SEARCH

SEARCH BY CITATION

Keywords:

  • male reproductive problems;
  • testicular and spermatozoal toxicity;
  • cyclophosphamide;
  • oxidative stress;
  • apoptosis;
  • total flavonoids from Epimedium

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIAL AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. CONCLUSION
  8. Acknowledgement
  9. Conflict of Interest
  10. REFERENCES

Total flavonoids of Epimedium (TFE) is the main active composition of Epimedium that has been used to treat male reproductive problems. The present aim was to investigate the protective effects of TFE on male mice reproductive system against cyclophosphamide (CP)-induced oxidative injury. The animals were treated with CP to make testicular injury model and the protective effects of TFE were observed. In the CP-treated group, testicular and epididymal weights, sperm count and motility significantly decreased relative to the control group (P < 0.05 and P < 0.01, respectively). Compared with the CP-treated group, TFE (200 and 400 mg/kg) treated mice increased testicular weights by 21.6% and 28.4% (P < 0.05), sperm counts by 81.7% and 148.3% (P < 0.01) and sperm motility by 47.2% and 61.3% (P < 0.01). Meanwhile, the CP-treated group showed enhancement of lipid peroxidation leading to testicular reproductive toxicity. TFE restored these oxidative damages by up-regulating the expression of antioxidant enzymes, especially SOD3 and GPX1. TUNEL assay and histopathological observations provided supportive evidence for above results, and when the dose of TFE increased, the aforesaid improvement became more and more strong. These results demonstrated that TFE exerted beneficially protective effects on the structural and functional damage of male mice reproductive system and reduced apoptosis in spermatogenic cells by inhibiting CP-induced oxidative stress. Copyright © 2013 John Wiley & Sons, Ltd.


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIAL AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. CONCLUSION
  8. Acknowledgement
  9. Conflict of Interest
  10. REFERENCES

Cyclophosphamide (CP), a cytotoxic bi-functional alkylating agent, is extensively used in the treatment of various cancers with high efficacy. It is also used as an immunosuppressant in organ transplantation, rheumatoid arthritis, systemic lupus erythematosus, multiple sclerosis and other benign diseases (Tripathi and Jena, 2010). However, despite its wide spectrum of clinical uses, CP also presents a wide spectrum of adverse effects including reproductive toxicity in humans and experimental animals (Das et al., 2002). Through clinical follow-up, 80.2%–92.6% of the male who had accepted CP treatment in childhood because of leukemia, solid tumors and autoimmune diseases, presented the azoospermia (Kenney et al., 2001); Research shows that adult male patients treated with CP have demonstrated diminished sperm counts and an absence of spermatogenic cycles in their testicular tissue (Kim et al., 2012), and long-term treatment with CP injures progeny decreases the weight of the reproductive organs and impairs fertility. Thus, long-term side effects such as gonadal toxicity have become an important issue in the people treated with CP (Pendse et al., 2004). Meanwhile, experimental studies have also revealed that CP treatment in rats and mice resulted in decreased testicular weight, transitory oligospermia, impairment of sperm and its fertilizing ability as well as abnormal changes of the testis and epididymis (Elangovan et al., 2006; Selvakumar et al., 2006a; Selvakumar et al., 2006b). Because fast-dividing cells are a special target for damaging effects of CP, spermatogenic cell are vulnerable to CP alkylation by DNA cross-links and DNA double-strand breaks (Aguilar-Mahecha et al., 2005). However, the precise mechanism by which CP causes testicular and other toxicity is not fully known.

In recent years, researchers have found that oxidative stress plays a critical role in the pathogenesis of male reproductive toxicity induced by CP (Türk et al., 2010; Selvakumar et al., 2006b). Oxidative stress occurs mainly due to increased production of reactive oxygen species (ROS) such as superoxide anion (O2•–), hydroxyl radicals (·OH) and other reactive species in the application of CP (Türk et al., 2010), and thus may cause spermatogenesis dysfunction or even death of spermatozoa. Indeed, there is clinical evidence that oxidative stress is associated with application of CP. Usually, there are low amounts of antioxidants and rich polyunsaturated fatty acids in the mitochondrial membrane of spermatozoa, which makes spermatozoa more susceptible to lipid peroxidation (Shathish et al., 2012; Kim et al., 2012). Meanwhile, in the application of CP, the generation and accumulation of ROS induced by oxidative stress can overwhelm the intrinsic antioxidants and bring about damage to sperm cell, as a result of peroxidation of lipids, proteins, carbohydrates and DNA (He et al., 2012). This kind of ROS-induced sperm cell injury plays an important role in the pathogenesis of male reproductive toxicity induced by CP (Kim et al., 2012; Shathish et al., 2012). Accordingly, successful antioxidant interventions targeted to cleave ROS, which to date has attracted intensive interests from investigators, offer insights into delaying or preventing reproductive system injury induced by CP.

Epimedium is a traditional Chinese pharmic plant, which has been widely used in China with significant effects on recuperating the kidney yang, strengthening muscles and bones and dispelling wind dampness (State pharmacopoeia committee, 2010). Total flavonoids of Epimedium (TFE) are the main active ingredients. Recent pharmacological studies have shown that TFE possess lots of activities, such as antiaging, immuno-regulation, inhibiting osteoclasts, antidepressants, promoting sex hormone secretion, protecting cardio-cerebral vascular system and reducing serum lipid in hyperlipidemia (Huang et al., 2005; Meng et al., 2010). Nevertheless, there is no relevant reports on CP-induced spermatogenesis impairment. Our previous studies (Zhang et al., 2010) have found that TFE were able to attenuate male reproductive toxicity caused by CP, and yet the underlying mechanisms of TFE against CP-induced testis injury remain poorly understood, especially for antioxidant and apoptosis. The goal of our present study was to further confirm TFE protective effects on male reproductive system, evaluate whether TFE attenuate oxidative stress or inhibit apoptosis in CP-induced injury in murine testicular and epididymal tissue and, based on these results, investigate the antioxidative and antiapoptotic mechanisms involved.

MATERIAL AND METHODS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIAL AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. CONCLUSION
  8. Acknowledgement
  9. Conflict of Interest
  10. REFERENCES
Materials

TFE were purchased from Ren Cheng Co., Ltd (Chengdu, China). The voucher specimens were deposited in the Institute of Chinese Herb Medicine, College of Medical Sciences, China Three Gorges University.

