SEARCH

SEARCH BY CITATION

Keywords:

  • Mycosphaerella graminicola;
  • epidemiology;
  • wheat varietal resistance;
  • fungicide efficiency;
  • DMI-resistant genotypes;
  • real-time PCR

Abstract

  1. Top of page
  2. Abstract
  3. 1 INTRODUCTION
  4. 2 MATERIALS AND METHODS
  5. 3 RESULTS
  6. 4 DISCUSSION
  7. ACKNOWLEDGEMENTS
  8. REFERENCES

BACKGROUND

Sterol 14α-demethylase inhibitors (DMIs) have been widely used for more than 20 years against wheat Septoria leaf blotch. However, resistance towards DMIs has increased in recent years. The objective of this study was to evaluate the effect of fungicide timing and persistence and wheat resistance varietal on Mycosphaerella graminicola and its DMI-resistant genotypes.

RESULTS

Using qPCR, M. graminicola was detected 2 weeks later in the resistant cultivar than in the susceptible cultivar. A high proportion of DMI-moderate resistant genotypes (≥94%) was found in all samples, with an average of 74.2, 0.1 and 19.7% for R6, R7− and R7+ genotypes, respectively. Distribution of DMI-resistant genotypes was neither affected by different wheat cultivars nor by analysis dates. Electron microscopy coupled with qPCR analysis showed that the DMI fungicide prothioconazole had a significant inhibitive effect against spore germination and post-germination. However, the preventive treatment was the most effective, but it was affected strongly by fungicide persistence.

CONCLUSION

Preventive fungicide applications are more effective against Septoria leaf blotch than the curative treatments, so persistence and wheat varietal resistance should be taken into account in the management of this disease. It would seem that none of the studied factors affect the frequency of DMI-resistant genotypes. © 2013 Society of Chemical Industry

1 INTRODUCTION

  1. Top of page
  2. Abstract
  3. 1 INTRODUCTION
  4. 2 MATERIALS AND METHODS
  5. 3 RESULTS
  6. 4 DISCUSSION
  7. ACKNOWLEDGEMENTS
  8. REFERENCES

Mycosphaerella graminicola (Fuckel) J. Schroeter in Cohn (anamorph Septoria tritici Roberge in Desmaz.) is one of the most important pathogens on winter wheat in northern Europe.[1, 2] This fungus is responsible for Septoria leaf blotch and causes 30–40% yield reduction under extreme conditions.[3] The primary inoculum is commonly described by the arrival of M. graminicola ascospores.[4] At high humidity, spores germinate and germ tubes penetrate 12 h post-inoculation into the leaves, exclusively through the stomata. The internal colonisation is still intercellular between mesophyll cells until 10–12 days post-inoculation. Then, the host cells die in response to the necrotrophic mode of M. graminicola, with the development of visual chlorosis and necrotic symptoms. The formation of brown/black pycnidia in the substomatal cavities of the necrotic spots results from asexual reproduction, which appears 14–21 days after inoculation.[5] Pycnidiospores are the secondary inoculum and are responsible for the repetition of the infection in the upper foliar layers by the rain effect on the vertical spore transfer, called ‘splashing’.[6]

The application of fungicides is the most common method used for controlling this pathogen. Several families of fungicides exist and are used against M. graminicola, but their efficiencies differ and decline with use.[7] The azole class of sterol demethylation inhibitors (DMIs), which includes triazoles, is able to control M. graminicola targeting of the CYP51 enzyme (14α-demethylase), and it has been used frequently over the past 25 years.[1, 2] However, significant changes in the sensitivity of M. graminicola strains toward DMI fungicides have been widely reported,[1] especially over the past 5 years in the case of triazoles. Resistance to DMIs has been described by various mechanisms, one of which is point mutations in the CYP51 gene, which reduces the affinity between DMIs and the 14α-demethylase enzyme.[1, 2] Many DMI-resistant genotypes (R-types) characterised by amino acid alterations have been reported in the M. graminicola CYP51 gene,[1, 8-10] and generally, there are two main categories: strains that contain the amino acid isoleucine at the position 381 of the CYP51 protein sequence (I381) and strains with the point mutation (V381), where isoleucine is replaced by valine.[1, 2] In 2010, Leroux and Walker[11] classified M. graminicola field isolates into four main phenotypic classes: wild-type strains (TriS), DMI-resistant phenotypes with low (TriLR), moderate (TriMR) and high (TriHR) levels of resistance to representative triazole fungicides. In the last 5 years, TriMR (R6, R7− and R7+) isolates have become predominant, leading to a gradual erosion of field efficacy for most DMIs, with the exception of epoxiconazole and prothioconazole applied at their recommended label doses.[12, 13] However, all R6, R7− and R7+ types of TriMR have the V381 point mutation of the CYP51, with either the ΔY459/G460 double deletion (R7− and R7+) or an amino acid substitution at position 459 (Y459S/D/N/P) or 461 (Y461S/H) (R6a) or 379 (A379G) (R7+).[11]

As this disease has a long latent period, presymptomatic detection and quantification of M. graminicola and genotypes that are related to different DMI resistance levels are very important for the effective control of strains that are highly resistant to DMIs. This allows better timing, choice and dose of fungicide applications. However, it is not possible to achieve such detection by conventional methods, and hence fungicides cannot be applied until visible symptoms appear.

Molecular detection of disease in plants was developed using the polymerase chain reaction (PCR) technique, which offers a rapid and sensitive diagnostic method.[14] The association of specific chemistries and a fluorescent reporter molecule (TaqMan chemistry) with PCR has permitted the development of real-time PCR.[15] This technique is an accurate and reliable tool for many phytopathological studies.[15-18] Real-time PCR analysis, also referred to as quantitative PCR (qPCR), can provide a deeper insight into host–pathogen interactions by detecting the primary inoculum, general infection level and genotypes, depending on the specific target gene. For M. graminicola, qPCR based on the specific and stable gene β-tubulin has been described as a diagnostic tool by Bearchell et al.[19] and on the CYP51 gene for 14α-demethylase mutations by Selim.[20]

In the present study, we used qPCR to study the epidemiological context of M. graminicola, taking into account the effect of many factors, including external contamination by ascospores, cultivars resistance, leaf colonisation stages and fungicide efficiency and persistence. The correlation between results of molecular qPCR analysis and visual symptoms observations were investigated.

