SEARCH

SEARCH BY CITATION

Keywords:

  • (−)-epigallocatechin-3-gallate;
  • TGF-β1;
  • extracellular matrix;
  • nasal polyp-derived fibroblast

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. CONCLUSIONS
  8. Acknowledgements
  9. REFERENCES

Nasal polyps are chronic inflammatory conditions characterized by myofibroblast differentiation and extracelluar matrix accumulation. The major catechin from green tea is (−)-epigallocatechin-3-gallate (EGCG), which has garnered attention for its potential to prevent oxidative stress-related diseases. The purpose of this study was twofold: (i) to determine the effect of EGCG on fibroblast differentiation into myofibroblasts and extracellular matrix accumulation in transforming growth factor (TGF)-β1-induced nasal polyp-derived fibroblasts (NPDFs) and (ii) to determine if the antioxidative effect of EGCG on reactive oxygen species (ROS) production in TGF-β1-induced NPDFs is involved in the aforementioned processes. TGF-β1-induced NPDFs were treated with or without EGCG. α-smooth muscle actin (α-SMA) and collagen type I mRNA were analyzed by reverse transcription-polymerase chain reaction. α-SMA protein was also detected using immunofluorescent staining. The amount of total soluble collagen was analyzed by Sircol collagen assay. ROS activity was measured by the nitroblue tetrazolium reduction assay and visualized by fluorescent microscopy. EGCG significantly inhibited expressions of α-SMA and collagen type I mRNA and reduced α-SMA and collagen protein levels at concentrations of 10–20 µg/mL. EGCG also inhibited TGF-β1-induced ROS production at the same concentrations. These results suggest the possibility that EGCG may be effective at inhibiting the development of nasal polyps through an anti-oxidant effect. Copyright © 2013 John Wiley & Sons, Ltd.


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. CONCLUSIONS
  8. Acknowledgements
  9. REFERENCES

Nasal polyps are a chronic inflammatory condition of the mucous membranes in the nose and paranasal sinuses. Nasal polyps, which cause nasal obstruction, rhinorrhea, loss of the sense of smell, headaches, and a reduced quality of life, are commonly encountered in otolaryngology clinics. The overall prevalence of nasal polyps in the general population ranges from 1% to 4% (Pawankar, 2003). However, the etiology and the system of formation of nasal polyps are still not fully elucidated, despite many studies.

The pleuripotential cytokine, transforming growth factor (TGF)-β1, is a key mediator in normal tissue repair and in the development of fibrosis. TGF-β1 directly stimulates the proliferation of fibroblasts and the phenotypic transformation of fibroblasts into myofibroblasts, which produces increased amounts of extracellular matrix (ECM), including fibronectin and collagen (Blobe et al., 2000). ECM accumulation has been proposed as one of the important factors in the pathogenesis of nasal polyps based on animal studies (Larsen et al., 1992; Norlander et al., 1996). It has also been shown that the number of myofibroblasts observed in nasal polyps and myofibroblast accumulation is induced by TGF-β1 (Wang et al., 1997). In our previous studies, natural substances, such as Berberine and Naringenin, have been shown to have inhibitory effects on TGF-β1-related nasal polyp pathways (Jung et al., 2013; Moon et al., 2013). In addition, we observed that TGF-β1 induces reactive oxygen species (ROS) production and ROS is required for the expression of α-smooth muscle actin (α-SMA) (a marker of myofibroblasts) and collagen production (Park et al., 2012).

Natural antioxidants, such as polyphenols from green tea extracts, have recently garnered considerable attention for preventing oxidative stress-related diseases, including cancers, cardiovascular diseases, neurologic diseases, degenerative diseases, and airway diseases (Lee et al., 2003; Trevisanato and Kim, 2000). The major and most active catechin from green tea is (−)-epigallocatechin-3-gallate (EGCG).

In this study, we hypothesized that the antioxidative effect of EGCG inhibits myofibroblast differentiation and collagen production in nasal polyp-derived fibroblasts (NPDFs). We provide novel data demonstrating the ability of EGCG to inhibit TGF-β1-induced nasal myofibroblast differentiation and collagen production.

