SEARCH

SEARCH BY CITATION

Keywords:

  • Itch;
  • E3 ligase;
  • Mesenchymal progenitor cells;
  • Osteoblasts;
  • Bone formation

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. Disclosure of Potential Conflicts of Interest
  10. References

Itch, a HECT family E3 ligase, affects numerous cell functions by regulating ubiquitination and proteasomal degradation of target proteins. However, the role of Itch in osteoblasts has not been investigated. We report that Itch−/− mice have significantly increased bone volume, osteoblast numbers, and bone formation rate. Using bone marrow stromal cells from Itch−/− mice and wild-type (WT) littermates as bone marrow mesenchymal precursor cells (BM-MPCs), we found that BM-MPCs from Itch−/− mice have compatible numbers of cells expressing mesenchymal stem cell markers. However, Itch−/− BM-MPCs grew faster in an in vitro culture, formed more CFU-F mesenchymal colonies, and exhibited increased osteoblast differentiation and decreased adipogenesis. Importantly, Itch−/− mesenchymal colony cells formed significantly more new bone in a tibial defect of recipient mice compared with WT cells. The expression levels of JunB, an AP-1 transcription factor that positively regulate osteoblast differentiation, were significantly increased in Itch−/− BM-MPCs when proteasome function is intact. In contrast, the amount of ubiquitinated JunB protein was markedly decreased in Itch−/− cells when proteasome function was blocked. Overexpression of WT Itch, but not an Itch ligase-inactive mutant, rescued differentiation defects of Itch−/− BM-MPCs. Itch−/− BM-MPCs had a similar role in immune modulation as WT cells. Thus, Itch negatively controls osteoblast differentiation from BM-MPCs through the regulation of proteasomal degradation of positive osteoblast regulator JunB protein. Itch is a potential new target for bone anabolic drug development to treat patients with bone loss. STEM Cells 2013;31:1574–1583


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. Disclosure of Potential Conflicts of Interest
  10. References

Ubiquitination is a post-translational modification that has many functional implications. Ubiquitination occurs through a well-defined three-step process. Ubiquitin is first transferred to an ubiquitin-activating enzyme, E1. The activated ubiquitin is then transferred to an ubiquitin-conjugating enzyme, E2. Finally, the ubiquitin–E2 complex is recruited to a third enzyme, an ubiquitin ligase, E3, that specifically binds a protein substrate and facilitates the transfer of ubiquitin from E2 to the substrate [1]. Ubiquitinated proteins undergo proteasomal or lysosomal degradation [2]. There are several types of ubiquitin ligases, which is classified according to structures and mechanisms of action to mediate target protein ubiquitination. WW domain-containing ubiquitin ligases are a subgroup of the HECT family of ubiquitin E3 ligases, which promote protein ubiquitination by binding to a PPXY motif on target proteins. Up-to-date, the WW domain-containing ubiquitin ligases, Smurf1, Smurf2, Wwp1, and Wwp2, have been reported to be involved in bone cell regulation through modification of the stability of multiple proteins including BMP-Smad-Runx2 protein [3, 4], Smad3 and GSK3β [5], JunB [6], and Goosecoid [7]. Itch is another member of the WW domain-containing ubiquitin ligases. Itch−/− mice on a C57BL/6J background develop a progressive autoimmune disease with multiorgan inflammation [8]. Patients with Itch mutations have autoimmune inflammatory cell infiltration in various tissues [9]. However, the role of Itch in bone disease has not been investigated.

The molecular mechanisms by which Itch deficiency leads to autoimmune disease and multiorgan inflammation have been linked to persistent activation of the Jun amino-terminal kinase (JNK) and NF-κB signal pathways in T cells and macrophages in response to inflammatory cytokines. Itch−/− T cells show an activated phenotype, enhanced proliferation, and augmented production of the type 2 T helper cell cytokines interleukin 4 (IL-4) and IL-5, which are associated with decreased JunB ubiquitination [10]. Furthermore, TH2 cell cytokines trigger phosphorylation-dependent activation of Itch through JNK signal protein kinase cascade, leading to accelerated degradation of c-Jun and JunB [11]. Itch limits tumor necrosis factors (TNF)-induced NF-κB activation by facilitating A20-mediated ubiquitination and degradation of the adaptor protein, RIP, in the TNF receptor complex in T cells and macrophages [12, 13]. Itch is also required for negative regulation of TNF- and lipopolysaccharide-mediated TNF receptor-associated factor 6 ubiquitination induced by RING finger protein 11 [14]. Whether these signaling molecules mediate the effect of Itch on bone cells have not been investigated.