2 MATERIALS AND METHODS

  1. Top of page
  2. Abstract
  3. 1 INTRODUCTION
  4. 2 MATERIALS AND METHODS
  5. 3 RESULTS
  6. 4 DISCUSSION
  7. ACKNOWLEDGEMENTS
  8. REFERENCES

2.1 In vivo studies of Septoria leaf blotch using qPCR

2.1.1 Trapping of spores

The spore trap assay is described by Fraaije et al.[21] A spore trap was installed in the field, at a distance of 3 m from the wheat trial in order to avoid the capture of pycnidiospores that move vertically as a result of splashing raindrops. Spores were collected from a plastic film, and then they were ground using an MM 300 Mixer Mill (Qiagen, Courtaboeuf, France) in a 2-mL Eppendorf® Safe-lock micro test tube containing 250 mg white quartz (Sigma® S-9887; Sigma, St Louis, MO, USA) and one 5-mm stainless steel bead (Cat. No. 69989, Qiagen, Courtaboeuf, France).

2.1.2 Evolution of Septoria leaf blotch and resistant wheat cultivars

The field sites were located at the Beauvais Agricultural Research Station of the Institut Polytechnique LaSalle-Beauvais, Beauvais, France. Based on the susceptibility to M. graminicola, one resistant cultivar (Maxwell) and four susceptible cultivars (Dinosor, Alixan, Tremie and Maxyl) were selected (Table 1). Rainfall, temperature and leaf wetness in the trial field were monitored daily (Fig. 1a). Trials were performed during the 2008–2009 growing season using a completely randomised block design with three replicate plots. Fertilisation was according to plant requirements and protection against other diseases was carried out. The plot size was 2 m × 12 m. Twenty leaves were randomly sampled from one foliar layer of the main stem. The foliar layer number (Fn) was determined by counting the position of the leaf from the flag leaf (F1). Disease evolution was determined by assessing visual symptoms and by qPCR analysis. The necrotic area related to Septoria blotch was recorded and then the leaves were stored at −80 °C until lyophilisation.

Table 1. Wheat cultivars used in the resistance study against Mycosphaerella graminicola
CultivarProducerYearSusceptibility rating
  1. a

    The susceptibility rating is on a scale of 1 to 9, where 1 represents ‘susceptible’ and 9 represents ‘resistant’.

MaxwellSaaten Union20087
DinosorUnisigma20054
AlixanNickerson20054
TremieSerasem19924
MaxylMomont20055
image

Figure 1. (a) Weather conditions and (b) temporal dispersal of ascospores in M. graminicola DNA presented as the amount per day.

Download figure to PowerPoint

2.1.3 M. graminicola DMI-resistant genotypes

M. graminicola DMI-resistant genotypes were determined for wheat leaf samples collected from the five wheat cultivars (listed above) grown under field conditions. Intentional mismatch primers (Table 2) and allele-specific qPCR were used as described by Selim,[20] to quantify the mutation proportions of CYP51 in DNA samples.

Table 2. Sequences of primers and probes used to determine moderate resistant (R6, R7− or R7+) or general (MG) genotypes of M. graminicola
PrimerSequence (5′–3′)MutationGenBank accession numberAmplicon sizeTm
  1. Lower case nucleotide indicates the intentional mismatch.

  2. Nucleotides in bold are located at the site of single-nucleotide polymorphism (SNP).

  3. W indicates wild-type specific primer; Tm indicates primer melt temperature.

  4. a

    //and ΔY459/G460 indicate double deletion of tyrosine (Y) and glycine (G) at positions 459 and 460 of the amino acid sequence, respectively.

SYBER Green     
MG, forwardCCTCGCCGAACTTACGATCTEF41862258
MG, reverseCGCGGACTTCCTTTCCTTG6059
R6 and 7−, forwardCCCTTCGTATTCACGCTCgAGI381VEF41863060
R6, reverseGCTTACCAGGCCGTAGCCAEF41862827660
R7−, reverseCCTTGCTTACCAGGCCGTt//GTΔY459/G460EF41863027360
R7+, forwardCAAAGAAACCCTTCGTATTCAtGGA379G60
R7+, reverseAATGGAGGCAGTCGGGAAA16759
TaqMan     
MG, forwardGCCTTCCTACCCCACCATGTAY5472646360
MG, reverseCCTGAATCGCGCATCGTTA60
MG PFAM-TTACGCCAAGACATTC-MGB69
W, forwardAGTCGTCAAAGAAACCCTTCGTAEF41862210658
W, reverseGGTGGTTGGAATGACGTATGC59
W PVic-CGCTCCAATCCACTC-MGB68

2.2 In planta studies of Septoria leaf blotch using qPCR

2.2.1 Plant material

Susceptible and resistant winter wheat cultivars Dinosor and Maxwell, respectively, were used. Grains were disinfected by incubation with 1% sodium hypochlorite for 5 min, with shaking, and then washed three times in autoclaved distilled water. Grain germination was achieved in a 0.5% water–agar medium. After incubation in darkness—24 h at 20 °C, 48 h at 4 °C and then 24 h at 20 °C[22]—grains were transferred to 500 mL pots containing an autoclaved soil mixture of horticultural compost, sand and silt–loam soil (1:1:2 v/v/v). Pots were incubated at 15 °C, for a 16-h photoperiod, with 150 µmol of photon m−2 s−1. Plantlets were watered twice a week with 50 mL distilled water per pot, and once a week with 50 mL water containing 25% Murashige and Skoog basal medium (Sigma® M 5519).

2.2.2 Inoculum preparation

M. graminicola DMI moderate resistant isolates (T0248, T0254 and T0256) were obtained from M. graminicola collection strains held in the authors' laboratory. They are, respectively, R6, R7− and R7+ genotypes. Sporidia (yeast-like cells) stored at −80 °C were activated by transfer to fresh potato dextrose agar medium (39 g L−1; Sigma). After 10 days of incubation at 18 °C, with a 12-h photoperiod, mycelia and spores were scraped off the surface and grown in a liquid yeast–sucrose medium (yeast extract 10 g L−1, sucrose 10 g L−1; Sigma) for 7 days at 18 °C with permanent light (100 µmol of photon m−2 s−1) and shaking (150 rpm). Spores were collected by centrifugation at 2655 × g for 5 min at 15 °C, washed twice with sterile distilled water, and then suspended in 10 mM MgSO4 (Sigma® M-9397) containing 0.1% Tween 20 surfactant. The concentration was adjusted to 105 spores mL−1 and the inoculum was prepared by mixing an equal volume of each isolate spore suspension.