MATERIALS AND METHODS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. CONCLUSIONS
  8. Acknowledgements
  9. REFERENCES
Reagents

Human recombinant TGF-β1 was obtained from R&D Systems (Minneapolis, MN, USA). EGCG and other reagents were purchased from Sigma (St. Louis, MO, USA), unless otherwise specified.

NPDF isolation and cell culture

To induce fibroblasts from nasal polyps, six patients (three females and three males; 33.2 ± 6.3 years of age) were recruited from the Department of Otorhinolaryngology at Korea University. All patients were non-smokers and had not been treated with oral anti-allergic agents for at least 2 months. Nasal polyps were acquired during surgery after obtaining written informed consent. The study was approved by the Korea University Medical Center Institutional Review Board.

Fibroblasts were isolated from surgical tissues by enzymatic digestion with collagenase (500 U/mL), hyaluronidase (30 U/mL), and DNAse (10 U/mL). Briefly, following 2 weeks of incubation with 5% CO2 at 37°C on culture plates, fibroblasts were detached with a 0.05% trypsin-EDTA solution (Invitrogen, Carlsbad, CA, USA). Cells were collected by centrifugation, washed twice, resuspended in Dulbecco's modified Eagle medium (DMEM; Invitrogen) supplemented with 10% fetal bovine serum and penicillin/streptomycin (5000 IU/mL), plated in a 30-mm2 tissue culture plate (Falcon, Becton Dickinson, Franklin Lakes, NJ, USA), and allowed to attached for 4 days. Non-adherent cells were removed by changing the medium. Passage-4 or −5 fibroblasts were used in experiments.

Cytotoxicity assay

The cytotoxic effect of flavonoids was evaluated by the 3-(4, 5-dimethylthiazol-2yl)-2, 5-diphenyl-2H-tetrazolium bromide (MTT; Sigma) method. In a 96-well microplate, NPDFs (5 × 103 cells/well) were cultivated in DMEM and supplemented as described above. Effects of EGCG were evaluated at various concentrations (10–80 μM) for 48 h at 37°C with a 95% humidified atmosphere and 5% CO2. After this period, the cells were incubated with MTT for 4 h, and the reaction was interrupted by the addition of acidified isopropanol. A fluorescence microplate reader (F2000; Hitachi Ltd., Tokyo, Japan) was used to determine the results (570 nm). All assays were carried out in triplicate.

Reverse transcription - polymerase chain reaction (RT-PCR)

NPDFs were pre-treated for 2 h with EGCG (10–40 μM) 24 h before TGF-β1 (5 ng/mL) stimulation. Total RNA was isolated according to the manufacturer's recommendations using Trizol reagent (Invitrogen). The concentration of total RNA was determined by UV spectrophotometry (Beckman Instruments, Fullerton, CA, USA). Two micrograms of RNA were reverse transcribed using MMLV reverse transcriptase (Invitrogen) according to the manufacturer's protocol, in a 50-μL volume containing 0.5 µg oligo(dT) primer, 10 mM dNTPs, and buffers supplied by the manufacturer. PCR was performed using the following primers: α-SMA (sense sequence, 5’- GGTGCTGTCTCTCTATGCCTCTGGA -3’; anti-sense sequence, 5’- CCCATCAGGCAACTCGATACTCTTC -3’; 321 bp); collagen type I (sense sequence, CAT CAC CTA CCA CTG CAA GAA C; anti-sense sequence, ACG TCG AAG CCG AAT TCC, 278bp); and glyceraldehyde-3-phosphate dehydrogenase (GAPDH; sense sequence, 5’- GTGGATATTGTTGCCATCAATGACC - 3’; anti-sense sequence, 5’- GCCCCAGCCTTCTTCATGGTGGT -3’; 270 bp). All primers were purchased from Bioneer (Daejeon, Korea). Amplification reactions were performed as follows: initial 5-min denaturing step at 94°C, followed by 30 cycles at 94°C for 45 s; 55–65°C for 45 s; 72°C for 45 s; and a final extension step at 74°C for 5 min. All reactions were performed in a 20-μLvolume. Products were electrophoresed on a 1.5% agarose gel and visualized by staining with ethidium bromide. The gels were captured and visualized using the Molecular Imager ChemiDoc XRS + (Bio-Rad, Hercules, CA, USA).