Recently we examined bone phenotype of Itch−/− mice and found that young Itch−/− mice have increased bone mass despite that they have increased osteoclast numbers, suggesting that Itch must affect cells in the osteoblast lineage to overcome osteoclast-mediated effect. The aim of this study is to elucidate cellular and molecular mechanisms by which osteoblast differentiation and function are elevated in Itch−/− mice. We demonstrate that Itch−/− mice have increased osteoblast numbers and bone formation rate (BFR). Bone marrow mesenchymal precursor cells (BM-MPCs) from Itch−/− mice have increased osteoblast differentiation in vivo and in vitro. At the molecular level, Itch−/− BM-MPCs express increased amount of JunB protein, a positive regulator of osteoblast differentiation. Overexpression of wild-type (WT) Itch, but not an Itch ligase-inactive mutant, rescued differentiation defects of Itch−/− BM-MPCs. Our findings indicate that Itch depletion has a strong positive effect on osteoblast differentiation in a cell autonomous fashion and Itch is a new ubiquitin E3 ligase that negatively regulates osteoblast differentiation.

Materials and Methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. Disclosure of Potential Conflicts of Interest
  10. References

Animals

Itch−/− mice were generated on a C57BL/6J background [8] and were genotyped by PCR analysis. Itch+/− mice were bred to generate Itch−/− mice. Primers for genotyping: Itch WT:5′-ATCGTCTACTCACCCCACATAAGG-3′, Itch knockout : 5′-AAGAAGCAGCAGAGACAACGAGTG-3′ Common: 5′-TCTATGCTCTGTTGTCTCCCATGC-3′. All animal procedures were conducted using procedures approved by the University of Rochester Committee for Animal Resources. One-month-old Itch−/− mice and WT littermates were used. SCID mice were purchased from Jackson Laboratories (Bar Harbor, Maine. www.JAX.org, Strain Name: B6.CB17-Prkdcscid/SzJ, Stock Number: 001913).

Antibodies and Retrovirus

Antibodies to JunB, β-actin, and Runx2 were purchased from Santa Cruz. FITC-anti-CD45, PE-anti-CD105, APC-anti-CD31, PE-cy7-anti-Sca1, and PE-cy5-anti-CD11b used in fluorescence-activated cell sorting (FACS) were purchased from eBioscience. To generate retroviral expression vector encoding Itch or Itch ligase-inactive mutant, in which cysteine residue at the 830 position was mutated to alanine (ItchC830A), the coding region for Itch and ItchC830A was amplified by PCR from the Flag-Itch or ItchC830A plasmid and cloned into the pMX–green fluorescent protein (GFP) retroviral vector at the BamHl and Notl site, resulting into the pMX-Itch-GFP and the pMX-ItchC830A-GFP expression vector. The pMX-GFP vector was used as a control for infection efficiency. These retroviral vectors were transiently transfected into the Plat-E retroviral packaging cell line, and viral supernatant was collected 48 hours later, as we described previously [15].

Fluorescence-Activated Cell Sorting

Cells were harvested and red blood cells were lysed. Cells were stained with FITC-anti-CD45, PE-anti-CD105, APC-anti-CD31, PE-cy7-anti-Sca1, and PE-cy5-anti-CD11b for 30 minutes, and subjected to FACS analysis according to the manufacture's instruction [16]. Results were analyzed by Flowjo7 software.

Mesenchymal Progenitor Cell Preparation

All cells used in this study were primary cells from bone marrow after red blood cells were lysed. Several types of cell preparations were prepared based on individual experimental needs. (a) For colony forming unit (CFU) colony formation assay, an assay to evaluate the cell's capacity to give rise to CFU-F, mesenchymal colonies, and CFU-alkaline phosphatase (ALP) assay, an assay to examine the cell's capacity to differentiate to osteoblasts, bone marrow cells were cultured in 10 cm dish at 106 cells per dish in 10 ml of α-MEM culture medium containing 10% fetal calf serum (FCS) with or without 50 μg/ml ascorbic acid and 10 mM β-glycerophosphate. Media were changed every 4 days, and cultures were maintained for 28 days. At the end of the culture period, cells were stained for H&E or ALP. (b) For bone nodule formation, bone marrow cells were cultured in α-MEM culture medium containing 10% FCS for 7–10 days to generate BM-MPCs. BM-MPCs were then cultured in osteoblast-inducing medium containing 50 μg/ml ascorbic acid and 10 mM β-glycerophosphate for 21–28 days and mineralized bone nodules were examined by Von Kossa staining. (c) For adipogenesis, BM-MPCs were cultured with the adipocyte differentiation medium for 12–16 days as described previously [17]. Adipocyte staining with oil red O was performed. (d) For isolating CD45 cells that contain enriched mesenchymal progenitor cells (MPC-enriched cells), bone marrow cells were incubated with anti-CD45 antibody conjugated microbeads (Miltenyi Biotec, Auburn, CA, http://www.miltenyibiotec.com). The CD45-negative population (CD45) was isolated by negative selection according to the manufacturer's instructions as we previously described [18]. (e) For bone-derived mesenchymal progenitor cells (B-MPCs) isolation, we used a recent published protocol [19]. Long bones were flushed several times with Phosphate Buffered Saline (PBS), cut into small pieces, and cultured in a plastic dish for 3 days. The bone pieces were transferred into a clear dish as the passage 1 and continually cultured for another 7 days to allow cells growing to confluent. The third passage cells were used for characterization and experiments.