2.2.3 Plantlet inoculation and leaf sampling

Twenty-one-day-old plantlets were inoculated either with 10 µL (one drop) of M. graminicola inoculum (105 spores mL−1) at the bottom part of the second leaf for microscopic observations, or by spraying a 3 mL covering over the whole plantlet to assess fungicide efficiency. The plants were enveloped in a transparent polyethylene bag for 3 days. The bag provided an atmosphere of saturated humidity around the inoculated leaves. Disease development was followed for 1 month after inoculation by sampling inoculated leaves at 0, 1, 2, 3, 5, 7, 12, 14, 16, 19, 23, 26, 28 and 30 days post-inoculation (dpi). Six leaves per leaf layer were collected each time, three for the microscopic observations and three for qPCR analyses.

2.2.4 Fungicide treatments

JOAO (prothioconazole 250 g a.i. L−1; Bayer CropSciences, Langenfeld, Germany) in its recommended dose (0.8 L ha−1) was tested for its efficiency (preventive and curative) and persistence in containing the development of Septoria disease under controlled conditions. For fungicide application, each plant was covered once with 3 mL of the fungicide solution, supplemented with one drop of Tween 20, using a spray gun (Preval®; Coal City, Illinois, USA).

2.2.4.1 Fungicide application timing

Depending on the day of inoculation (d0), four fungicide timing applications were tested: one preventive treatment at one day before inoculation (d − 1) and three curative at 3, 7 and 10 days after inoculation (d + 3, d + 7 and d + 10, respectively).

2.2.4.2 Fungicide persistence

Depending on the day of fungicide application (d0), five inoculation dates were tested: 1, 7, 15, 21 and 30 days after fungicide treatment (dat) (d + 1, d + 7, d + 15, d + 21 and d + 30, respectively).

2.2.5 Microscopy observations

Microscopic observations were carried out according to Shetty et al.,[23] with modifications. Leaves were cut and cleared by placing them overnight between two filter papers saturated with glacial acetic acid and absolute ethanol (1:3 v/v). They were then washed three times with distilled water and stored between two filter papers in a solution of lactoglycerol (lactic acid/glycerol/distilled water, 1:1:1, v/v/v) until observation. Coloration was carried out by incubating the leaf parts in 0.1% trypan blue in lactoglycerol for 1 h at 50 °C.

Stained slides were microscopically assessed using a Leica DM 4500P research microscope (Leica Microsystems, Bensheim, Germany). Further magnification was achieved by analysing the surface of cryofractured nonstained leaf fragments with an electron microscope (TM-1000 Tabletop Microscope; HITACHI High-Technology Corporation, Minato-ku, Tokyo, Japan).

2.2.6 DNA extraction

All plant leaves analysed by qPCR had less than 40% necrotic surface. Collected leaf samples were placed directly in liquid nitrogen and then lyophilised in a Virtis 12 XL lyophiliser for 48 h. The dried samples were then ground using an MM 300 Mixer Mill (Qiagen, USA). DNA was extracted using the DNeasy 96 Plant kit (Qiagen, USA) according to the manufacturer's protocol. DNA was quantified by measurement of UV absorption at 260 nm (Cary 50 UV–visible spectrophotometer; Varian, Courtaboeuf, Les Ulis, France).

2.2.7 Quantification of M. graminicola using qPCR analysis

To quantify infection levels of M. graminicola, primers and TaqMan minor groove binder probes were used to target a 63-bp fragment of the β-tubulin gene (GenBank accession no. AY547264), as described in Bearchell et al.[19] A TaqMan assay was carried out in 25 µL of a reaction mixture that contained the following: 12.5 µL Universal TaqMan PCR Master Mix (Life Technologies SAS, Villebon sur Yvette, France), 0.3 µM of each primer, 0.2 µM probe, 200 ng DNA and water to a volume of 25 µL. The conditions of qPCR determination were the following: 10 min at 95 °C, followed by 40 cycles of 15 s at 95 °C and 1 min at 60 °C. All qPCR experiments were carried out using an ABI PRISM 7300 sequence detection system (Applied Biosystems).

qPCR analysis of the M. graminicola β-tubulin gene was calibrated from 102 to 107 copies by serial dilution of the appropriate cloned target sequence.

3 RESULTS

  1. Top of page
  2. Abstract
  3. 1 INTRODUCTION
  4. 2 MATERIALS AND METHODS
  5. 3 RESULTS
  6. 4 DISCUSSION
  7. ACKNOWLEDGEMENTS
  8. REFERENCES

3.1 External contamination by ascospores

Data in Fig. 1a show that there was dry weather during the experimental season (2008–2009) and low temperatures of around 10 °C until the end of April. Results of spore capture showed a low level of external ascospore contamination (Fig. 1b). Three periods of contamination were observed. The first period was during April, with two main peaks that represented 30 and 3000 ascospores per day. The second was the main period, which represented a continuous arrival of ascospores during May, with a stable number of about 100 spores per day. The third period was a classical period of ascospore production, which was at the end of the wheat growing season during July (about 30 spores per day).

3.2 Development of fungal biomass

Evolution of M. graminicola was characterised by simultaneously using visual symptoms and M. graminicola β-tubulin gene qPCR (Fig. 2). Observation of necrotic areas on the top three leaf layers of the two cultivars Maxwell and Dinosor showed late disease development during June, with a ‘croissant’-like gradient from the top of the plant (flag leaf) to the bottom. The epidemic began in the susceptible cultivar Dinosor 15 days earlier than in the resistant cultivar Maxwell. By 16 June [Zadok's growth stage (GS) 85], Dinosor's leaf necrotic surface was 5, 22 and 25% for F1, F2 and F3, respectively, whereas Maxwell had not shown any symptoms. Two weeks later, all three leaf layers of Dinosor had more than 60% necrotic surface, whereas the values for Maxwell were 11.6, 23.5 and 67.5%, respectively.

image

Figure 2. Septoria blotch disease progression on Dinosor and Maxwell cultivars measured by necrotic surface observation and by qPCR.