Apparatus

Image analysis system (Leica, Germany), PT1020 tissue processor and tissue slicer (Leica, Germany), Suprafuge 22 high speed refrigerated centrifuge (Heraeus instruments, Germany), 752 UV and visible range microspectrophotometer (Shanghai, China), CDF-3220 Quantitative real-time polymerase chain reaction (PCR) (MJ Research, USA).

Chemicals

CP was obtained from Hengrui Medicine Co. Ltd (Jiangsu, China). Bouins liquid: Picric acid saturated solution 750 ml, Formaldehyde 250 ml, Acetic acid 50 ml. Sperm nutrition: BWW (NaCl 0.554 g/l, KCl 0.0356 g/l, CaCl2 0.025 g/l, KH2PO4 0.0162 g/l, MgSO4 · 7H2O 0.0294 g/l, NaHCO3 0.210 g/l, NaPyr 0.003 g/l, Nalac 0.370 g/l, Glucose 0.100 g/l, 0.5% mass fraction of phenol red 1.0 ml/l, Penicillin 100 U/ml, 0.3% mass fraction of BSA). Trizol was purchased from Shanghai Sangon Biotech Co., Ltd (Shanghai, China). MMLV First Strand cDNA Synthesis Kit and Ready-to-easy PCR Amplification Kit were obtained from Bio basic (Ontario, Canada).

HPLC analysis of TFE

TFE was extracted and analysed according to the method of previous study's research team (Li et al., 2006). Briefly, Epimedium (1000 g) was cut into small pieces and refluxed extraction with the 10000 ml 60% ethanol, and after 2 h, the mixture was filtered, and the filtrate was collected. A further 8000 ml 60% ethanol was added to Epimedium residue and refluxed extraction for another 2 h. The filtrate was collected and combined with the previous filtrate sample and then decompressed concentrating to paste. Then, the paste was dissolved in water and poured into chromatographic column containing macroporous adsorption resin AB-8 (Tianjin Pesticide Factory, China) rinsed with water and then eluted with 70% ethanol, flow rate at 2.0 ml/min. At last, TFE was gotten. High-performance liquid chromatography (HPLC) was performed to quantify and identify the presence and species of TFE in the sample. Authentic standards of Hexandraside F, Epimedin A, Epimedin B, Epimedin C and so forth were purchased from Chengdu Push Bio-Technology Co., Ltd (Chengdu, China); Icariin was purchased from the National Institute for the Control of Pharmaceuticals and Biological Products (Beijing, China). TFE was dissolved in ethanol at a concentration of 1.0 mg/ml. HPLC analysis was performed on a Ultimate XB-C18 column (4.6 mm × 150 mm, 5 micron) eluted with the mobile phases of acetonitrile (A) and 0.1% phosphoric acid solution (B) in gradient at a flow rate of 1.0 ml/min. The elution program was as follow: 0–5 min changed from 18% A to 35% A, 5–20 min, kept 35% A. The detection wavelength was 170 nm. The temperature of column was 30°C. Detection was evaporative light scattering detection (ELSD): the temperate of drift tube was 40°C, and the nitrogen pressure was 33 Psi.

Animals and experimental protocol

Eight-week-old male Balb/c mice were purchased from the Laboratory Animal Institute of Hubei Disease Control Center (Wuhan, China). The rights of experimental animals were ensured quantum satis ad during the experiment. Mice were housed in constant conditions at a temperature of 23 ± 3°C, humidity of 60 ± 5% and on a 12 h light–dark cycle. They were fed ad libitum and conditioned in a non-stressful environment for at least 1 week prior to experiments. Experiments were performed in accordance with the Guide for the Care and Use of Laboratory Animals of China Three Gorges University and approved by the ethics committee. The whole laboratory procedure was carried out under the permission and surveillance of the ethics committee. After 7 days of acclimation to the environment, mice were randomly divided into four groups: group I (control, n = 10), group II (CP-treated group, n = 10), group III (TFE, 200 mg/kg + CP-treated group, n = 10) and group IV(TFE, 400 mg/kg + CP-treated group, n = 10). For the first 7 days, group II, III and IV were treated with CP 50 mg/kg by intraperitoneal injection and group I were treated with normal saline once a day. For the next 28 days, groups I and II were treated with vehicle (normal saline), while group III and IV were treated with TFE, orally. The animals were weighed weekly to adjust the gavage volume. There were ten mice in each group (besides four mice in gene expression experiment, there were six in other experiment, such as histopathological examination, TUNEL and immunohisto-chemical analysis), and the experiment was carried out after the 4th week at the TFE treatment.

Preparation of tissues

At the end of the treatment period, mice were anesthetized with pentobarbital sodium (80 mg/kg, i.p.). The testes and epididymis were rapidly removed, weighed. The testes for the assays of biochemical analysis, RT-PCR and real-time PCR were snap-frozen in liquid nitrogen and stored at −80°C until further processing. The epididymis was used for sperm analysis.

Sperm analysis

The experimental mice sacrificed, and the entire epididymis was rapidly removed under sterile conditions and washed three times in phosphate buffered saline (PBS) to remove excess blood cells. The epididymis was minced into small fragments and then incubated in BWW medium containing 0.3% bovine serum albumin for 15 min at 37°C. The sperm concentrations were evaluated with a hemocytometer (Anxin, Shanghai, China). The number of sperm that was motile was determined by a Photo colour semen quality analyser (Wuhan, China), and the sperm motility was converted into a percentage.

Histopathological examination

For histopathological study, the testicular tissues of six animals from each group were separated, and a portion of the tissues was fixed in formalin and embedded in paraffin, sectioned at 5 µm, stained with hematoxylin and eosin and then observed by using a Leica DM2500 (Germany) microscope. The other portion was fixed in glutaral and potassium oxalate, then sliced and fixed in osmium tetroxide and potassium pyroantimonate, embedded in epoxy resins and stained with uranyl acetate and aluminum citrate. The tissue was cut into pieces, and slices of 50 nm thickness were made with ultramicrotome LKB8800 (LKB Produkter AB, Sweden). The ultrastructure of testis was observed on transmission electron microscopy (H-7500, Hitachi, Tokyo, Japan).