MicroCT, Histology, and Histomorphometry of Bone Sections

Bones were dissected free of soft tissue, fixed overnight in 70% ethanol, and scanned at high resolution (10.5 μm) on a VivaCT40 micro-CT scanner (Scanco Medical, Basserdorf, Switzerland, http://www.scanco.ch) using an integration time of 300 ms, energy of 55 kVp, and intensity of 145 μA. The three-dimensional images were generated using a constant threshold of 275 for all samples. The hind limbs were fixed in 10% buffered formalin, decalcified in 10% EDTA, and embedded in paraffin. Sections (4-μm thick) were then stained with H&E or for tartrate-resistant acid phosphatase (TRAP) activity for osteoclast identification. Histomorphometric analysis of osteoblast and osteoclasts numbers, expressed as the number per millimeter of bone surface, was performed on two to three sections/bone using an Osteometrics image analysis software system (Osteometrics, Atlanta, GA, http://www.osteometrics.com), as we previously described [15].

Double Calcein Labeling

Double calcein labeling was performed by intraperitoneal injection of 10 mg calcein per gram of body weight (C-0875, Sigma, St. Louis, MO, http://www.sigmaaldrich.com) at 6 days and 1 day prior to sacrifice, as described previously [17]. Bones were harvested and embedded in LR White acrylic resin. Serial sections were cut, and the freshly cut surface of each section was viewed and imaged using fluorescence microscopy. The double calcein-labeled morphometric analysis in trabecular bone was measured using an Osteometrics image analysis software system (Osteometrics). Two sections were assessed per bone. The mineral apposition rate (MAR), BFR, and double label surface/bone surface (dLS/BS) were calculated as we previously described [18].

Tibial Bone Defect Model

Two-month-old SCID mice (n = 5) were anesthetized and bilateral 2 × 5 mm2 cortical bone defects were made in the anterior proximal tibiae of SCID mice and filled with bovine bone matrix. Cells (5 × 105) from CFU colonies were injected into the bone matrix in defects. The right tibiae received cells from WT mice and the left tibiae received cells from Itch−/− mice. The mice were sacrificed 6 weeks postsurgery, and the volume of new bone (BV/TV, expressed as a percentage of the total defect volume) formed in the defects was measured by μCT followed by histomorphometric analysis of the area of newly formed trabecular bone in decalcified H&E-stained sections. Three sections were assessed per bone.

Quantitative Real-Time RT-PCR

Total RNA was extracted using TRIzol reagent (Invitrogen, Grand Island, NY. http://www.invitrogen.com). cDNAs were synthesized by iSCRIPT cDNA Synthesis Kit (Bio-Rad). Quantitative real-time RT-PCR amplifications were performed in the iCycler (Bio-Rad, Hercules, CA. www.bio-rad.com) real-time PCR machine using iQ SYBR Green supermix (Bio-Rad) according to the manufacturer's instruction. gapdh was amplified on the same plates and used to normalize the data. Each sample was prepared in triplicate and each experiment was repeated at least three times. The relative abundance of each gene was calculated by subtracting the CT value of each sample for an individual gene from the corresponding CT value of gapdh (ΔCT). ΔΔCT were obtained by subtracting the ΔCT of the reference point. These values were then raised to the power of 2 (2ΔΔCT) to yield fold-expression relative to the reference point. Representative data are presented as means + SD of the triplicates or of four wells of cell culture. The sequences of primer sets for ALP, osteocalcin (OCN), PPARgama, C/EBPalpha, C/EBPbeta, and gapdh mRNAs are shown in Table 1.

Table 1. Primer sequence
NameF/RSequences
Col1FTCTCCACTCTTCTAGTTCT
 RTTGGGTCATTTCCACATGC
ALPFCTTGCTGGTGGAAGGAGGCAGG
 RCACGTCTTCTCCACCGTGGGTC
OCNFCAAGTCCCACACAGCAGCTT
 RAAAGCCGAGCTGCCAGAGTT
PPARγFTCGCTGATGCACTGCCTATG
 RGAGAGGTCCACAGAGCTGATT
C/EBPαFCAAGAACAGCAACGAGTACCG
 RGTCACTGGTCAACTCCAGCAC
C/EBPβFCGCAGACAGTGGTGAGCTT
 RCTTCTGCTGCATCTCCTGGT
C/EBPδFCGACTTCAGCGCCTACATTGA
 RCTAGCGACAGACCCCACAC
GAPDHFGGTCGGTGTGAACGGATTTG
 RATGAGCCCTTCCACAATG