Download figure to PowerPoint

The development of epidemics of M. graminicola was detected earlier with qPCR analysis (Fig. 2) than when the same samples were observed visually. qPCR was not used for samples with >40% of the surface area necrotic because of the negative effect observed on the accuracy of analysis. The M. graminicola β-tubulin gene on F3 was observed 2–4 weeks before symptoms appeared. There were five copies of the β-tubulin gene per 100 ng leaf DNA (CBT100ng). The detection of M. graminicola DNA was 2 weeks later in the resistant cultivar than in the susceptible cultivar. The croissant gradient of the disease from the top of the plant to the bottom was also observed by qPCR analysis on all analysis dates except 2 and 8 June (GS 61 and 65 for Maxwell and GS 64 and 70 for Dinosor, respectively), when F1 qPCR values were higher than F2 and higher than or equal to F3. This increase was 14 days after the second period of the external contamination as determined by spore capture. This was characterised by the continuous arrival of ascospores (Fig. 1b), combined with disease-favourable conditions, a high rate of precipitation (25 mm) and a temperature of 20–25 °C (Fig. 1a).

3.3 Wheat resistance to Septoria leaf blotch

The resistance of wheat cultivars to M. graminicola was evaluated using visual symptoms assessment and qPCR analysis. Leaf samples were collected from the two leaf layers below the flag leaf, from the F3 leaf layer on 2 June at GS 61, 64, 65, 68 and 67, and from the F2 leaf layer on 16 June at GS 72, 71, 73, 73 and 73, of Maxwell, Dinosor, Alixan, Tremie and Maxyl, respectively. Results obtained for the M. graminicola DNA amount (Fig. 3b), using either the F3 or F2 leaf layer, correlated well with the susceptibility rating given by the Arvalis Institut du Végétal.[24] Where two statistical groups were obtained, one presented the four susceptible cultivars (Dinosor, Alixan, Tremie and Maxyl) and the second presented the resistant cultivar (Maxwell). A close correlation was obtained between the results of the amount of DNA and the percentages of leaf necrotic area, especially when using the F2 leaf layer, where the discrimination between the two categories was clearer than with the F3 leaf layer (Fig. 3a).

image

Figure 3. (a and b) Evaluation of cultivar resistance using visual symptoms observations and qPCR. (c) Frequency of DMI-resistant genotypes of M. graminicola; low resistant (I381) and moderate resistant (R6, R7− and R7+). Leaf samples were collected from leaf layers F3 and F2 on 2 and 16 June 2009, respectively. Bars with the same letters are not significantly different.

Download figure to PowerPoint

3.4 Distribution of R-types of M. graminicola to DMI

Quantification of the R-types of M. graminicola was not possible in the case of the Maxwell cultivar because of its low level of contamination. Therefore, the quantification of R-types (R6, R7−, R7+ and I381) was achieved only for the susceptible cultivars Dinosor, Alixan, Tremie and Maxyl. Analyses of R-types were carried out on two dates and using two leaf layers: F3 leaf samples were used on 2 June and F2 leaf samples on 16 June. For F3, the averages of CBT100ng were 1492, 2284, 1378 and 3606, and for F2 were they 3174, 5194, 3591 and 3642 for Dinosor, Alixan, Tremie and Maxyl, respectively. No significant differences were observed between R-types over the four cultivars used and over the two dates of analyses (Fig. 3c). Regardless of the wheat cultivar, a high proportion of V381 strains (≥94%) was found, with an average of 74.2, 0.1 and 19.7% for R6, R7− and R7+ genotypes, respectively, whereas, I381 strains represent only 6% of all M. graminicola populations.

3.5 Effect of application timing and persistence on fungicide efficacy

The effect of fungicide application timing on the development of Septoria blotch disease was investigated in an in planta experiment over 21 days. Within this period, the non-green leaf area reached 15% on non-inoculated control plants. Between 3 and 15 dpi, disease dynamics on control plants was slow (CBT100ng was 113–237 for Dinosor and 67–191 for Maxwell) but accelerated between 15 and 21 dpi to reach 1922 and 764 for Dinosor and Maxwell, respectively. The area under the disease progression curve (AUDPC) was calculated using qPCR analysis (CBT100ng) for the period from 3 to 21 dpi. For control plants, AUDPC was 8633 and 4614 for Dinosor and Maxwell, respectively. The AUDPC for all fungicide treatments was lower than in the control. A significant negative effect of all fungicide treatments on the development of fungal DNA was observed regardless of the plant cultivar. The most effective application occurred with the preventive treatment (d − 1), where fungal DNA was strongly decreased on all dates of observations: protection levels of 79% and 85% were achieved for Dinosor and Maxwell, respectively. Microscopic observations showed that spores failed to germinate when fungicide was applied 1 day before inoculation (Fig. 4). Curative treatment (d + 3) was similar to preventive treatment; the level of protection for Dinosor and Maxwell was 73 and 71%, respectively. Less fungicidal impact was observed when the fungicide was applied 7 and 10 days after inoculation (d + 7 and d + 10); the level of protection was 45–60%.

image

Figure 4. Electron microscopy exposures of Dinosor leaves sampled at 15 dpi by a 10 µL drop of M. graminicola conidiospores (105 mL−1): (a) non-treated control, where almost all spores germinated and stomata near from the point of inoculation were penetrated; and (b and c) wheat leaf treated with prothioconazole 1 day before inoculation (d − 1), where spores failed to germinate and almost all spores degraded (triangles).

Download figure to PowerPoint

For studying the fungicide persistence, a susceptible cultivar (Dinosor) was inoculated at 1, 7, 15, 21 and 30 days after fungicide treatment (dat). As observed previously, the preventive treatment, 1 day before inoculation, had a high protection level of 83.6%. But this level of protection was decreased strongly when the inoculation was done 7 or 15 dat with a protection level of 42.5% and 27.2% respectively. Inoculation modalities tested after 15 days of treatment did not have any protective effect.