Immunofluorescent staining of α-SMA protein

NPDFs were plated on coverslips, and fibroblasts were pre-treated with EGCG for 2 h before TGF-β1 stimulation for 48 h. Then, the cells were fixed in phosphate buffered saline (PBS) containing 4% paraformaldehyde for 30 min, blocked with 3% bovine serum albumin, incubated with an anti-α-SMA antibody (1: 200) for 2 h, and washed three times with PBS for 5 min. The cells were then incubated in goat anti-mouse IgG Alexa Fluor 488 (Invitrogen) at a dilution of 1:200 for 1 h. The cells were then mounted in Vectashield (Vector Laboratories, Burlingame, CA, USA) with 4',6-diamidino-2-phenylindole. The cells were visualized on an immunofluorescence microscope (IX71; Olympus, Tokyo, Japan) under identical settings.

Sircol soluble collagen assay

The Sircol Collagen Assay (Biocolor Ltd., Belfast, UK) is a quantitative dye-binding method designed for the analysis of acid-soluble collagens extracted from mammalian tissues and collagens released into culture medium during in vitro culture. NPDFs were pre-treated with EGCG for 2 h before TGF-β1 stimulation for 24 h. The assay was performed according to the manufacturer's recommendations.

Measurement of ROS

Total ROS production was evaluated by the nitroblue tetrazolium (NBT) reduction test, which involves the use of a yellow, water-soluble powder that becomes blue and insoluble upon reduction. NBT (10 mg/mL) was prepared in PBS by adding 10 mg of NBT powder (Sigma) to 1 mL of PBS, and stirring it at room temperature for 1 h. In a 24-well plate, fibroblasts were pre-treated with EGCG for 2 h and stimulated with TGF-β1 (5 ng/mL) for 12 h. Then, 25 μL of NBT was added, and the cells were incubated for 1 h at 37°C. The reaction was stopped by adding 440 μL of 1 M KOH. The supernatant was removed, and 560 μL of dimethyl sulfoxide was added to each well. The plates were placed on a sonicator for 10 min to accelerate the extraction of formazan. Finally, the optical densities were recorded using a UV spectrophotometer (Beckman Coulter, Fullerton, CA, USA).

The production of intracellular ROS was also determined by fluorescent microscopy using a fluorescent probe (2', 7'-dichlorofluorescein diacetate [DCFH-DA]; Molecular Probes, Inc., Eugene, OR, USA). The stock DCFH-DA (2 mM) was prepared in absolute ethanol and kept at −70°C in the dark. Cells were incubated with 20 μM DCFH-DA for 1 h, then with maximum concentrations of EGCG for another 2 h prior to treatment with TGF-β1 for 12 h. After washing with PBS, cells were examined using a fluorescent microscope (Olympus).

Statistical analysis

The statistical significance of the difference between the control and experimental data was analyzed using Wilcoxon's rank-sum test. A p-value <0.05 was accepted as statistically significant.

RESULTS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. CONCLUSIONS
  8. Acknowledgements
  9. REFERENCES

The effect of EGCG on α-SMA expression in TGF-β1-induced NPDFs

To evaluate the cytotoxicity of EGCG on NPDFs, the MTT assay was used. EGCG did not exhibit a cytotoxic effect for 48 h at concentrations as high as 80 μM (Fig. 1). Next, the cells were pre-treated with EGCG (10–40 μM) for 2 h and stimulated by TGF-β1 for 24 h. The level of α-SMA mRNA expression was determined by RT-PCR. TGF-β1 significantly increased the level of α-SMA mRNA expression. Pre-treatment with EGCG significantly inhibited TGF-β1-induced α-SMA mRNA expression (Fig. 2A).

image

Figure 1. Cytotoxicity test using 3-(4, 5-dimethylthiazol-2yl)-2, 5-diphenyl-2H-tetrazolium bromide assay at various concentrations of epigallocatechin-3-gallate in nasal polyp-derived fibroblasts.