Western Blot Analysis and Ubiquitination Assay

For Western blot analysis, whole-cell lysates were prepared from B-MPCs. Whole-cell lysates (10 μg protein/lane) were loaded in 10% SDS-PAGE gels and immunoblotted with antibodies to Runx2, JunB, and β-actin. For ubiquitination assay, B-MPCs were treated with the proteasome inhibitor MG 132 (10 μM) for 4 hours. Whole-cell lysates (200 μg protein/sample) were incubated with UbiQapture-Q Matrix (Biomol) by gentle agitation at 4°C overnight to pull down all ubiquitinated proteins according to the manufacturer's instructions. After washing three times, captured proteins were eluted with 2× SDS-PAGE loading buffer and analyzed by Western blotting using anti-JunB antibody, as described previously [18].

T-Cell Proliferation Assay

The effect of mesenchymal cells on T-cell proliferation was examined according to a published protocol [20]. In brief, mononuclear cells were obtained from the spleen and incubated with 1 μM carboxyfluorescein succinimidyl ester (CFSE, Molecular Probes) for 8 minutes at 20°C. Cells were quenched with fetal calf serum, washed twice with media, and then suspended in complete RPMI medium containing 2 mM glutamine (Sigma-Aldrich), 100 IU/ml penicillin, and 100 μg/ml streptomycin. CFSE-labeled spleen cells (2 × 105 in 200 μl) were seeded into 96-well plate at a final cell density of 1 × 106/ml along with 5 × 104 B-MPCs, in the presence of 10 μg/ml anti-CD3 antibody (R&D Systems, Minneapolis, MN, http://www.rndsystems.com). After 3 days, cells were stained with CD4-PE and were analyzed by FACS. The percentage of CD4+ T-cells and distribution of CFSE-labeled CD4+ T-cells were determined.

Statistics

All results are given as mean ± SD. Comparisons between two groups were analyzed using the two-tailed unpaired Student's t test. One-way ANOVA and Dunnett's post hoc multiple comparisons were used for comparisons among three or more groups. p values less than .05 were considered statistically significant.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. Disclosure of Potential Conflicts of Interest
  10. References

Itch−/− Mice Have Increased Bone Volume and Osteoblastic Bone Formation

To determine the role of Itch in bone mass, we examined bone phenotype of 1-month-old Itch−/− mice and WT littermates. μCT of femoral bones showed that Itch−/− mice have increased bone volume, trabecular numbers and decreased trabecular separation compared with WT littermates (Fig. 1A). Histomorphometric analysis of H&E-stained bone sections revealed 45%–50% increased bone volume and osteoblast numbers in Itch−/− mice (BV/TV: 20.6% % 2.6% vs. 11.6% ± 1.6% in WT mice; and No. osteoblasts/mm bone surface: 52 ± 5 vs. 29 ± 2 in WT mice) (Fig. 1B). TRAP-stained sections showed 30%–35% increased osteoclasts on trabecular bone surface in Itch−/− mice (No. osteoclasts/mm bone surface: 18 ± 2 vs. 12 ± 1.5 in WT mice) (Fig. 1C). Double calcein labeling indicated increased MAR (0.59 ± 0.04 vs. 0.37 ± 0.05 μm/day), BFR (0.44 ± 0.01 vs. 0.23 ± 0.02 μm3/μm2 per day), and dLS/BS (0.51% ± 0.05% vs. 0.34% ± 0.08%) in bone sections from Itch−/− mice compared to bone sections from WT mice. These data suggested that the increased bone volume in Itch−/− mice is caused by increased osteoblastic bone formation, although the increased osteoclastic formation is also observed.

thumbnail image

Figure 1. Itch−/− mice have increased bone volume. Bones from 1-month-old Itch−/− mice and WT littermates were analyzed. (A): Representative image of μCT scanning of femur and μCT data analyses. Bar = 300 μm. (B): H&E-stained tibial sections and histomorphometric analyses of the percentage of BV/TV and the number of osteoblast (Ob)/mm bone surface. Bar = 250 μm. (C): Tartrate-resistant acid phosphatase (TRAP)-stained sections and the number of TRAP+ osteoclasts (OC)/mm bone surface. Bar = 50 μm. (D): Double calcein labeling of femoral sections and bone formation parameters. Bar = 25 μm. Values are mean ± SD of five mice/group. *, p < .05 versus WT mice. Abbreviations: BFR, bone formation rate; dLS/BS, double label surface/bone surface; MAR, mineral apposition rate; WT, wild type.