3.6 Validation of qPCR analyses

3.6.1 Relationship between qPCR analyses and M. graminicola necrotic symptoms

The second leaf layer (F2) of the susceptible cultivar Maxyl was used to study the correlation between DNA amounts measured by qPCR for leaf samples with different levels of necrotic surfaces, from 0 to 100% (Fig. 5). M. graminicola DNA was detected in samples without symptoms and the DNA amount increased proportionally with an increase in leaf necrotic surface. A high level of correlation (CF = 0.95) was observed up to 40% leaf necrotic surface. The amount of M. graminicola DNA decreased beyond 50% leaf necrotic surface and remained stable.

image

Figure 5. Linear relationship between necrotic symptoms and qPCR analysis using F2 leaf layer of Maxyl cultivar.

Download figure to PowerPoint

3.6.2 Relationship between qPCR analysis and fungal colonisation stages

To understand the relationship between the amounts of M. graminicola DNA measured by qPCR and leaf colonisation stage, a M. graminicola–wheat pathosystem with one point of inoculation was followed. The base part of the second leaf of 21-day-old plantlets (GS 13) was inoculated using 10 µL (one drop) of M. graminicola inoculum (105 spores mL−1). Fungal colonisation stages and the development of the amount of DNA are tabulated in Table 3.

Table 3. Relationship between Mycosphaerella graminicola colonisation stages and results of qPCR analysis
Day post-inoculationColonisation stateCBTga
  1. a

    Copy of M. graminicola β-tubulin gene per gram of fresh leaf.

0Inoculation327
1Germination367
3Penetration443
5–7Internal colonisation533–564
12Cell degradation683
26Symptoms (2%)1785

One day after inoculation, 70% of spores had germinated and almost all germ tubes growing on the leaf surface were oriented toward the stomata (Fig. 6a and b). Stomata located near the inoculation point were penetrated (Fig. 6c and d). Appressorium-like structures (swellings of germ tube tips) were observed in contact with the ridges found at the guard cell lips (Fig. 7a and b) and also sometimes over anticlinal walls, within the depressions between epidermal cells (Fig. 7c–e). Electron microscopic observations of cryofractured leaf samples showed a direct penetration of leaf tissue in positions far from the stomata (Fig. 7f). Intercellular colonisation by mycelia growth was observed 5 and 7 dpi (Fig. 6e). It was characterised by a progression from the inoculation point toward the top part of the leaf. This progression was fast at the beginning and became slower until 9 dpi. At 12 dpi, stomata were coloured blue and cell death reached 20% of the leaf surface around the inoculation point (Fig. 6f). Disease development remained stable at this level until the appearance of symptoms at 26 dpi.

image

Figure 6. Electron microscopy (a, c and e) and light microscopy (b, d and f) exposures of the colonisation stages of Dinosor leaves inoculated by a 10 µL drop of M. graminicola conidiospores (105 mL−1): (a and b) spore germination at 1 dpi, 70% of spores germinated and almost all germ tubes grew on the leaf surface oriented toward the stomata (arrows); (c and d) at 3 dpi, stomata located near the inoculation point were penetrated (arrowhead); (e) at 5 and 7 dpi, the stomata were penetrated by passing through the stomatal guard cells and then intercellular colonisation by mycelia growth; (f) at 12 dpi, 55% of the stomata were coloured blue and cell death had reached 20% of the leaf surface. (Note the colonisation of adjacent substomatal chambers and the surrounding tissue of the substomatal chamber.)

Download figure to PowerPoint

image

Figure 7. Electron microscopy (a, b, c, e and f) and light microscopy (d) exposures of Dinosor leaves inoculated by a 10 µL drop of M. graminicola conidiospores (105 mL−1) sampled at 15 dpi: (a) stomata penetration by germ tubes; (b) two germ tubes with an appressorium-like structure penetrating a single stomata (arrows); (c, d and e) germ tube apical differentiations, which are similar to those seen over stomatal openings but here are associated with a leaf surface depression over an epidermal cell anticlinal wall (arrows); (f) cryofracture of M. graminicola colonised wheat leaf. Note that the site of penetration (arrowhead) is not via stomata, which proves the direct penetration by this fungus.

Download figure to PowerPoint

The qPCR assay was performed for samples collected on the same dates as for samples used for the microscopic observations. M. graminicola DNA evolution was characterised by an increase in the number of β-tubulin gene copies per gram (CBTg) of fresh leaf weight from 327 at the day of inoculation to 683 copies at 12 dpi. The amount of DNA then remained stable over 10 days. At 26 dpi, during the appearance of symptoms, an increase in the amount of DNA becomes important.

4 DISCUSSION

  1. Top of page
  2. Abstract
  3. 1 INTRODUCTION
  4. 2 MATERIALS AND METHODS
  5. 3 RESULTS
  6. 4 DISCUSSION
  7. ACKNOWLEDGEMENTS
  8. REFERENCES

Septoria tritici leaf blotch in wheat has a long latent period.[25] Prompt information about epidemic diseases, external contamination (arrival of ascospores) and fungicide-resistant alleles can be used to modify disease management strategies, based on the optimal use of host resistance, chemical control and cultural practices.[21] In the present study, we highlight the importance of the use of qPCR in the study of Septoria leaf blotch epidemics, plant resistance, and fungicide efficiency and persistence against M. graminicola and its DMI-resistant genotypes.

Air spores of M. graminicola present the primary disease inoculation. These could be produced all year round under specific conditions, such as certain weather conditions,[26] and by mature pseudothecia.[5] Results of spore traps have indicated that external contamination by ascospores affects the Septoria leaf blotch epidemic by increasing the level of contamination in the upper leaf layers (F1 and F2). The position of these leaf layers allows them to capture more air spores than the leaf layers at the bottom of the plant. This external contamination by ascospores could affect the estimation of fungicide efficiency by allowing reinfection outside the period of fungicide effectiveness. However, our results in planta showed that when inoculation was delayed until 7 dat fungicide performance decreased by more than 50%. Therefore, the detection of this reinfection source provides an accurate evaluation of the efficiency of fungicide treatment. In ascospore traps, the limitation of qPCR is the absence of specific gene markers that can discriminate between conidiospores and ascospores. However, M. graminicola conidia have a limited spread of only a few meters,[27] whereas ascospores spread over longer distances.[21] Therefore, the limitation of qPCR was successfully eliminated by removing all plants within a 3 m diameter of the traps in order to avoid the capture of rain-splash-dispersed conidia.