Download figure to PowerPoint

image

Figure 2. Effects of epigallocatechin-3-gallate on expression of α-SMA mRNA in TGF-β1-induced nasal polyp-derived fibroblasts. (A) RT-PCR and densitometric analysis. (B) Immunofluorescent microphotography (scale bar = 100 µm). GAPDH mRNA is shown as an internal control, * P < 0.05 vs. control. ** P < 0.01 vs. control. This figure is available in colour online at wileyonlinelibrary.com/journal/ptr.

Download figure to PowerPoint

To determine the inhibitory effect of EGCG in TGF-β1-induced myofibroblast differentiation (α-SMA protein), we pre-treated cells with EGCG for 2 h and stimulated the cells with TGF-β1 for 48 h. The addition of EGCG decreased the number of α-SMA protein-positive cells (Fig. 2B).

The effect of EGCG on collagen production in TGF-β1-induced NPDFs

To determine the inhibitory effect of EGCG in TGF-β1-induced collagen type I mRNA expression, we pre-treated cells with EGCG for 2 h before stimulating the cells with TGF-β1 for 24 h. The expression of collagen type I mRNA increased by stimulation with TGF-β1 and notably decreased by pre-treatment with EGCG (Fig. 3A).

image

Figure 3. Effects of epigallocatechin-3-gallate on the expression of collagen in TGF-β1-induced nasal polyp-derived fibroblasts. (A) Expression of collagen type I mRNA determined by RT-PCR. (B) Total soluble collagen production determined by a Sircol collagen dye-binding assay. * P < 0.05 vs. TGF-β1 only, ** P < 0.01 vs. TGF-β1 only.

Download figure to PowerPoint

To determine the inhibitory effect of EGCG in TGF-β1-induced soluble collagen production, we pre-treated cells with EGCG for 2 h and stimulated the cells with TGF-β1 for 48 h. The addition of EGCG noticeably reduced TGF-β1-induced soluble collagen production (Fig. 3B).

The effect of EGCG on ROS generation in TGF-β1-induced NPDFs

In our previous study, we showed that ROS released in response to TGF-β1 are involved in α-SMA expression and collagen production in NPDFs.6 To evaluate the effect of EGCG in the inhibition of TGF-β1-induced ROS production, we pre-treated cells with EGCG for 2 h before stimulating the cells with TGF-β1 for 12 h, and then determined ROS production. Pre-treatment with EGCG decreased the production of TGF-β1-induced ROS (Fig. 4A).

image

Figure 4. Effect of epigallocatechin-3-gallate on intracellular reactive oxygen species (ROS) production in TGF-β1-induced nasal polyp-derived fibroblasts. (A) Total ROS were measured by nitroblue tetrazolium reduction after TGF-β1 treatment. (B) The production of intracellular ROS was also determined by fluorescent microscopy using a fluorescent probe, 2', 7'-dichlorofluorescein diacetate (scale bar = 100 µm). * P < 0.05 vs. TGF-β1 only, ** P < 0.01 vs. TGF-β1 only. This figure is available in colour online at wileyonlinelibrary.com/journal/ptr.

Download figure to PowerPoint

The anti-oxidant effect of EGCG in TGF-β1-induced intracellular ROS production was also confirmed by fluorescent microscopy. The pre-treatment with EGCG inhibited TGF-β1-induced intracellular ROS production compared with TGF-β1 treatment alone (Fig. 4B).

DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. CONCLUSIONS
  8. Acknowledgements
  9. REFERENCES

In this study, we showed that TGF-β1 up-regulates α-SMA expression and collagen production in NPDFs, with up-regulation of ROS production. The EGCG inhibited TGF-β1-induced α-SMA expression and collagen production. EGCG also inhibited ROS production. These findings support the notion that EGCG has antioxidant effects that are critical for the modulation of myofibroblast differentiation and ECM accumulation, which are involved in nasal polyp pathogenesis.

Although the etiology of the diseases and the pathophysiologic mechanisms leading to nasal polyp formation are poorly understood, a variety of studies suggest that the differentiation of fibroblasts into myofibroblasts and ECM accumulation is a key process in nasal polyp formation (Desmouliere et al., 1993). Myofibroblasts can be transdifferentiated from fibroblasts in vitro by exposure to the fibrogenic cytokine, TGF-β1 (Desmouliere et al., 1993). TGF-β1 has been shown to be a potent stimulus for myofibroblast differentiation and induction of pulmonary fibrosis in vivo (Kolb et al., 2002). Being strongly expressed in nasal polyp tissues, TGF-β1 is thought to be involved in the structural modifications that characterize this disease (Little et al., 2008).