Download figure to PowerPoint

Mesenchymal Progenitor Cells from Itch−/− Mice Have Increased CFU Colony Formation and Osteoblast Differentiation and Decreased Adipocyte Differentiation

To determine whether increased osteoblastic bone formation in Itch−/− mice is due to the alteration of osteoblast differentiation from BM-MPCs, we first examined whether Itch−/− bone marrow cells could give rise more mesenchymal colonies when they are cultured in basal medium and more ALP+ colonies when they are cultured in the osteoblast-inducing medium. Itch−/− cells formed significantly increased number of CFU-F and CFU-ALP+ colonies compared to WT cells (CFU-F colony No./well: 79 ± 4 vs. 52 ± 3; CFU-ALP+ colony No./well: 63 ± 5 vs. 38 ± 2). To examine osteoblast function, we examined mineralized nodule formation using Itch−/− BM-MPCs. Itch−/− BM-MPCs formed more mineralized nodules than those from WT littermates (mineralized nodule No./well: 105 ± 7 vs. 68 ± 8) (Fig. 2A). Consistently, the expression levels of osteoblast marker genes, Col1, ALP, and OCN, were all increased in BM-MPCs and CD45 MPC-enriched cells isolated from Itch−/− mice (Fig. 2B).

thumbnail image

Figure 2. Itch−/− bone marrow mesenchymal progenitors have increased osteoblast differentiation and decreased adipocyte differentiation. (A): Bone marrow mesenchymal progenitor cells (BM-MPCs) from Itch−/− mice and WT littermates were cultured in the osteoblast-inducing medium for 7–21 days. (A): Representative image of CFU-F, CFU-ALP+ colonies or mineralized nodules (upper panels) and the number of CFU-F and CFU-ALP+ colonies or mineralized nodules (lower panels). Values are mean ± of three dishes. (B): The expression levels of osteoblast marker genes were examined by qPCR in B-MPCs and CD45 MPC-enriched cells. (C): H&E-stained sections from tibial bone of 3-month-old Itch−/− mice and WT littermates were analyzed. The number of adipocytes/mm bone surface was counted. Bar = 250 μm. Values are mean ± SD of five mice/group. (D): BM-MPCs were cultured in the adipocyte-inducing medium for 21 days and the number of adipocytes was counted. Bar = 100 μm. Values are mean ± SD of three dishes. (E): The expression levels of adipocyte master genes were examined by qPCR in BM-MPCs and CD45± MPC-enriched cells. Values are mean ± SD of five mice. *, p < .05 versus WT cells. Abbreviations: ALP, alkaline phosphatase; WT, wild type; CFU, colony forming unit.

Download figure to PowerPoint

Bone marrow progenitor cells can differentiate into osteoblasts and adipocytes. These reciprocal differentiations often happen in bone disease, such as osteoporosis [17]. The adipocyte differentiation was examined in Itch−/− mice. H&E-stained bone sections from 3-month-old Itch−/− mice and WT littermates showed numerous adipocytes in bone marrow of WT mice; however, few adipocytes were observed in Itch−/− mice (Fig. 2C). BM-MPCs were cultured and induced into adipocytes using the adipocyte-inducing medium. Cells from Itch−/− mice formed fewer adipocytes than WT cells (oil red O+ cells No./well: 390 ± 83 vs. 1,005 ± 71) (Fig. 2D). Similarly, the expression levels of adipocyte marker genes, C/EBPα, C/EBPβ, C/EBPδ, and PPARγ, were all decreased in BM-MPCs and CD45 MPC-enriched cells isolated from Itch−/− mice compared to WT littermates (Fig. 2E), indicating decreased adipocyte differentiation in cells from Itch−/− mice.

Itch−/− Mesenchymal Progenitor Cells Have Increased Bone Formation Potential in Recipient Mice

To elucidate whether increased osteoblast differentiation in Itch−/− cells is due to increased number of mesenchymal stem cells, we examine the frequency of cells that express surface markers for mesenchymal stem cells. Although there are no standard mesenchymal stem cell surface markers, murine mesenchymal stem/progenitor cells have been identified as CD45/CD11b/CD31/CD105+/Sca1+ cells [21]. We assessed the percentage of CD45/CD11b/CD31/CD105+/Sca1+ cells in bone marrow cells from Itch−/− mice and WT littermates by FACS analysis. We first demonstrated that bone marrow cells from Itch−/− mice and WT littermates have a similar percentage of CD45 cells, which are gated off CD45+ hematopoietic lineage cells and contain enriched MPCs [18]. We then indicated that they have same percentage of CD11b/CD31/CD105+/Sca1+ cells, cells that are often used as mesenchymal progenitor cells [22] (Fig. 3A). To directly test the effect of Itch depletion on osteoblast differentiation potential in the absence of its effect on other cell types, we implanted Itch−/− or WT CFU cells which are composed of MPCs and decalcified bone matrix into tibial defects of SCID mice (Fig. 3B). Itch−/− cells formed significantly more new bone in defects of recipient mice compared with WT cells examined by μCT (new bone BV/TV: 5.8% ± 1.9% vs. 2.4% ± 0.7%) (Fig. 3C) and histomorphometric analysis in H&E stained sections (new bone area: 0.035 ± 0.003 vs. 0.018 ± 0.006 mm2 and mesenchymal tissue area: 0.009 ± 0.003 vs. 0.004 ± 0.001 mm2) (Fig. 3D). Thus, MPCs from Itch−/− mice have great bone formation potential in vivo.