Biochemical analysis

Frozen testis tissue was homogenized and centrifuged at 3000 rpm at 4°C for 15 min. Supernatant homogenates were transferred to clean eppendorf (EP) tubes and stored at −80°C in aliquots until used for biochemical assays. The protein content of the supernatant was determined using the Lowry method. The malondialdehyde (MDA), superoxide dismutase (SOD) and glutathione peroxidase (GPX) levels in the testicular tissues were measured by chemichromatometry according to the directions of the reagent kits (Jiancheng Bioengineering Institute, Nanjing, China).

Quantitative real-time PCR analysis

Total RNA of the testes samples was extracted using TRIZOL reagent according to the supplier's instruction. RNA was quantitated by optical density measurement at 260 and 280 nm by using a spectrophotometer, and integrity was confirmed by running 4 µl of RNA on a 1.5% agarose gel. Reverse transcription (RT) was performed from total cellular RNA by using Revert Aid TM First-Strand cDNA Synthesis Kit for RT-PCR; a total volume of 25 µl reaction mixture containing 4.0 µg of total RNA, 1.0 µl of oligo-(dT)18 (0.5 µg/µl) and 7.0 µl of DEPC-treated water was denatured at 70°C for 5 min and chilled on ice for at least 1 min. Subsequently, 4 µl of 5 × reaction buffer, 1.0 µl RiboLockTM ribonuclease inhibitor (20 U/µl) and 2.0 µl dNTP (10 mM) were mixed and incubated at 37°C for 5 min. After incubation, 1.0 µl MMLV Reverse Transcriptase (200 U/µl) was added and incubated at 37°C for 10 min, 42°C for 60 min and 70°C for 10 min in a thermocycler (Bio-Rad MJ Mini PCR, USA). Finally, samples were chilled on ice and incubated with 2 U of RNAse for 20 min at 37°C before amplifying the target cDNA. cDNA was quantified and assessed for purity using a UV spectrophotometer, and the concentration was measured at 260 nm; the A260/A280 relation was calculated to determine cDNA quality.

The PCR primers of SOD1, SOD2, SOD3, GPX1 and β-actin were synthesized by Shanghai Sangon Biotech Co., Ltd (Shanghai, China). The sequences of the primers used in this study were shown in Table 1. PCR was carried out in 20 µl of reaction mixture containing 10 µl of TaKaRa 2 × PCR Master Mix (SYBR® Premix Ex TaqTM, TaKaRa, Japan), 0.5 µl 10 μM of each forward and reverse primer, template cDNA and PCR-grade water up to a final volume of 25 µl in a Bio-Rad iQ5 96-well plate. An initial activation at 95°C for 2 min was followed by an amplification target sequence of 40 cycles of pre-denaturing at 95°C for 30 s, then 95°C for 30 s, 60°C for 30 s and 72°C for 20 s in a thermocycler (CDF-3220 quantitative real-time PCR, USA). PCR of β-actin chosen as an internal control was carried out in the same tubes as for the genes.

Table 1. Primer sequences used in real-time PCR and RT-PCR
GenesForward primerReverse primerLengths of amplicons (bp)
SOD1TGCAGGGAACCATCCACTTCGCCCATGCTGGCCTTCAGTTAATC92
SOD2ACAGCCTCCCAGACCTGCCTTACCCTCGGTGGCGTTGAGATTGTTC123
SOD3AACTTCACCAGAGGGAAAGAGCCCAGTAGCAAGCCGTAGAACAAG93
GPX1GCAATCAGTTCGGACACCAGCACCATTCACTTCGCACTTCTC126
BaxCTGCAGAGGATGATTGCTGAGAGGAAGTCCAGTGTCCAGC155
Bcl-2CGACTTTGCAGAGATGTCCACATCCACAGAGCGATGTTGT117
β-actinCCACAGCTGAGAGGGAAATCATCCTCTTCCTCCCTGGAGA100
TUNEL analysis

The testicular cell apoptosis in the testes was examined by TUNEL using the In Situ Cell Apoptosis Detection Kit from Wuhan Boster Biological Engineering Co., Ltd (Wuhan, China), according to the manufacturer's instructions. At least 100 seminiferous tubules randomly selected from five sections (5 µm) of individual group testis were examined, and the numbers of TUNEL positive and TUNEL-negative cells were recorded, which were performed by investigators in a blinded fashion. This implies that all of these were determined by a single investigator who was unaware of the experimental groups. Data were expressed as apoptosis index (AI = [Number of positive cells/total cells] × 100) of apoptotic germ cells.

RT-PCR analysis

Total RNA was extracted from mice testicular tissues using Trizol reagent according to instructions provided by the manufacturer (Invitrogen, Carlsbad, CA). cDNA was synthesized by RT kit (Fermentas, USA). Primer was designed and synthesized by Shanghai Sangon Biological Engineering Technology and Services Co., Ltd (Shanghai, China), and the sequences of the primers used in these studies are shown in Table 1. The RT-PCR exponential phase was determined on 25–30 cycles to allow semi-quantitative comparisons among cDNAs developed from identical reactions. Each PCR involved a 94°C, 5 min initial denaturation step followed by 25 cycles (for Bcl-2) at 94°C for 30 s, 62°C for 30 s and 72°C for 30 s, 27 cycles (for Bax) at 94°C for 30 s, 52°C for 40 s and 72°C for 40 s, 24 cycles (for β-actin) at 94°C for 30 s, 55°C for 10 s and 72°C for 30 s, then 72°C, 10 min extension step. Finally, the amplification products were separated by agarose gel electrophoresis (2.0%), stained with ethidium-bromide, and the bands were analysed by Labworks imaging acquisition and analysis software (SYNGNE, England).

Immunohistochemical staining analysis

Paraffin embedded testis tissues of all the control and treatment groups were cut into 5 µm thick sections, placed on poly-l-lysine coated slides, deparaffinized in xylene and rehydrated with graded alcohol. The testis sections were incubated with citrate buffer (pH 6.0) at 95–100°C for 5 min in water bath for antigen retrieval. After cooling, non-specific binding was blocked by incubating the sections with 5% BSA for 20 min at room temperature. Slides were incubated with rabbit anti-Bax or rabbit anti-Bcl2 primary antibody from Wuhan Boster Biological Engineering Co., Ltd (Wuhan, China), diluted at 1:100 in PBS (pH 7.4) overnight at 4°C in a humidified chamber. After washing the slides in PBS, sections were incubated with polyvalent biotinylated goat anti-rabbit secondary antibody diluted at 1:2000 at room temperature for 20 min, followed by incubation with streptavidin peroxidase for 20 min. Subsequently, 3, 3-diaminobenzidene was applied as chromogen for colour development. The sections were finally counterstained with hematoxylin for 2 min, dehydrated, cleared in xylene and fixed in mounting media. At least five random fields of each section were examined, and semi-quantitative evaluations were assessed by a reader who was blinded to the animals’ treatment status using a Photo and Image Autoanalysis System.

