SEARCH

SEARCH BY CITATION

Keywords:

  • PEDF;
  • Adult stem cells;
  • Mesenchymal stem cells;
  • Bone;
  • Differentiation;
  • MAPK;
  • Osteoblast

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. DISCUSSION
  7. Conclusion
  8. Acknowledgments
  9. Disclosure of Potential Conflicts of Interest
  10. References
  11. Supporting Information

Pigment epithelium-derived factor (PEDF) is a potent antiangiogenic factor found in a wide variety of tissues. Recent findings indicated that lack of PEDF leads to osteogenesis imperfecta type VI whose hallmark is a defect in mineralization. We investigated the effects of PEDF on human mesenchymal stem cells (hMSCs) and signaling pathways through which PEDF displays its activities in hMSCs. hMSCs incubated in a medium supplemented with PEDF induced expression of osteoblastic-related genes. In addition, PEDF induced alkaline phosphatase (ALP) activity in MSCs at 14 days of incubation in maintenance medium; hMSCs incubated in osteogenic medium in presence of PEDF expressed 19% more ALP activity (35.655 ± 1.827 U/mg protein, p = .041 than cells incubated in the same medium without PEDF supplementation (29.956 ± 2.100 U/μg protein). hMSCs incubated in osteogenic medium in presence of PEDF deposited 50% more mineral (2.108 ± 0.306 OD/ml per well per 1 × 104 cells per square centimeter, p = .017) than MSCs incubated in absence of the protein (1.398 ± 0.098 OD/ml per well per 1 × 104 cells per square centimeter) as determined by Alizarin Red quantitation. Reduction in PEDF expression in MSCs by siRNA led to decreased ALP activity (33.552 ± 2.009 U/ng protein of knockdown group vs. 39.269 ± 3.533 U/ng protein of scrambled siRNA group, p = .039) and significant reduction in mineral deposition (0.654 ± 0.050 OD/ml per well per 1 × 104 cells per square centimeter of knockdown group vs. 1.152 ± 0.132 OD/ml per well per 1 × 104 cells per square centimeter of wild-type group, p = .010). Decreased ALP activity and mineral deposition were restored by supplementation with exogenous PEDF protein. PEDF activated ERK and AKT signaling pathways in MSCs to induce expression of osteoblastic-related genes. These data suggest that PEDF is involved in MSCs osteoblastic differentiation. Stem Cells 2013;31:2714–2723


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. DISCUSSION
  7. Conclusion
  8. Acknowledgments
  9. Disclosure of Potential Conflicts of Interest
  10. References
  11. Supporting Information

Pigment epithelium-derived factor (PEDF) is a potent antiangiogenic factor found in a wide variety of fetal and adult tissues; it is thought to play a role in the regulation of angiogenesis during development [1-3]. The protein was originally isolated from human fetal retinal pigment epithelial cells and has been shown to be synthesized by a variety of other cells including osteoblasts and osteoclasts [4-6]. A report on expression pattern of PEDF in developing mouse hind limbs from newborn through maturation demonstrated that the protein is expressed in chondrocytes within the resting zone, proliferative zone, and upper hypertrophic zones of the epiphyseal growth plate [6, 7]. The pattern of expression was reported to be consistent throughout the developmental stages of the mouse. In addition, PEDF was shown to be expressed by osteoblasts lining the bone spicules in the ossification zone of metaphyseal bone as well as by osteoblasts lining cortical periosteum [6, 7]. This report suggested that PEDF may play a regulatory role in the processes of chondrocytic and osteoblastic differentiation, endochondral ossification, and bone remodeling during development of long bones. Most studies on PEDF have focused on its role in angiogenesis and vascular endothelial growth factor regulation (VEGF) [8-10]. Because of its antiangiogenic activities, PEDF is being investigated for cancer treatment [11]. There are no studies on the role of this protein in bone except the recent findings that patients who lack expression of this protein develop osteogenesis imperfecta (OI) type VI [12-15]. In this study, to begin to understand the role of PEDF in bone, we examined its effects on mesenchymal stem cells (MSCs) osteoblastic differentiation and mineral deposition in vitro and report here that PEDF plays a role in the regulation of proteins and genes involved in osteogenesis thus may play a role in MSCs osteoblastic differentiation.