thumbnail image

Figure 3. Mesenchymal colony cells from Itch−/− mice form increased new bones in recipient mice. (A): The percentage of nonhematopoietic lineage cells (CD45) and the percentage of cells that express MPC surface markers (CD11b/CD31/Sca1+/CD105+) in primary bone marrow cells by fluorescence-activated cell sorting analysis. (B): CFU cells from Itch−/− and WT littermates were implanted into tibial defects of SCID mice with decalcified bone matrix as scaffold. Mice were sacrificed 6 weeks postimplantation. (C): μCT images and μCT data of the percentage of new formed bone volume versus total tissue volume. (D): Histology and histomorphometric data of the area of new bone, dead bone, and mesenchymal tissue containing spindle-shaped fibroblasts observed in decalcified H&E-stained sections of the bones. Bar = 125 μm. Values are mean ± SD of five mice. *, p < .05 versus WT cells. Abbreviations: FSC, forward scatter; WT, wild type; CFU, colony forming unit.

Download figure to PowerPoint

Decreased Ubiquitination and Proteasome Degradation of JunB Protein in the Absence of Itch

Itch functions as E3 ligase to promote ubiquitination of targeting proteins. JunB and Runx2 are two positive osteoblast regulators that are regulated partially through ubiquitination and proteasome degradation in osteoblasts [6, 23]. In vitro studies reported the overexpression of E3 ligase Smurf1 or Wwp1 promote the ubiquitination and proteasome degradation of Runx2 protein in osteoblast cell lines [23, 24]. A recent report indicated that disheveled protein, a negative regular of Wnt/β-catenin signaling pathway, is regulated by Itch in HEK293T cells [25]. We examined the expression levels of Runx2, JunB, and activated form of β-catenin to determine which one of them is a potential endogenous target of Itch in MPCs to account for altered osteoblast differentiation. We used the expression level of activated form of β-catenin as readout for disheveled protein. Interestingly, we found dramatically increased JunB, moderate increased activated form of β-catenin, and slightly increased Runx2 in Itch−/− BM-MPCs (Fig. 4A). These data indicate that under condition where Itch−/− cells have normal proteasome function, the degradation of JunB and perhaps disheveled protein was reduced. Because of markedly accumulated JunB, we decided to determine whether the increased JunB protein in Itch−/− BM-MPCs is due to abnormal ubiquitination by comparing the amount of ubiquitinated JunB protein between Itch−/− BM-MPCs and WT cells in the presence of proteasome inhibitor MG132. Itch−/− BM-MPCs had a significantly reduced JunB ubiquitination with a similar level of total JunB protein compared to WT cells (Fig. 4B).

thumbnail image

Figure 4. Decreased JunB ubiquitination in Itch−/− bone marrow mesenchymal progenitors. (A): Protein expression levels of Runx2, JunB, and active β-catenin proteins in bone marrow mesenchymal progenitor cells (BM-MPCs) from WT and Itch−/− mice by Western blot analysis. The fold changes were calculated from the intensity of bands on Western blot image using Scion Image Beta 4.02 (Scion Corporation, NIH). (B): Itch−/− and WT BM-MPCs were treated with MG132 for 4 hours and whole-cell lysates were incubated with UbiQapture-Q matrix to pull down ubiquitinated proteins. Ubiquitinated proteins were blotted with anti-JunB antibody. Expression level of JunB and β-actin was measured in the same whole-cell lysates. Abbreviation: WT, wild type.