Statistical analysis

All quantitative data derived from this study were analysed statistically. The results were expressed as mean ± standard deviation (SD). Database was set up with SPSS 11.5 software package (SPSS Inc., Chicago, IL). Differences among groups were analysed by one-way analysis of variance. Post hoc testing was performed for inter-group comparisons using the least significant difference test. Resulting P values less than 0.05 were regarded as statistically significant.

RESULTS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIAL AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. CONCLUSION
  8. Acknowledgement
  9. Conflict of Interest
  10. REFERENCES

Composition of the total flavonoids

Fig. 1 showed the HPLC-ELSD chromatographic fingerprint of the TFE sample. In the chromatographic fingerprint, 11 chromatogram peaks were marked. By using the HPLC-UV-ESI-TOF-MS system, five peaks among them were identified according to compound molecular weight data. Peaks numbered 3–7 represented Hexandraside F, Epimedin A, Epimedin B, Epimedin C and Icariin, respectively; the other six peaks were unidentified. In our present extraction and purification method, the content of TFE detected by HPLC-ELSD analysis was 89.58%, and their chemical structures were shown in Fig. 1.

image

Figure 1. The representative HPLC-ELSD chromatographic fingerprint and composition of the TFE. Peaks numbered 3–7, respectively, represented Hexandraside F, Epimedin A, Epimedin B, Epimedin C and Icariin, respectively.

Download figure to PowerPoint

Effects of TFE on testicular and epididymal weights and sperm parameters

The testicular and epididymal weights and sperm parameters were used to monitor the damage of male reproductive system. Before experiment, the body weights were not significantly different among the control group, CP-treated group and two TFE groups (data not shown). However, in our present study, there was a significant decrease in body weight, testicular and epididymal weights in the CP-treated mice relative to the control group (P < 0.05, respectively). TFE (200 and 400 mg/kg) might remarkably increase body weight by 10.8% and 12.0% (P < 0.05, respectively), testicular weight by 21.6% and 28.4% (P < 0.05) and epididymal weight by 11.5% (P < 0.05) and 26.9% (P < 0.05) compared with the CP-treated group. Nevertheless, by comparing the growth of body weight, testicular and epididymal weights of each animal, we found that although the increasing trends of body weight, testicular and epididymal weights of each animal were basically identical under TFE treatment, the velocity of body weight was more rapid than that of testis and epididymis, and this was the same as the change tendency in the control group, which finally made testicular and epididymal indexes not to exhibit statistical difference among the control group and two TFE groups compared with the CP-treated group (P > 0.05, respectively) (Table 2).

Table 2. Effects of TFE on testicular and epididymal weights and sperm parameters in the experiment mice
GroupsBody weight(g)Testicular weight(g)Testicular index(mg/g)Epididymal weight(g)Epididymal index(mg/g)Sperm count (×106/ml)Sperm motility (%)
  • Control, normal saline; CP, CP, 50 mg/kg; TFE (200 mg/kg) + CP, CP, 50 mg/kg + TFE, 200 mg/kg; TFE (400 mg/kg) + CP, CP, 50 mg/kg + TFE, 400 mg/kg. Data are shown as the mean ± SD (n = 10).

  • #

    P < 0.05,

  • ##

    P < 0.01 compared to the control group;

  • *

    P < 0.05,

  • **

    P < 0.01 compared to the CP-treated group.

Control25.20 ± 1.130.110 ± 0.0074.13 ± 0.1370.032 ± 0.0031.26 ± 0.16293.35 ± 9.0868.47 ± 7.62
CP (50 mg/kg)24.31 ± 1.45 #0.074 ± 0.009 #3.11 ± 0.3150.026 ± 0.003 #1.14 ± 0.20127.26 ± 4.84 ##38.82 ± 9.61 ##
TFE(200 mg/kg) + CP26.94 ± 2.06 *0.090 ± 0.013 *3.33 ± 0.1520.029 ± 0.001 *1.16 ± 0.06849.53 ± 17.37 *57.13 ± 11.21**
TFE(400 mg/kg) + CP27.23 ± 1.45 *0.095 ± 0.011*3.41 ± 0.1970.033 ± 0.003 *1.21 ± 0.17267.68 ± 19.86 **62.62 ± 9.41 **

As for sperm parameters, there was a significant decrease in sperm count and motility in the CP-treated mice relative to the control group (P < 0.05 and P < 0.01, respectively). TFE (200 and 400 mg/kg) remarkably increased sperm count by 81.7% (P < 0.01) and 148.3% (P < 0.01), and sperm motility by 47.2% (P < 0.01) and 61.3% (P < 0.01) compared with the CP-treated group, and there was a dose–effect relationship between the two TFE-treated groups (Table 2).

Effects of TFE on the contents of MDA and activities of SOD, GPX in mice

Compromised male reproductive system function induced by CP is always associated with a state of oxidative stress in testicular tissues. Thus, the activities of the redox system were measured in testes. Unusually changed activities of oxidant and antioxidant enzymens and the contents were found in the CP-treated group. Relative to the control group, decreased antioxidant activity was found in the reduced activities of SOD (20.5%, P < 0.05), GPX (40.5%, P < 0.05) and increased MDA production (2.1 times, P < 0.05), respectively, in the CP-treated mice. TFE (200 and 400 mg/kg) markedly attenuated all abnormalities of oxidative stress (P < 0.05, respectively) compared with the CP-treated mice (Table 3).

Table 3. Effects of TFE on antioxidant assay in the testicular tissue of the experimental mice
GroupsSOD(U/mg protein)GPX (nmol/mg protein)MDA (nmol/mg protein)
  • Control, normal saline; CP, CP, 50 mg/kg; TFE (200 mg/kg) + CP, CP, 50 mg/kg + TFE, 200 mg/kg; TFE (400 mg/kg) + CP, CP, 50 mg/kg + TFE, 400 mg/kg. Data are shown as the mean ± SD (n = 10).