The accuracy of the use of qPCR to evaluate the resistance level of wheat cultivars to M. graminicola was investigated. Detection of M. graminicola using qPCR was achieved 2–4 weeks before symptoms appeared and was 2 weeks earlier in the susceptible cultivars than in the resistant one. However, the M. graminicola epidemiology was well characterised for the resistant cultivar by a low level of contamination and a longer period of incubation than the susceptible cultivars. A close correlation was obtained between qPCR results and the percentages of leaf necrotic area, especially with the F2 leaf layer (r = 0.95–0.99). Generally, results of qPCR analyses correlated well with the susceptibility rating of cultivars that were previously identified by the Arvalis Institut du Végétal.[24] However, under natural infection conditions, visual assessment is suitable for assessing the combined resistance to all pathogens involved, but it is not suitable for assessing resistance to individual pathogens in a disease complex.[28] Visual assessment lacks accuracy and specificity and may be confused with other diseases, stress-related symptoms or even normal plant development.[29-31] This problem was eliminated with qPCR, which has a high level of specificity of M. graminicola β-tubulin and other microorganisms on the leaf surface that interfere with M. graminicola DNA are avoided.[16] Furthermore, the using of multiplex qPCR,[32] permits the quantification of other wheat pathogens in the same DNA sample.

The effect of wheat genotypes on the distribution of DMI-resistant R-types of M. graminicola was also studied. As observed previously by Selim,[20] no significant effect of wheat cultivar was observed and the population structure was stable over all the analysis dates in the same season. Interestingly, the frequency of V381-genotypes was >90%, which indicates an increasing in TriMR compared with the frequency of >50% reported in previous surveys carried out in 2005 and 2006,[1] and >70% in 2007.[20] In fact, the high frequency of amino acid substitution I381V in combination with other mutations such as A379G and ΔY459/G460 supports the hypothesis that some combinations of CYP51 mutations have evolved through intragenic recombination and have subsequently reached high frequencies due to reduced sensitivity for most DMIs, with the exception of epoxiconazole and prothioconazole applied at their recommended label doses.[12, 13, 33] However, the presymptomatic detection and quantification of M. graminicola R-types is very important for the effective control of strains that are highly resistant to DMIs, as it allows better timing, choice and dose of fungicide applications. For example, genotypes R6, R7− and R7+ are less sensitive to tebuconazole but are sensitive to prochloraz, whereas genotypes carrying substitution V136A (R5) are most resistant to prochloraz.[1, 34, 35]

In the absence of total wheat cultivar resistance to Septoria leaf blotch, DMIs remain the key fungicide agents against M. graminicola.[1, 36] Their effects on M. graminicola are mostly attributed to the systemic action and inhibition of spore germination.[37] In the present study, qPCR analysis was used to evaluate the preventive and curative efficiency of DMI fungicides to control the more frequent genotypes of M. graminicola (R6, R7− and R7+). Results showed that prothioconazole treatments significantly decreased the amount of M. graminicola DNA by 80% in preventive treatment, and they were still 70% efficient when applied curatively at 3 dpi. Electron microscope observations showed that, after the preventive fungicide treatment (d − 1), the spores failed to germinate. Although all fungicide treatments resulted in a significant DNA reduction, compared with a non-treated control, later applications of prothioconazole, at 7 to 10 dpi, resulted in a high loss of efficiency (>50%). These results are in agreement with those reported by Godwin et al.[37] and Guo et al.,[18] namely that prothioconazole has a significant inhibitive effect against spore germination and post-germination, and could have a good curative effect against M. graminicola when applied at up to 20% of the latent period. However, most fungicides work best when applied early in the infection cycle, prior to visual symptom expression.[38] Our results examining fungicide persistence using the susceptible cultivar (Alixan), have clarified that preventive treatment was affected by the period between fungicide applications and when leaves were first infected. Whereas the preventive treatment (d − 1) was very effective with a protection level of 83.6%, this level of protection has decreased strongly when the inoculation was done 7 or 15 dat with a protection level of 42.5% and 27.2%, respectively. Inoculation 15 days after fungicide treatment did not have any protective effect. Thus, a qPCR monitoring process could help determine when fungicide application would be needed, and hence it could be determined when spraying would be most economical.[17]

For a good understanding of the M. graminicola epidemic, cytological investigations are very important; however, under field conditions they are difficult to carry out.[5] Therefore, we studied the relationship between qPCR analysis and the M. graminicola infection processes under controlled conditions and by using a one-drop inoculation method. This method is efficient because it controls the number of spores at the beginning of infection, it reduces points of penetration that delay disease development and it eliminates the limitation of the qPCR method, which arises from the DNA quantification of dead and nongerminated spores.[39, 40] However, penetration of leaves occurred mostly through the stomata, which is in agreement with previous reports.[5, 23, 41, 42] Appressorium-like swellings were produced over the stomata as well as periclinally and anticlinally, and all stomatal penetration took place from germ tubes with swellings. Direct penetrations have been demonstrated previously[23, 41, 43, 44] and were rare. It has been suggested that direct penetration was due to a secondary mechanism of invasion of the host;[41] however, its trigger factors are not known. The time course of the wheat infection processes of M. graminicola has been described by Kema et al.[5] and by Duncan and Howard.[42] In the present study, a strong correlation between the results of qPCR and microscopic observations was found, and disease development determined using TaqMan qPCR had a similar pattern to that previously revealed by ELISA[5] or by the PCR/PicoGreen assay.[16] Until the formation of necrotic lesions, the biomass increased only slightly (or even decreased), but then increased rapidly during necrosis and the formation of pycnidia.