Download figure to PowerPoint

Itch-Inhibited Osteoblast Differentiation Requires the E3 Ligase Activity

Ubiquitin E3 ligases promote ubiquitination of targeting proteins by facilitating the transfer ubiquitin moiety from E2 protein substrate via its ligase activity [1]. To elucidate whether Itch ligase activity is required for regulating osteoblast differentiation by Itch, we need to demonstrate that the WT Itch, but not ligase-inactive Itch mutant (Itch-C830A), could rescue the osteoblast defect of Itch−/− cells. Because it is very difficult to infect bone marrow progenitor cells, we used bone-derived MPCs (B-MPCs) according to a recent published protocol with minor modification [19]. We first characterized immunophenotype of B-MPCs by FACS (Fig. 5A) and confirmed that these cells had capacity to differentiate to osteoblast, adipocytes, and chondrocyte lineages (Fig. 5B). We then infected B-MPCs with retroviral supernatant containing GFP, Itch-C830A, or WT Itch virus for 4 days, changed to osteoblast-inducing medium for another 5 days, and examined the ALP+ area as an indicator of osteoblast differentiation. Similar to BM-MPCs, Itch−/− B-MPCs gave rise to more ALP+ osteoblasts than WT cells. Increased ALP+ area in Itch−/− cells was completely reversed in cells that were infected by WT Itch virus, but not in cells that were infected by Itch-C830A virus. Consistently, WT Itch virus reduced ALP+ area in WT cells while Itch-C830A virus had no effect (ALP+ area/plate area: 6.5 ± 1 in GFP− vs. 0.5% ± 0.1% in WT Itch− vs. 6% ± 0.8% in Itch-C830A-infected WT cells) (Fig. 5C).

thumbnail image

Figure 5. Itch ligase activity is required for increased osteoblast differentiation of Itch−/− cells. The bone-derived cells from WT mice were cultured in α-MEM medium and passaged for three times as bone-derived mesenchymal progenitor cells (B-MPCs). (A): Expression profile of surface markers for mesenchymal stem cells in B-MPCs was examined by fluorescence-activated cell sorting. MPC surface markers are CD45/Sca1+/CD105+/CD44+/CD31/CD11b/CD117. (B): The differentiation potential to osteoblasts, adipocytes, and chondrocytes was examined by culturing cells in the appropriate inducing media for 2–4 weeks. (C): Bone-MPCs were infected with retroviral supernatant containing GFP, Itch-C830A mutant or WT Itch virus. Cells were cultured in the osteoblast-inducing medium for 5 days and stained for ALP activity. The percentage of ALP+ area/total plate area was measured. Values are mean ± SD of three plates. *, p < .05 versus different groups as indicated. Abbreviations: ALP, alkaline phosphatase; GFP, green fluorescent protein; WT, wild type.

Download figure to PowerPoint

As mesenchymal stem cells are known to have a role in immune modulation [26] and Itch−/− mice have impaired T-cell function [10], we performed a T-cell proliferation assay by coculturing T cells with or without addition of BM-MPCs from Itch−/− mice or WT littermates. Results showed both WT and Itch−/− BM-MPCs could decrease the number (Fig. 6A) and division (Fig. 6B) of T cells at a compatible level, indicating that Itch−/− BM-MPCs have a similar immune modulation effect as WT cells.

thumbnail image

Figure 6. Itch−/− mesenchymal progenitors have a comparable inhibitory effect on T-cell proliferation. WT splenocytes were labeled with CFSE. Labeled splenocytes were then cocultured with BM-MPC from Itch−/− mice and WT littermates in the presence of anti-CD3 antibody for 3 days. Cells were stained with anti-CD4 antibody. The percentage of CD4+ T cells (A) and distribution of CFSE-labeled CD4+ T-cells (B) were determined by fluorescence-activated cell sorting analysis. Abbreviations: CFSE, carboxyfluorescein succinimidyl ester; WT, wild type.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. Disclosure of Potential Conflicts of Interest
  10. References

In this study, we used global Itch knockout mice and demonstrated that Itch−/− mice have high bone volumes with increased osteoblast-mediated bone formation. Itch depletion does not affect the number of cells that express mesenchymal stem cell markers within bone marrow. However, mesenchymal progenitor cells (MPCs) from bone marrow of Itch−/− mice have increased osteoblast differentiation in vitro and new bone formation in vivo. Itch−/− MPCs expressed very high levels of osteoblast positive regulator JunB with significantly reduced amount of ubiquitinated JunB protein. Furthermore, increased osteoblast differentiation of Itch−/− MPCs requires Itch ligase activity. Thus, Itch is a new E3 ligase that negatively regulates osteoblast function at the progenitor levels.

Itch belongs to the family of WW domain-containing ubiquitin ligases. Among them, Smurf1 and Wwp1 have been reported to have negative effects on osteoblast function. Smurf1 promotes the degradation of Smad1/5 [3], Runx2 [23], JunB [6], and MEKK2 [27] proteins. Smurf1−/− mice develop age-related bone loss. Wwp1 plays an important role in chronic inflammation-induced osteoblast inhibition and regulates JunB degradation [18]. How does Itch deficiency-associated bone and osteoblast defects differ from these already described bone abnormalities in Smurf1−/− or Wwp1−/− mice? First, increased bone volume occurs at a young age (1-month old) in Itch−/− mice before skeleton maturation while Smurf1−/− mice have detectable increased bone mass until 6 months of age [6]. Second, Itch−/− mice develop multiple-organ inflammation with age, a phenotype similar to patients with the Itch gene mutation [9] while Smurf1−/− or Wwp1−/− mice have relatively normal immune system. Finally, Itch−/− mice have increased osteoclast formation while Smurf1−/− or Wwp1−/− mice have normal osteoclastogenesis. Thus, Itch likely regulates cell function at different stages or/and in different cell types from Smurf1 and Wwp1.