  • #

    P < 0.05,

  • ##

    P < 0.01 compared to the control group;

  • *

    P < 0.05,

  • **

    P < 0.01 compared to the CP-treated group.

Control77.19 ± 14.3363.98 ± 18.150.19 ± 0.04
CP(50 mg/kg)61.40 ± 7.28 #38.1 ± 8.28 #0.59 ± 0.18 #
TFE(200 mg/kg) + CP73.51 ± 8.2951.61 ± 18.950.37 ± 0.08 *
TFE(400 mg/kg) + CP76.99 ± 14.45 *60.30 ± 12.02 *0.23 ± 0.06 *

Effects of TFE on testicular histopathological changes and ultrastructural observation

Under the light microscope, the slides of histologic pathology demonstrated that the testes of control mice kept normal the thickness of seminiferous epithelium layer, number of spermatogenic cells and interstitial cells (Fig. 2.Aa). Compared with the control group, testicular tissues from CP-treated mice showed seminiferous epithelium thinned, arrayed loosely and disorderedly; spermatogenic cells reduced, shed and layers lessened; and interstitial tissue edema and interstitial cells reduced (Fig. 2.Ab). TFE (200 and 400 mg/kg) might significantly reverse the abovementioned abnormal changes (Fig. 2.Ac–d).

image

Figure 2. The representative photomicrographs and ultrastructure of mice testis (lesion site labeled with green arrow heads). (A) Photomicrographs with hematoxylin and eosin; (B) Ultrastructure on transmission electron microscope. a, Control, normal saline; b, CP, CP, 50 mg/kg; c, TFE (200 mg/kg) + CP, CP, 50 mg/kg + TFE, 200 mg/kg; d, TFE (400 mg/kg) + CP, CP, 50 mg/kg + TFE, 400 mg/kg. This figure is available in colour online at wileyonlinelibrary.com./journal/ptr

Download figure to PowerPoint

Structural observation using transmission electron microscopy was performed. Testicular germ cells in the control group revealed normal structure of seminiferous epithelium, mitochondria and amounts of lysosome, and the aggregates of heterochromatin around the nuclear membrane and the shrinkage of nucleus were not observed (Fig. 2.Ba). In the CP-treated group, the transmission electron microscopy result showed that the ultrastructure of all kinds of testicular germ cells showed various abnormal changes such as karyopycnosis, broadening of nucleoplasmic space, shrinking of nuclear membrane, chromatin aggregation, intracytoplasmic vacuolar degeneration, mitochondrial swelling, increasing of lysosome number and alveoli expansion of smooth endoplasmic reticulum and so on (Fig. 2.Bb). The ultrastructure abnormal changes of the testicular germ cells were obviously recovered in TFE (200 and 400 mg/kg) groups (Fig. 2.Bcd), and as the dose of TFE increased, their improvement became more and more strong.

Effects of TFE on mRNA expressions of SOD1, SOD2, SOD3 and GPX1 in mice testicular tissues

In order to further confirm oxidative stress associated with compromised male reproductive system function, the SOD1, SOD2, SOD3 and GPX1 mRNA levels were detected by quantitative real-time PCR. As shown in Table 4, in the CP-treated group, except that SOD1 expression was not statistically significant (P > 0.05), the mRNA expression levels of SOD2, SOD3 and GPX1 significantly down-regulated by 45.4% (P < 0.05), 61.6% (P < 0.01) and 53.9% (P < 0.01), respectively, compared with the control group. When treated with TFE (200 and 400 mg/kg), these down-regulated tendencies of the SOD2, SOD3 and GPX1 were remarkably reversed compared with the CP-treated group, especially of SOD3 and GPX1 (P < 0.01, respectively) (Table 4). The present results of the quantitative real-time PCR studies provided effectively supportive evidence for the frontal testicular tissue SOD and GPX biochemical analyses (Table 3).

Table 4. Effects of TFE on mRNA expressions of SOD1, SOD2, SOD3 and GPX1 in mice testicular tissues
GroupsSOD1SOD2SOD3GPX1
  • Control, normal saline; CP, CP, 50 mg/kg; TFE (200 mg/kg) + CP, CP, 50 mg/kg + TFE, 200 mg/kg; TFE (400 mg/kg) + CP, CP, 50 mg/kg + TFE, 400 mg/kg. Data are shown as the mean ± SD (n = 4).

  • #

    P < 0.05,

  • ##

    P < 0.01 compared to the control group;

  • *

    P < 0.05,

  • **

    P < 0.01 compared to the CP-treated group.

Control1.17 ± 0.191.83 ± 0.572.58 ± 0.322.21 ± 0.28
CP (50 mg/kg)0.87 ± 0.261.00 ± 0.24 #0.99 ± 0.23 ##1.02 ± 0.33 ##
TFE(200 mg/kg) + CP0.98 ± 0.211.18 ± 0.432.45 ± 0.21 **1.97 ± 0.24 **
TFE(400 mg/kg) + CP1.00 ± 0.211.31 ± 0.112.51 ± 0.19 **2.13 ± 0.31 **

Effects of TFE on spermatogenic cell apoptosis

TUNEL assay was performed to analyse the CP-induced spermatogenic cell apoptosis. As shown in Fig. 3, the percentage of TUNEL positive cells in the CP-treated group was significantly increased by 280.0% (P < 0.01) compared with the control group. When treated with TFE (200 and 400 mg/kg), there was a remarkable decrease in apoptotic indexes by 44.7% and 57.9% compared with the CP-treated group (P < 0.05 and P < 0.01, respectively).

image

Figure 3. Abnormal spermatogenic cell apoptosis was found in the CP-treated mice and remarkably restored by TFE (200 and 400 mg/kg). (A) The representative spermatogenic cell apoptosis in the testes by TUNEL. (B) The spermatogenic cell apoptotic index. a, Control, normal saline; b, CP, CP, 50 mg/kg; c, TFE (200 mg/kg) + CP, CP, 50 mg/kg + TFE, 200 mg/kg; d, TFE (400 mg/kg) + CP, CP, 50 mg/kg + TFE, 400 mg/kg. Data are shown as the mean ± SD (n = 6). #P < 0.05, ## P < 0.01 compared with the control group, *P < 0.05, **P < 0.01 compared with the CP-treated group. This figure is available in colour online at wileyonlinelibrary.com./journal/ptr