It has been shown in the present study that the preventive fungicide application is still effective against Septoria leaf blotch in wheat but it is very important to take into account the fungicide persistence, wheat varietal resistance level, and external contamination by ascospores in the management of this disease. It would seem that none of the studied factors affect the frequency of DMI-resistant genotypes. Also we showed that qPCR presents an accurate, specific and presymptomatic quantitative method for realising these objectives. Further research is required to improve our understanding of M. graminicola epidemics, taking in account the highly resistant isolates which were identified recently by Leroux and Walker[11] and using different fungicides.

ACKNOWLEDGEMENTS

  1. Top of page
  2. Abstract
  3. 1 INTRODUCTION
  4. 2 MATERIALS AND METHODS
  5. 3 RESULTS
  6. 4 DISCUSSION
  7. ACKNOWLEDGEMENTS
  8. REFERENCES

This work was financially supported by Bayer CropScience in France (BCSF).

REFERENCES

  1. Top of page
  2. Abstract
  3. 1 INTRODUCTION
  4. 2 MATERIALS AND METHODS
  5. 3 RESULTS
  6. 4 DISCUSSION
  7. ACKNOWLEDGEMENTS
  8. REFERENCES
  • 1
    Leroux O, Albertini C, Gautier A, Gredt M and Walker AS, Mutation in the CYP51 gene correlated with changes in sensitivity to sterol 14α-demethylation inhibitors in field isolates of Mycosphaerella graminicola. Pest Manag Sci 63:688698 (2007).
  • 2
    Stammler G, Carstensen M, Koch A, Semar M, Strobel D and Schlehuber S, Frequency of different CYP51-haplotypes of Mycosphaerella graminicola and their impact on epoxiconazole-sensivity and -field efficacy. Crop Protect 27:14481456 (2008).
  • 3
    Palmer CL and Skinner W, Mycosphaerella graminicola: latent infection, crop devastation and genomics. Mol Plant Pathol 3:6370 (2002).
  • 4
    Shaw MW and Royle DJ, Airborne inoculum as a major source of Septoria tritici (Mycophaerella graminicola) infections in winter wheat crops in the UK. Plant Pathol 38:3543 (1989).
  • 5
    Kema GHJ, Yu D, Rkenberg FHJ, Shaw MW and Baayen RP, Histology of the pathogenesis of Mycosphaerella graminicola in wheat. Phytopathology 86:777786 (1996).
  • 6
    Shaw MW and Royle DJ, Factors determining the severity of epidemics of Mycosphaerella graminicola (Septoria tritici) on winter wheat in the UK. Plant Pathol 42:882899 (1993).
  • 7
    Fraaije BA and Cools HJ, Are azole fungicides losing ground against Septoria wheat disease? Resistance mechanisms in Mycosphaerella graminicola. Pest Manag Sci 64:681684 (2008).
  • 8
    Cools HJ, Fraaije B and Lucas JA. Molecular examination of Septoria tritici isolates with reduced sensitivity to triazoles, in Modern Fungicides and Antifungal Compounds, ed. by Dehne DW, Gisi U, Kuck KH, Russell PE and Lyr H. BCPC, Alton, UK, pp. 103114 (2005).
  • 9
    Chassot C, Hugelshofer U, Sierotzki H and Gisi U, Sensitivity of Cyp51 genotypes to DMI fungicides in Mycosphaerela graminicola, in Modern Fungicides and Antifungal Compounds V, ed. by Dehne DW, Gisi U, Kuck KH, Russell PE and Lyr H. DPG Seebsterverlag, Braunschweig, pp. 129136 (2008).
  • 10
    Roohparvar R, Huser A, Zwiers LH and De Waard MA, Control of Mycosphaerella graminicola on wheat seedlings by medical drugs known to modulate the activity of ATP-binding cassette transporters. Appl Environ Microbiol 73:50115019 (2007).
  • 11
    Leroux P and Walker AS, Multiple mechanisms account for resistance to sterol 14 alpha-demethylation inhibitors in field isolates of Mycosphaerella graminicola. Pest Manag Sci 67:4459 (2010).
  • 12
    Clark W, Septoria tritici and azol performance. Asp Appl Biol 78:127132 (2006).
  • 13
    Leroux P, Walker AS, Couleaud G, Maumené C and Le Hénaff G, Field strategies to manage fungicide resistance in Mycosphaerella graminicola, the causal agent of wheat leaf blotch, in Modern Fungicides and Antifungal Compounds V, ed by Dehne DW, Gisi U, Kuck KH, Russell PE and Lyr H. DPG Seebsterverlag, Braunschweig, pp. 143149 (2008).
  • 14
    Henson JM and French RC, The polymerase chain reaction and plant disease diagnosis. Annu Rev Phytopathol 31:81109 (1993).
  • 15
    Schena L, Nigro F, Ippolito A and Gallitelli D, Real-time quantitative PCR: A new technology to detect and study phytopathogenic and antagonistic fungi. Eur J Plant Pathol 110:893908 (2004).
  • 16
    Fraaije BA, Lowell DJ, Rohel EA and Hollomon DW, Rapid detection and diagnosis of Septoria tritici epidemics in wheat using a polymerase chain reaction/PicoGreen assay. J Appl Microbiol 86:701708 (1999).
  • 17
    Guo JR, Schnieder F and Verreet JA, Presymptomatic and quantitative detection of Mycosphaerella graminicola development in wheat using a real-time PCR assay. FEMS Microbiol Lett 262:223229 (2006).
  • 18
    Guo JR, Schnieder F and Verreet JA, A real-time PCR assay for quantitative and accurate assessment of fungicide effects on Mycosphaerella graminicola leaf blotch. J Phytopathol 155:482487 (2007).
  • 19
    Bearchell SJ, Fraaije BA, Shaw MW and Fitt BDL, Wheat archive links long-term fungal pathogen population dynamics to air pollution. Proc Natl Acad Sci USA 102:54385442 (2005).
  • 20
    Selim S, Allele-specific real-time PCR quantification and discrimination of sterol 14 α-demethylation-inhibitor-resistant genotypes of Mycosphaerella graminicola. J Plant Pathol 91:391400 (2009).
  • 21
    Fraaije BA, Cools HJ, Fountaine J, Lovell DJ, Motteram J, West JS, et al., Role of ascospores in further spread of QoI-resistant cytochrome b alleles (G143A) in field populations of Mycosphaerella graminicola. Phytopathology 95:933941 (2005).
