis of these results, animals were fed 0.2% camphene for a longer period in this study. The concentration of camphene used in this study (0.2%, equivalent to 200 mg/kg body weight) corresponds to approximately 16 mg/kg body weight in humans when calculated based on normalization to body surface area according to Reagan-Shaw et al. [18]. The dosage used in this study is lower than the upper limit of camphene in humans, which is recommended to be 20 mg/kg body weight by the Council of Europe Committee of Experts on Flavoring Substances [13].

Adiponectin is an important regulator of hepatic TG metabolism, acting to increase fatty acid oxidation in the liver [19]. It is well known that adiponectin binds to its membrane receptors, adipoR1 and adipoR2, leading to the activation of the AMPK-dependent pathway [7, 8]. Activated AMPK reduces S6K1 phosphorylation, which in turn decreases the expression of lipogenic transcription factors and their target genes, thus lowering hepatic lipid accumulation [11, 20]. Recent studies suggest that high-fat feeding in mice reduces circulating adiponectin levels in association with the development of insulin resistance and hepatic steatosis [21]. In this study, dietary camphene significantly increased circulating adiponectin levels and adiponectin receptor mRNA expression, which may have consequently increased AMPK phosphorylation in HFD-fed mice. In the livers of the HFD-fed mice, the camphene-activated AMPK might have contributed to the decreased expression of transcription factors (i.e., LXR and SREBP1c) and their target genes (i.e., FAS, CD36, and SCD1) involved in lipogenesis, and increased the expression of CPT1, which is involved in fatty acid oxidation. Thus, these results provide evidence that dietary camphene ameliorates hepatic lipid accumulation and enhances fatty acid oxidation via adiponectin–AMPK signaling in HFD-fed mice.

However, it is unclear whether camphene exerts its protective effect against hepatic steatosis by directly stimulating adiponectin secretion from adipocytes. Therefore, the present study examined the effect of camphene on adiponectin production and secretion in 3T3-L1 adipocytes. The treatment of 3T3-L1 adipocytes with camphene significantly increased both adiponectin mRNA expression and secretion. Thus, these findings suggest that camphene ameliorates hepatic steatosis by directly upregulating adiponectin production and secretion in adipose tissue.

Accumulating evidence indicates that adiponectin is an important adipocytokine that improves not only hepatic fat content, but also hepatic insulin sensitivity [21]. In obese rodents, the downregulation of adiponectin levels induced by HFD feeding increases the S6K1-mediated negative regulation of insulin signaling, decreasing GLUT2 translocation to the plasma membrane [11, 22]. This study provides evidence that camphene effectively improves insulin resistance in HFD-fed mice. Furthermore, the results suggest that adiponectin–AMPK signaling activated by camphene supplementation contributes to the decreased S6K1 phosphorylation and increased IRS1 and AKT activation. The camphene-activated AKT may subsequently increase GLUT2 translocation from the cytosol to the plasma membrane in the liver, which may in turn contribute to the improvement of insulin sensitivity. It is well established that insulin resistance in the liver leads to the elevated expression of key gluconeogenic genes such as PEPCK and G6Pase [23]. In this study, hepatic PEPCK and G6Pase mRNA levels were significantly lower in the livers of the CPND group than in the HFD group. Accordingly, our findings suggest that the protective action of camphene against HFD-induced insulin resistance is mediated, at least in part, via the activation of adiponectin–AMPK signaling pathways in the liver.

In conclusion, this study demonstrated that camphene improved hepatic lipid accumulation, liver dysfunction, and plasma insulin and glucose levels in HFD-fed mice. In addition, camphene increased circulating adiponectin levels in HFD-fed mice. Consistent with the in vivo results, camphene significantly increased both adiponectin mRNA expression and secretion in 3T3-L1 adipocytes. Furthermore, camphene significantly increased adiponectin receptor expression and AMPK activation in the livers of HFD-fed mice. Our findings indicate that the activation of adiponectin–AMPK signaling plays a pivotal role in the ability of camphene to protect against the development of hepatic steatosis and insulin resistance in HFD-fed mice. Further studies are needed to clarify whether camphene is indeed a promising agent for preventing or treating hepatic steatosis in humans.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods
  5. Results
  6. Discussion
  7. References