Like other members of WW domain-containing ubiquitin ligases, Itch regulates the stability of multiple proteins via ubiquitination and subsequent proteasomal or lysosomal degradation [28]. Among multiple Itch target proteins, we found that JunB is a major endogenous substrate of Itch in BM-MPCs. JunB is a positive regulator of osteoblast differentiation. Elevated total JunB protein when the proteasome function is intact and decreased amount of ubiquitinated JunB when the proteasome function is blocked in Itch−/− BM-MPCs indicate that JunB is a major endogenous substrate of Itch in these cells. Previous studies propose that ubiquitination and proteasome degradation is one of regulatory mechanisms of Runx2 [29]. However, we found that Runx2 protein levels are only slightly changed, suggesting that Runx2 is not the major target of Itch in BM-MPCs. JunB is a member of AP-1 transcription factor. We reported that abnormal JunB degradation is responsible for the negative effect of Smurf1 on osteoblast proliferation and differentiation. Smurf1−/− BM-MPCs express elevated levels of JunB protein and JunB depletion abolishes increased osteoblast marker gene expression in Smurf1−/− BM-MPCs [6]. Compared to Smurf1−/− BM-MPCs, Itch−/− cells had much higher level of JunB protein and osteoblast differentiation potential. Itch−/− mice develop high bone mass at young age (1-month old) while Smurf1−/− mice have increased bone volume when they become at least 6–8-month old. Thus, Itch may be a stronger osteoblast negative regulator than Smurf1.

Itch deficiency causes progressive autoimmune diseases [8, 9] and increased osteoclastogenesis [30]. We found that Itch−/− mice at a young age (1-month old) have high bone mass while at an old age (1-year old) they develop osteoporosis. This is not due to changes of osteoblast and osteoclast differentiation potential of Itch−/− cells at different ages because increased osteoblast and osteoclast numbers were detected in young and old Itch−/− mice. It is possible that the aging process potentates the catabolic effect of Itch depletion on osteoclast-mediated bone resorption, which overrides the anabolic effect of Itch depletion on osteoblasts. Because of the potential adverse effects of Itch inhibition on immune system and osteoclasts, Itch inhibitors may be more suitable for local administration in a short duration to treat patients with local bone damage. Administration of Itch depleted mesenchymal stem and progenitor cells may be used in facilitating bone repairs given the fact that Itch−/− MPCs formed much more new bone in bone defects in recipient mice, and Itch is stronger osteoblast inhibitor than Smurf1 and Wwp1 based on bone phenotype analysis of knockout mice [6]. Another use of Itch−/− mesenchymal stem and progenitor cells is to search for new potential bone anabolic proteins that are also endogenous substrates of Itch by comparing proteomic information among Itch−/− cells, Itch−/− cells infected with WT Itch, and Itch−/− cells infected with ligase-inactive mutant of Itch mutant.

Conclusion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. Disclosure of Potential Conflicts of Interest
  10. References

In summary, we found that ubiquitin E3 ligase Itch is a negative regulator of osteoblast differentiation from mesenchymal stem and progenitor cells. We found increased osteoblast numbers and BFR in Itch−/− mice. Itch−/− bone marrow progenitor cells formed more mesenchymal colonies that have increased capacity to differentiate to osteoblasts. More importantly, Itch−/− mesenchymal colony cells formed much more new bone in recipient mice, indicating that Itch depletion has a strong positive effect on osteoblast differentiation in a cell autonomous fashion. Thus, Itch is a potential new target for development of bone anabolic drug, which could accelerate local bone repair in patients with bone disorders such as bone fracture and defects.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. Disclosure of Potential Conflicts of Interest
  10. References

We thank Dr. Lydia E. Matesic (University of South Carolina) for providing Itch−/− mice, Dr. Abbott DW (Case Western Reserve University School of Medicine) for Flag-Itch and Itch-C830A mutant expression vectors, and Dr. Igor Kuzin (University of Rochester) for helping T-cell proliferation assay. This work was supported by research grants from National Institute of Health PHS awards (AR48697 to L. Xing). MicroCT was supported by P30AR0613007 to Edward M. Schwarz.

Disclosure of Potential Conflicts of Interest

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. Disclosure of Potential Conflicts of Interest
  10. References

The authors indicate no potential conflicts of interest.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. Disclosure of Potential Conflicts of Interest
  10. References