Materials and Methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. DISCUSSION
  7. Conclusion
  8. Acknowledgments
  9. Disclosure of Potential Conflicts of Interest
  10. References
  11. Supporting Information

Human MSCs Isolation

Human-derived MSCs were harvested from the bone riming of patients undergoing hip surgery (ages 50–70) under approved exempt protocol # 18660 by Penn State College of Medicine Institutional Review Board. The cells were isolated from five different donors using the methods described previously [16]. Briefly, bone rimings were washed extensively in sterile phosphate-buffered saline (PBS) by repeated centrifugation at 1,000 rpm for 5 minutes. Single-cell suspensions were suspended in Dulbecco's modified Eagle's medium (DMEM) supplemented with 20% Fetal bovine serum (FBS) and plated in Petri dishes. The cells were maintained in culture in DMEM supplemented with 20% FBS, 1% penicillin/streptomycin (P/S), and 60 mM 2-mercaptoethanol for 7 days. Nonadherent cells were removed and adherent cells were maintained in culture with medium changes and passaged when they reached confluence. To demonstrate that the cells possessed stem cell characteristics, one of the cell isolates was assessed for putative MSCs surface marker expression by flow-activated cell sorting (FACS) and bone formation in vivo by seeding cells onto ceramic scaffolds followed by implantation into the backs of severe combined immunodeficient (SCID) mice. The cells were also assessed for chondrogenic and adipogenic differentiation. The cells were used as such without further purification.

FACS Analysis

To determine stem cell characteristics of MSCs used in this study, a selected population of cells was subjected to FACS analysis to assess for expression of putative cell surface markers attributed to MSCs. Methods used previously were followed [17]. Briefly, bone marrow-derived MSCs were lifted off the plates by trypsinization with 0.25% trypsin/EDTA and washed with cold PBS. Cell aliquots (5 × 105) were incubated in a buffer containing monoclonal antibodies for 1 hour at 4°C to specific surface markers to be assessed. Antibodies used for FACS analysis were phycoerythrin-conjugated anti-CD11, anti-CD34, anti-CD44, anti-CD45, anti-CD73, anti CD90, and anti-CD105 (all from BD Bioscience, San Diego, CA, http://www.bdbiosciences.com). The flow cytometry instrument is housed in Penn State College of Medicine Core Facility). CD44, CD73, CD90, and CD105 are putative markers attributed to MSCs, CD11 is associated with macrophages, and CD34 and CD45 are associated with hematopoietic stem cells.

In Vitro Differentiation of Human-Derived MSCs

Representative MSCs isolated from one of the patients were characterized for stem cell differentiation; first in vitro and later in vivo to mesenchymal cell lineages. We determined potential of the cells to differentiate toward, osteogenic, chondrogenic, and adipogenic lineages.

Chondrogenic Differentiation

For chondrogenic induction, hMSCs (2 × 105) in DMEM were suspended in 15 ml conical tubes in DMEM and centrifuged. The DMEM medium was removed and replaced with a defined medium which consisted of DMEM with high glucose supplemented with 10 ng/ml TGF-β3 and 200 μM 2-ascorbate, ITS premix, and 10−7 M Dexamethasone. The pellets were maintained in this chondrogenic medium for 21 days with medium changes every 3 days and as described previously [16, 18]. After 21 days of incubation, the pellets were fixed in 4% paraformaldehyde for 24 hours, washed, and embedded in OCT. Ten micrometer tissue sections were cut and stained in H and E to assess for presence of cartilage matrix [16]. Control cells were incubated in a medium lacking osteogenic induction factors.