Download figure to PowerPoint

Effects of TFE on Bax and Bcl-2 mRNA and protein levels

To investigate whether TFE can modulate the expression of the Bcl-2 family, we had studied the Bcl-2, Bax mRNA levels and the ratio of Bcl-2 to Bax by RT-PCR, and Bcl-2, Bax protein levels by immunohistochemistry. Through mRNA level analyzing, we found that the mRNA expression of Bcl-2, in the CP-treated group, significantly reduced by 35.4% (P < 0.01), but the Bax mRNA remarkably up-regulated by 49.21% (P < 0.01), and Bcl-2/Bax ratio appeared remarkably decreased by 56.7% (P < 0.01) compared with the control group (Fig. 4 A–C). In contrast, TFE (200 and 400 mg/kg) could significantly increase Bcl-2 expression and decrease Bax expression (P < 0.05 and P < 0.01, respectively), so finally, resulting in an elevation Bcl-2/Bax ratio (P < 0.01) compared with the CP-treated group (Fig. 4 A–C). With the dose of TFE progressively increasing, all of these changes became much stronger. According to the protein analysis, we also discovered that the protein expression of Bcl-2, in the CP-treated group, significantly reduced by 67.9% (P < 0.01), but the Bax protein remarkably up-regulated by 415.2% (P < 0.01), and Bcl-2/Bax ratio appeared remarkably decreased by 93.9%(P < 0.01) compared with the control group (Fig. 4 D–G); TFE (200 and 400 mg/kg) could significantly increase Bcl-2 expression and decrease Bax expression (P < 0.05 and P < 0.01, respectively), which resulted in an elevation Bcl-2/Bax ratio (P < 0.01) compared with the CP-treated group (Fig. 4 D–G), and when the dose of TFE increased, their improvement became more and more strong.

image

Figure 4. Abnormal mRNA and protein expressions of the Bcl-2 family were found in the CP-treated mice and remarkably improved by TFE (200 and 400 mg/kg). (A) The representative Bcl-2 and Bax mRNA electrophoretic pictures; (B) Bcl-2 and Bax mRNA expressions by RT-PCR; (C) Ratio of Bcl-2 to Bax mRNA; (D) The representative Bcl-2 immunohistochemical picture; (E) The representative Bax immunohistochemical picture; (F) Bcl-2 and Bax protein expressions by immunohistochemistry; (G) Ratio of Bcl-2 to Bax protein. a, Control, normal saline; b, CP, CP, 50 mg/kg; c, TFE (200 mg/kg) + CP, CP, 50 mg/kg + TFE, 200 mg/kg; d, TFE (400 mg/kg) + CP, CP, 50 mg/kg + TFE, 400 mg/kg. Data are shown as the mean ± SD (n = 6 or 4). #P < 0.05, ## P < 0.01 compared with the control group, *P < 0.05, **P < 0.01 compared with the CP-treated group. This figure is available in colour online at wileyonlinelibrary.com./journal/ptr

Download figure to PowerPoint

DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIAL AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. CONCLUSION
  8. Acknowledgement
  9. Conflict of Interest
  10. REFERENCES

Effective cancer chemotherapy and immunosuppressive therapy with CP is severely limited due to its unwanted reproductive toxicity such as diminishing sperm counts and an absence of spermatogenic cycles in their testicular tissue (Kim et al., 2012), decreasing the weight of the reproductive organs, and impairing fertility and unwanted reproductive toxicity that has been demonstrated in both men and women treated with CP, and in various animal species (Fraiser et al., 1991; Trasler et al., 1986). It is usually believed that acrolein and mustard which generated from CP metabolism in body are the most common agents implicated in the reproductive toxicity, because they can potentially result in DNA–DNA or DNA–protein cross-links and single-strand fragmentation by alkylation (Tripathi and Jena, 2008). More importantly, increased lipid peroxidation is one of the toxic manifestations in the testis following CP administration, and generated acrolein also is the main source of ROS (Türk et al., 2010). Under physiological conditions, small amounts of ROS are needed for fertilization, acrosome reaction and capacitation, which remain stable balance with scavenging antioxidants in normal tissues and organ (Selvakumar et al., 2006a; Sikka, 2001). When the generation of ROS breaks antioxidant defenses or exceeds the ability of the antioxidant defense system, oxidative damage occurs. In addition, the sperm plasma membrane is abundant of polyunsaturated fatty acids, and sperm cytoplasm is scare of scavenging enzymes, so spermatozoa are particularly susceptible to the attack from excessive ROS.

Due to oxidative stress occurs mainly increased production of ROS such as O2•–, OH and other reactive species in the application of CP, which not only has its own toxicity, but also produces other oxygen free radicals through a series of reactions, and they immediately result in elevated MDA as a by-product of lipid peroxidation. Therefore, removing O2•– and · OH and other reactive species is probably one of the most effective defense mechanisms against CP-induced reproductive toxicity. In the present study, we found that CP induced oxidative stress as evident from significant increase in MDA and decrease in GSH and SOD levels in the testis of mice. TFE could significantly restore GSH and SOD levels, as well as decrease the formation of MDA. These findings displayed that TFE possessed antioxidative properties against CP-induced oxidative damage; it was similar to the result of our previous result (Zhang et al., 2010).

SOD is a very important enzyme, whose increased activity has been reported to be beneficial to the cellular capability of scavenging/quenching free radicals (Qin et al., 2009). Cumulative evidences suggest that SOD family, SOD1, SOD2 and SOD3, are the first and most important line of antioxidant enzyme defense systems against ROS and particularly O2•–. SOD2, which is encoded on the nuclear genome but localizes to mitochondria via a mitochondrial targeting sequence, makes up >70% of the SOD activity in the heart and >90% of the activity in cardiac myocytes. The remaining SOD consists primarily of SOD1, which is localized in the cytosol. SOD3 is also a Cu- and Zn-containing enzyme encoded by a distinct gene. As the name implies, SOD3 localizes to the extracellular and intravascular spaces and is the least prevalent isoform in the myocardium (Li et al., 2010). Under physiological conditions, superoxide anions are scavenged by SOD1, SOD2 and SOD3 producing a relatively stable ROS H2O2 (Taniyama and Griendling, 2003). MDA is the degradation product of the oxygen-derived free radicals, and lipid oxidation, which increased MDA content, may contribute to increased generation of free radicals and/or decreased activities of antioxidant system (Zhou et al., 2008). In our present study, TFE might not only increase the testicular tissue levels of SOD, but also decrease MDA production. This implied that TFE might have effects on endogenous antioxidants or oxidative stress or both. One of the possible explanations is that elevated activities of SOD scavenged excessive ROS and attenuated the lipid peroxidation (Qin et al., 2009). In order to further study on the SOD changes in testicular tissue, SOD1, SOD2 and SOD3 mRNA levels were detected by real-time PCR in our study. The experimental results indicated that the mRNA expression levels of SOD2 and SOD3 markedly decreased in the CP-treated group, When pretreated with TFE, these down-regulated tendencies of the SOD2 and SOD3 were efficiently reversed, especially to SOD3, which was in line with the previous reports (Miao and St Clair, 2009; Laurila et al., 2009).