In a previous study of primary human cardiac fibroblasts, it was shown that exposure to TGF-β1 caused collagen production, an increase in α-SMA, and a phenotypic conversion of fibroblasts to myofibroblasts, which is mediated by ROS derived from NAD(P)H oxidases (Cucoranu et al., 2005). In nasal polyps, TGF-β1 also stimulates proliferation of NPDFs and myofibroblast differentiation (Serpero et al., 2006). In the current study, TGF-β1 significantly increased α-SMA expression in NPDFs. Moreover, the production of ROS was up-regulated by TGF-β1. We speculated that ROS is required for differentiation of fibroblasts into myofibroblasts in nasal polyps, as shown in other studies (Cucoranu et al., 2005; Koli et al., 2008). We showed that TGF-β1 significantly increased the expression of α-SMA, as well as the production of collagen in NPDFs. Moreover, the production of ROS was up-regulated by TGF-β1. These results suggest that TGF-β1 plays an important role in the pathogenesis of nasal polyps with increased production of ROS.

Tea is one of the most popular beverages worldwide. The polyphenols, especially the catechins, are the most significant group of flavanols. Among theses polyphenols, EGCG is the major component of green tea. Several lines of evidence have confirmed an association between green tea consumption and prevention of cancer development and atherosclerosis progression (Gao et al., 1994; Tijburg et al., 1997; Yang and Wang, 1993). An antioxidative function has been proposed as one of the mechanisms for the anti-tumor and anti-atherogenic effects of catechins (da Silva et al., 2000; Zhang et al., 2000). In a study of vascular NADPH oxidase, EGCG reduced the expression of NADPH oxidase and ROS production in human umbilical vein endothelial cells (Ahn et al., 2010). NADPH oxidase is also considered a major source of ROS in TGF-β1 induced NPDFs. Our previous study indicated that NADPH oxidase and its product (ROS) play an important role in TGF-β1-induced phenotypic transformation to myofibroblasts (data not shown) (Park et al., 2012). In addition, Lin et al. suggested that EGCG inhibits nasal polyp development by inhibiting VEGF production in NPDFs (Lin et al., 2008). They focused on the mechanism that NPDFs produce VEGF to promote angiogenesis under hypoxia. Our study is different in that EGCG inhibited ROS production and decreased myofibroblast differentiation and collagen production instead of decreasing angiogenesis by blocking VEGF.

In the current study, we hypothesized that the antioxidative function of EGCG inhibits myofibroblast differentiation and collagen production. As a result, we showed that EGCG significantly inhibits ROS production, which was up-regulated by TGF-β1 stimulation and that EGCG inhibits myofibroblast differentiation and collagen production in TGF-β1-induced NPDFs. Therefore, we concluded that EGCG can inhibit α-SMA expression and collagen production from TGF-β1-induced NPDFs through an antioxidant effect.

CONCLUSIONS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. CONCLUSIONS
  8. Acknowledgements
  9. REFERENCES

In this study, we showed that EGCG had an inhibitory effect on ROS production, which was up-regulated in TGF-β1-stimulated NPDFs. One of the mechanisms of the inhibitory effects of EGCG on α-SMA expression and collagen production from TGF-β1-induced NPDFs appeared to be mediated by an antioxidative effect. These unique findings provide further understanding of the molecular mechanisms underlying the effects of EGCG on nasal polyp formation and help to further delineate the targets of therapeutic intervention and prevention of nasal polyp development.

Acknowledgements

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. CONCLUSIONS
  8. Acknowledgements
  9. REFERENCES

This report was supported by a grant from the Korea Healthcare Technology R&D Projects, Ministry for Health, Welfare, and Family Affairs, Republic of Korea (A090084).

Conflicts of interest

The authors declare that they have no conflict of interest.

REFERENCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. CONCLUSIONS
  8. Acknowledgements
  9. REFERENCES