Adipogenic Differentiation

For adipogenic differentiation, hMSCs were cultured to near confluence followed by incubation in DMEM containing high glucose and supplemented with 10% FBS, 1% P/S, 10−2 μM dexamethasone, 10 μM insulin, 200 μM indomethacin, and 0.5 mM isobutyl-methylxanthine (all from Sigma Aldrich, St Louis, MO, http://www.sigmaaldrich.com/united-states.html). Medium was replaced every 3 days to 28 days, after 28 days, cells were incubated in 0.3% oil red O to stain for cells that differentiated into adipocytes [19]. Control cells were incubated in a medium without adipogenic induction factors.

In Vivo Transplantation of Marrow-Derived MSCs into SCID Mice

Marrow-derived MSCs were assessed for in vivo differentiation by seeding cells onto ceramic scaffolds followed by implantation into the backs of SCID mice. Briefly, BMSCs were seeded in 100 mm Petri dishes and incubated in the growth medium for 24 hours. After 24 hours, 5 × 106 cells were seeded onto 40 mg of hydroxyapatite/tricalcium phosphate (HA/TCP) ceramic powder particles ranging from 0.3 to 0.5 μm (Zimmer, Warsaw, IN, http://www.zimmer.com/en-US/hcp.jspx). The cells were allowed to attach onto the ceramic particles by incubation in the growth medium for 3–4 hours at 37°C in 5% CO2. The cell seeded scaffolds were centrifuged at 200g for 1 minute, and the supernatants were discarded. Cell seeded scaffolds were mixed with mouse fibrinogen and thrombin to form a pellet-shaped cohesive mixture of cells and particles. The cell seeded scaffolds were then implanted subcutaneously into the backs of 8–10-week-old female immunocompromised mice. Two mice were used, one mouse was implanted with two cell seeded ceramic scaffolds and one empty scaffold. The other mouse was implanted with two empty ceramic scaffolds and one cell seeded scaffold. The implants were harvested 8 weeks following implantation and processed for histology as described [20-22].

Alkaline Phosphatase Activity

Alkaline phosphatase (ALP) activity was assessed for the following groups of cells; (a) dose-response of MSCs to PEDF in maintenance medium in comparison to MSCs incubated in osteogenic medium. (b) MSCs in maintenance medium supplemented with optimal dose of PEDF (250 ng/ml) at days 0, 3, 7, 14 and compared to MSCs incubated in osteogenic medium at the same time points. (c) MSCs maintained in osteogenic medium supplemented with PEDF at different concentrations. (d) MSCs with PEDF knockdown and or treated with exogenous PEDF in osteogenic medium to assess rescue compared to MSCs transfected with scrambled siRNA and maintained in osteogenic medium. All analyses were done at 7 or 14 days following incubation. For each analysis, four samples were used and each sample was assessed three times.

For analysis, human MSCs were plated at 2 × 104 cells per well in 24-well plates and incubated in osteogenic medium or maintenance medium in presence or absence of recombinant human PEDF as outlined above. Dr. Tombran-Tink, supplied the recombinant protein used in the studies reported in this manuscript. The protein was prepared and characterized as previously described [23]. Dose-response of MSCs to PEDF was assessed by analysis of ALP activity after 14 days of incubation in maintenance medium supplemented with selected concentrations of PEDF. Briefly, hMSCs (2 × 104 per well) were plated in 24-well plates, in maintenance medium. After 24 hours, the medium was replaced with new maintenance medium supplemented with different concentrations of PEDF (10, 50, 250, and 1,250 ng/ml). For each concentration assessed, four different wells were used. Cells were incubated in the maintenance medium with medium replacement supplemented with respective PEDF concentration to be assessed every 2 days for 14 days. After 14 days, ALP activity was assessed. ALP activity was determined in cell lysates using an ALP activity assay kit (Sigma, St. Louis, MO) and as described previously. Cell lysates were analyzed for protein concentration using a Bio-Rad protein assay kit and ALP activity was normalized for total protein concentration [17, 24].