  • 22
    Arraiano LS, Brading PA and Brown JKM, A detached seedling leaf technique to study resistance to Mycosphaerella graminicola (anamorph Septoria tritici) in wheat. Plant Pathol 50:339346 (2001).
  • 23
    Shetty NP, Kristensen BK, Newman M-A, Møller K, Gregersen PL and Jørgensen HJL, Association of hydrogen peroxide with restriction of Septoria tritici in resistant wheat. Physiol Mol Plant Pathol 62:333346 (2003).
  • 24
    Arvalis Institut du Végétal, Blé tendre-maladies; comportement vis-à-vis des maladies. Choisir (2008).
  • 25
    Verreet JA, Klink H and Hoffmann GM, Regional monitoring for disease prediction and optimization of plant protection measures: the IPM wheat model. Plant Dis 84:816826 (2000).
  • 26
    Cordo CA, Simón MR, Perelló AE and Alippi HE. Spore dispersal of leaf blotch pathogens of wheat (Mycosphaerella graminicola and Septoria tritici), in CIMMYT, Septoria and Stagonospora Diseases of Cereals: A Compilation of Global Research. CIMMYT, Mexico, pp. 98101 (1999).
  • 27
    Boeger JM, Chen RS and McDonald BA, Gene flow between geographic population of Mycosphaerella graminicola (anamorph Septoria tritici) detected with restriction fragment length polymorphism markers. Phytopathology 83:11481154 (1993).
  • 28
    Loughman R, Wilson RE and Thomas GJ, Components of resistance to Mycosphaerella graminicola and Phaeosphaeria nodorum in spring wheat. Euphytica 89:377385 (1996).
  • 29
    Hollomon DW, Fraaije B, Rohel E, Butters J and Kendall S. Detection and diagnosis of Septoria diseases: The problem in practice, in Septoria on Cereals: A Study of Pathosystems, ed. by Lucas JA, Bowyer P and Anderson HM. CABI Publishing, Wallingford, pp. 273285 (1999).
  • 30
    Parker SR, Shaw MW and Royle DJ, The reliability of visual estimates of disease severity on cereal leaves. Plant Pathol 44:856864 (1995).
  • 31
    Shimin T, Accurate assessment of wheat and triticale cultivar resistance to Septoria tritici and Stagonospora nodorum infection by biotin/avidin ELISA. Plant Dis 89:12291234 (2005).
  • 32
    Fraaije BA, Lowell DJ, Coelho JM, Baldwin S and Hollomon DW, PCR-based assay to assess wheat varietal resistance to blotch (Septoria tritici and Stagonospora nodorum) and rust (Puccinia striiformis and Puccinia recondita) diseases. Eur J Plant Pathol 107:905917 (2001).
  • 33
    Brunner PC, Stefanato FL and Mcdonald BA, Evolution of the CYP51 gene in Mycosphaerella graminicola: evidence for intragenic recombination and selective replacement. Mol Plant Pathol 9:305316 (2008).
  • 34
    Fraaije BA, Cools HJ, Kim SH, Motteram J, Clark WS and Lucas JA, A novel substitution I381V in the sterol 14 α-demethylase (CYP51) of Mycosphaerella graminicola is differentially selected by azole fungicides. Mol Plant Pathol 8:245254 (2007).
  • 35
    Stammler G, Kern L, Semar M, Glaettli A and Schoefl U. Sensitivity of Mycosphaerella graminicola to DMI fungicides related to mutations in the target gene cyp51 (14 α-demethylase), in 15th International Reinhardsbrunn Symposium, Modern Fungicides and Antifungal Compounds 2008, ed. by Dehne HW, Gisi U, Kuck KH, Russell PE and Lyr H. Friedrichroda, Germany, pp. 137–142 (2008).
  • 36
    Mavrolidi VI and Shaw MW, Sensitivity distributions and cross-resistance patterns of Mycosphaerella graminicoma to fluquinconazole, prochloraz and azoxystrobin over a period of 9 years. Crop Protect 24:256259 (2005).
  • 37
    Godwin JR, Bartlett DW and Heaney SP. Azoxystrobin: implications of biological mode of action, pharmacokinetics and resistance management for spray programmes against Septoria diseases of wheat, in Septoria on Cereals: A Study of Pathosystems, ed. by Lucas JA, Bowyer P and Anderson HM. CABI Publishing, Wallingford, pp. 299–315 (1999).
  • 38
    O'Reilly P, Bannon E and Doyle A, Timing of fungicide applications in relation to the development of Septoria nodorum in winter wheat in Proceedings of the British Crop Protection Conference—Pests and Disease, Brigton Centre and Brighton Metropole, England, November 21–24, ed. by Surrey, U.K. : British Crop Protection Council (BCPC), Farnham, pp. 929–934 (1988).
  • 39
    Josephson KL, Gerba CP and Pepper IL, Polymerase chain reaction detection of nonviable bacterial pathogens. Appl Environ Microbiol 59:35133515 (1993).
  • 40
    Allmann M, Höfelein E, Köppel E, Lüthy J, Meyer R, Niederhauser C, et al., Polymerase chain reaction (PCR) for detection of pathogenic microorganisms in bacteriological monitoring of dairy products. Res Microbiol 146:8697 (1995).
  • 41
    Cohen L and Eyal Z, The histology of processes associated with the infection of resistant and susceptible wheat cultivars with Septoria tritici. Plant Pathol 42:737743 (1993).
  • 42
    Duncan KE and Howard RJ, Cytological analysis of wheat infection by the leaf blotch pathogen Mycosphaerella graminicola. Mycol Res 104:10741082 (2000).
  • 43
    Rohel EA, Payne AC, Fraaije BA and Hollomon DW, Exploring infection of wheat and carbohydrate metabolism in Mycosphaerella graminicola transformants with differentially regulated green fluorescent protein expression. Mol Plant–Microbe Interact 14:156163 (2001).
  • 44
    Dancer J, Daniels A, Cooley N and Foster S. Septoria tritici and Stagonospora nodorum as model pathogens for fungicide discovery, in Septoria on Cereals: A Study of Pathosystem, ed. by Lucas JA, Bowyer P and Anderson HM. CABI Publishing, Wallingford, pp. 316331 (1999).