In addition, GPX is crucial in the balance between two-step enzymatic antioxidant reaction limiting damage to tissues and cells, which is implicated in the first step of SOD transferring superoxide anion to hydrogen peroxide and the second step of GPX transferring hydrogen peroxide to water (De Haan et al., 2003). Overwhelming evidences generated from GPX1 knockout mice have concluded that GPX1 plays the primary protective role in coping with oxidative injury and death mediated by ROS (Lei et al., 2007). In the present study, we found that CP remarkably inhibited GPX1 mRNA expression, and TFE might effectively reverse them. These results suggested that TFE could promote GPX1 mRNA expression to improved CP-induced oxidative damage in testes.

In the CP-induced oxidative injury model, the overgeneration and accumulation of ROS directly bring about damage to spermatogenic and interstitial cells in testis, which plays an important role in the pathogenesis of male reproductive toxicity induced by CP (Kim et al., 2012; Shathish et al., 2012). Evidences from experimental models and adult male patients treated with CP showed that spermatogenic and interstitial cells loss as a result of apoptosis is significant in treatment with CP and inevitably leads to reproductive system function reduction (Kim et al., 2012). In the process of apoptosis, the Bcl-2 family of proteins plays an important role. Oxidative stress can trigger the intrinsic mitochondrial apoptosis pathway, in which the pro-apoptotic Bax protein is activated and promotes outer mitochondrial membrane (OMM) permeabilization and leads to cell apoptosis (Cheng et al., 2001; Degli Esposti and Dive, 2003). However, anti-apoptotic Bcl-2 protein resides on the OMM and prevents apoptosis by inhibiting the activation of the pro-apoptotic family members Bax (Lindsay et al., 2011). Hence, elevated Bcl-2 favours extended survival of cells, and increased levels of Bax accelerate cell death (Zinkel et al., 2006). Usually, the balance between the up and down-regulations of the members of Bax and Bcl-2 family proteins determines the fate of the cells either to undergo apoptosis or to survive in pathophysiology. In our study, increased Bax mRNA and protein expressions and decreased Bcl-2 mRNA and protein levels and ratio of Bcl-2 to Bax were found in CP-induced oxidative damage in mice testes, and it exhibited increased levels of apoptosis, which was in line with the previous report (Lindsay et al., 2011). After pretreatment with TFE, the aforesaid abnormal mRNA and protein expressions of Bcl-2 and Bax and ratio of Bcl-2 to Bax were significantly reversed compared with the CP-treated group, and when the dose of TFE increased, their effects became more stronger, which was in line with our sperm parameters and TUNEL experimental results.

Moreover, testicular tissue histology of CP-treated mice commendably indicated pathomorphological alterations. In our present study, histopathological evaluation revealed that TFE remarkably improved the abnormal morphological changes induced by CP and greatly reverted the microanatomy of the testis to normal. To our knowledge, under normal physiological conditions, the mitochondrion is the major source of ROS production in the spermatogenic and interstitial cells (Türk et al., 2010). It is also recognized that the disturbances in structure and function of eminiferous epithelium, mitochondria and amounts of lysosome are likely to be associated with increased ROS production and oxidative damage to the spermatogenic and interstitial cells in CP-induced oxidative damage in testes (Lei et al., 2007), and oxidative mitochondrial damage represents a direct cause of spermatogenic and interstitial cells death. In the present study, we found that the mitochondria in the CP-treated group was severely destroyed; on the contrary, TFE-treated groups showed regularly arranged sarcomere, and the mitochondria exhibited slights welling and mild vacuolization. These results also verified the foregoing hypothesis that TFE possessed the capacity to preserve the structural integrity of the spermatogenic and interstitial cells from the adverse effects of testicular oxidative damage induced by CP.

CONCLUSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIAL AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. CONCLUSION
  8. Acknowledgement
  9. Conflict of Interest
  10. REFERENCES

In this study, all of the experimental results demonstrated that TFE exerted beneficially protective effects on CP-induced male reproductive oxidative injury in mice. The primary mechanism of the protection could be that TFE might play an important role in forming sperm, repairing damaged testis and epididymis by directly scavenging ROS/free radicals and up-regulating the expression of antioxidant enzymes, especially of SOD3 and GPX1.

Acknowledgement

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIAL AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. CONCLUSION
  8. Acknowledgement
  9. Conflict of Interest
  10. REFERENCES

This study was supported by two common projects from National Natural Science Foundation of China (No: 30973928; 81173375).

Conflict of Interest

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIAL AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. CONCLUSION
  8. Acknowledgement
  9. Conflict of Interest
  10. REFERENCES

The authors have declared that there is no conflict of interest.

REFERENCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIAL AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. CONCLUSION
  8. Acknowledgement
  9. Conflict of Interest
  10. REFERENCES
  • Aguilar-Mahecha A, Hales BF, Robaire B. 2005. Effects of acute and chronic cyclophosphamide treatment on meiotic progression and the induction of DNA double-strand breaks in rat spermatocytes. Biol Reprod 72: 12971304.
  • Cheng EH, Wei MC, Weiler S, Flavell RA, Mak TW, Lindsten T, Korsmeyer SJ. 2001. Bcl-2, Bcl-X(L) sequester BH3 domain-only molecules preventing Bax-and Bak-mediated mitochondrial apoptosis. Mol Cell 8: 705711.
  • Das UB, Mallick M, Debnath JM, Ghosh D. 2002. Protective effect of ascorbic acid on cyclophosphamide-induced testicular gametogenic and androgenic disorders in male rats. Asian J Androl 4: 201207.
  • Degli Esposti M, Dive C. 2003. Mitochondrial membrane permeabilisation by Bax/Bak. Biochem Biophys Res Commun 304: 455461.
  • De Haan JB, Crack PJ, Flentjar N, Iannello RC, Hertzog PJ, Kola I. 2003. An imbalance in antioxidant defense affects cellular function: the pathophysiological consequences of a reduction in antioxidant defense in the glutathione peroxi- dase-1 (GPX1) knockout mouse. Redox Rep 8: 6979.
  • Elangovan N, Chiou TJ, Tzeng WF, Chu ST. 2006. Cyclophosphamide treatment causes impairment of sperm and its fertilizing ability in mice. Toxicology 222: 6070.
  • Fraiser LH, Kanekal S, Kehrer JP. 1991. Cyclophosphamide toxicity. Characterising and avoiding the problem. Drugs 42: 781795.
  • He HB, Xu J, Xu YQ, Zhang CC, Wang HW, He YM, Wang T, Yuan D. 2012. Cardioprotective effects of saponins from Panax japonicus on acute myocardial ischemia against oxidative stress-triggered damage and cardiac cell death in rats. J Ethnopharmacol 140: 7382.
  • Huang XL, Zhou YW, Wang W. 2005. Pharmacological research advances on total flavonoids of Epimedium. Chin Tradit Pat Med 27: 719721.
  • Kenney LB, Laufer MR, Grant FD, Grier H, Diller L. 2001. High risk of infertility and long term gonadal damage in males treated with high dose cyclophosphamide for sarcoma during childhood. Cancer 1991: 613621.
  • Kim W, Kim SH, Park SK, Chang MS. 2012. Astragalus membranaceus ameliorates reproductive toxicity induced by cyclophosphamide in male mice. Phytother Res 26:14181421.
  • Lei XG, Cheng WH, McClung JP. 2007. Metabolic regulation and function of glutathione peroxidase-1. Annu Rev Nutr 27: 4161.
  • Laurila JP, Laatikainen LE, Castellone MD, Laukkanen MO. 2009. SOD3 reduces inflammatory cell migration by regulating adhesion molecule and cytokine expression. PLoS One 4: e5786.
  • Li DM, Yin XF, Cai DW. 2006. Study on the specific chromatogram of the total flavones in Herba Epimedii by HPLC. Chin Hosp Pharm J 28:14731475.
  • Lindsay J, Esposti MD, Gilmore AP. 2011. Bcl-2 proteins and mitochondria- specificity in membrane targeting for death. Biochim Biophys Acta 1813: 532539.
  • Li YG, Ji DF, Zhong S. 2010. Saponins from Panax japonicus protect against alcohol-induced hepatic injury in mice by up-regulating the expression of GPX3, SOD1 and SOD3. Alcohol Alcohol 45: 320331.
  • Meng N, Kong K, Li SW. 2010. Advances in studies on chemical constituents and pharmaceutical activities in species of Epimedium. Acta Bot Boreal- Occident Sin 30: 10631073.
  • Miao L, St Clair DK. 2009. Regulation of superoxide dismutase genes: implications in diseases. Free Radic Biol Med 47: 344356.
  • Pendse S, Ginsburg E, Singh AK. 2004. Strategies for preservation of ovarian and testicular function after immunosuppression. Am J Kidney Dis 43: 772781.
  • Qin F, Liu YX, Zhao HW, Huang X, Ren P, Zhu ZY. 2009. Chinese medicinal formula Guan-Xin-Er-Hao protects the heart against oxidative stress induced by acute ischemic myocardial injuryin rats. Phytomedicine 16: 215221.
  • Selvakumar E, Prahalathan C, Sudharsan PT, Varalakshmi P. 2006a. Chemoprotective effect of lipoic acid against cyclophosphamide-induced changes in the rat sperm. Toxicology 217: 7178.
  • Selvakumar E, Prahalathan C, Sudharsan PT, Varalakshmi P. 2006b. Protective effect of lipoic acid on cyclophosphamide-induced testicular toxicity. Clin Chim Acta 367: 114119.
  • Shathish K, Reena D, Guruvayoorappan C. 2012. Chemoprotective effect of Decalepis hamiltonii against cyclophosphamide induced toxicity. J Exp Ther Oncol 9: 291301.
  • Sikka SC. 2001. Relative impact of oxidative stress on male reproductive function. Curr Med Chem 8: 851862.
  • State pharmacopoeia committee. 2010. Chin Trad Patent Med. I: 306309.
  • Taniyama Y, Griendling KK. 2003. Reactive oxygen species in the vasculature: molecular and cellular mechanisms. Hypertension 42: 10751081.
  • Trasler JM, Hales BF, Robaire B. 1986. Chronic low dose cyclophosphamide treatment of adult male rats: effect on fertility, pregnancy outcome and progeny. Biol Reprod 34: 275283.
  • Tripathi DN, Jena GB. 2008. Astaxanthin inhibits cytotoxic and genotoxic effects of cyclophosphamide in mice germ cells.Toxicology 248: 96103.
  • Tripathi DN, Jena GB. 2010. Astaxanthin intervention ameliorates cyclophosphamide- induced oxidative stress, DNA damage and early hepatocarcinogenesis in rat: role of Nrf2, p53, p38 and phase-II enzymes. Mutat Res 696: 6980.
  • Türk G, Ceribaşi AO, Sakin F, Sönmez M, Ateşşahin A. 2010. Antiperoxidative and anti-apoptotic effects of lycopene and ellagic acid on cyclophosphamide-induced testicular lipid peroxidation and apoptosis. Reprod Fertil Dev 22: 587596.
  • Zhang CC, Jia LL, Li SC, Xu YQ, Li YZ, Zeng X, Yuan D, He YM, Wang HW. 2010. Protective effect of total flavones of Folium Epimedii on spermatogenesis disturbance induced by cyclophosphamide in mice. Chin Trad Patent Med 32: 20522055.
  • Zhou R, Xu QB, Zheng P, Yan L, Zheng J, Dai GD. 2008. Cardioprotective effect of fluvastatin on isoproterenol-induced myocardial infarction in rat. Eur J Pharmacol 586: 244250.
  • Zinkel S, Gross A, Yang E. 2006. Bcl2 family in DNA damage and cell cycle control. Cell Death Differ 13: 13511359.