Following dose-dependent determination, in subsequent analyses ALP activity was assessed at day 14 following incubation of the cells in presence or absence of 250 ng/ml of PEDF which was determined to be optimal concentration. Optimal dose was based on increased ALP activity and significant enhancement of mineral deposition when this dose was added to MSCs either in normal or osteogenic medium. Previous reports assessing antitumor or ant-VEGF activities used much higher concentrations of PEDF ranging from 50 ng/ml (1 nmol/ml) to 5,000 ng/ml (100 nmol/ml) [25, 26]. Studies reported in this communication are the first to assess effect of PEDF on MSCs and thus there is no optimal dose reported previously. ALP activity was determined using the Sigma-Aldrich ALP assay kit following the manufacturer's protocol as described above and described previously [17, 24].

Osteogenic Differentiation and Alizarin Red S Staining

Alizarin red staining was used to determine the level of mineral deposition by MSCs in osteogenic medium either supplemented or not supplemented with PEDF. The following groups of MSCs were assessed for mineral deposition: (a) MSCs in osteogenic medium supplemented with PEDF at different concentrations (10, 50, 250, and 1,250 ng/ml) compared to MSCs in osteogenic medium without PEDF; (b) PEDF knockdown MSCs in osteogenic medium, knockdown MSCs in osteogenic medium plus exogenous PEDF compared to MSCs transfected with scrambled siRNA. For analysis, hMSCs were plated in 24-well plates at 1 × 104 cells per square centimeter and incubated in osteogenic medium for 28 days [27, 28]. The osteogenic medium consisted of α-MEM (Invitrogen, Carlsbad, CA, http://www.invitrogen.com) supplemented with 10% FBS, 50 μg/ml ascorbic acid, 10 mM β-glycerol phosphate, 10−7 M dexamethasone, and 1% penicillin/streptomycin (P/S) either in presence or absence of PEDF at either of the PEDF concentration shown above or 250 ng/ml which was determined to be the optimal concentration. The cells were maintained in culture with medium changes every 3–28 days. After 28 days, the media were removed, and the cells were rinsed in PBS, fixed in 10% formalin, and stained with Alizarin Red S. Alizarin Red S was prepared by dissolving Alizarin Red in water to make a solution of 1%. The plates were incubated in Alizarin Red S for 5 minutes at room temperature. After 5 minutes, the plates were rinsed in distilled water and were then examined under a light microscope and photographed. To quantify the level of calcium deposition by the cells, deposited Alizarin Red S was extracted with 10% cetylpyridinium chloride in distilled water, and assessed for absorbance at 560 nm as described previously [29].

Van Kossa Staining

The mineralization of differentiated hMSCs was also assessed by von Kossa staining. Cells were fixed in 4% (wt/vol) paraformaldehyde for 5 minutes, and then incubated in 5% silver nitrate solution for 20 minutes under ultraviolet lamp. After washing in distilled water, the plates were treated with 2% sodium thiosulfate for 2 minutes and were examined under a light microscope and photographed.

Western Blotting

Western blotting was performed to determine PEDF synthesis by hMSCs incubated in osteogenic medium at 0, 3, 7, 14, 21, and 28 days, and for phosphorylated and unphosphorylated ERK and AKT synthesis following incubation of hMSCs either in presence or absence of PEDF. Total protein was extracted with RIPA lysis buffer (1% Nonidet P40, 150 mM NaCl, 50 mM Tris-HCl, pH 7.4, 1 mM EDTA, 50 mM sodium fluoride, 2 mM sodium vanadate, 0.1% bovine serum albumin (BSA), and complete protease inhibitors) (Pierce, Rockford, IL, http://www.piercenet.com/). The extraction was performed by incubating cells on ice for 15–20 minutes. The lysate was centrifuged and the supernatant was collected. The protein concentration of cell lysates was determined using a Protein Assay kit (Bio-Rad, Hercules, CA, http://www.bio-rad.com/). Total cell extracts containing equal amounts of protein were separated by 12% SDS-PAGE and electroblotted to polyvinylidene difluoride (PVDF) membranes (Bio-Rad Laboratories). The membranes were probed with anti human antibodies to AKT (1:1,000, SC-5298, Santa Cruz, CA), Phospho-AKT (1:1,000, SC-7985-R, Santa Cruz, CA), total ERK1/2 (1:1,000, 9102, Cell Signaling Technology, CA), and phosphorylated ERK1/2 (1:1,000, 9106, Cell Signaling Technology). Antibodies to PEDF (1:2,000, SC-25594, Santa Cruz, CA) and mouse anti-human GAPDH (1:2,500, SC-32233, Santa Cruz, CA) were also used. For visualization, horseradish peroxidase-conjugated secondary antibodies were used and the bands were developed by SuperSignal West Pico substrate (Thermo Scientific). Specific bands were quantified using the Bio-Rad Laboratories GS-700 Densitometer (Bio-Rad).

Signaling Pathways Analysis

We assessed whether PEDF signals through ERK and AKT to illicit activities in MSCs. First we determined effect of PEDF on ERK and AKT phosphorylation. Human MSCs were plated onto 6 cm Petri dishes at density of 1 × 104/cm2 and pretreated with 20 μM of AKT kinase inhibitor (612847-09-3, Biovision, CA), 10 mM ERK docking domain inhibitor (294675-79-9, Sigma-Aldrich, CA), or control solution (DMSO). This was followed by incubation of MSCs in a medium supplemented with 250 ng/ml of PEDF for 1, 5, 30 minutes, 3 hours, and 24 hours [30]. Cells at each time point were extracted with RIPA buffer and the cell lysates were collected and used for Western blotting. Cells were also assessed for expression of osteogenic genes at 3 and 24 hours.

siRNA Derivation

The Smart-pool siRNA for silencing PEDF (catalog no. SC-40947, Santa Cruz, CA) was purchased from Santa Cruz (Santa Cruz, CA, http://www.scbt.com/). Transfection of the PEDF-specific siRNA (20 nM) was performed using Lipofectamine 2000 (Invitrogen, CA) following manufacturer's instructions. Briefly, human MSCs were seeded in 24-well plates at 2 × 104 cells in 0.5 ml of growth medium. For each well, 20 pmol siRNA diluted with OPTI-MEM was mixed in 1 μl Lipofectamine 2000 diluted in OPTI-MEM and incubated for 20 minutes, and then the complexes were added to each well. Nonspecific siRNA control (scrambled siRNA [Santa Cruz]) was used. To determine the efficiency of siRNA transfection, mRNA and protein were collected from the cells after transfection with siRNA; real-time PCR and Western blot analyses were performed to detect PEDF expression levels. The cells were used for differentiation to determine ALP activity and mineral deposition at 48 hour post-transfection.

Quantitative Real-Time PCR

Quantitative PCR was carried out to determine expression of osteogenic genes by hMSCs incubated in growth medium supplemented with 250 ng/ml of PEDF for 3, 7, 14, 21, and 28 days. The genes assessed were ALP, Runx2, osteopontin (OPN), osterix (OSX), osteocalcin (OCN), bone sialoprotein (BSP), bone morphogenetic protein 2 (BMP-2), and Col1a1. Expression of the same genes by hMSCs was assessed following short exposure to PEDF, 3 and 24 hours in either presence or absence of ERK or AKT inhibitor. Control cells were incubated in the same medium in absence of PEDF. Total RNA was extracted from cells using TRIzol (Invitrogen) and cDNA synthesis was performed with 1 μg of total RNA at 37°C for 50 minutes using oligo (dT) primers and reverse transcriptase (M-MLV, Invitrogen). cDNA was analyzed in a StepOnePlus Real-Time PCR system (Applied Biosystems, CA). Amplification was carried out in a total volume of 20 μl and PerfeCTa SYBR Green FastMix ROX reagents (Quanta Bioscience, MD) with the following cycling conditions: initial denaturation at 95°C for 5 minutes, followed by 40 cycles at 95°C for 3 seconds, 60°C for 30 seconds, and Melt Curve: 95°C, 15 seconds (100%); 65°C, 1 minute, 95°C 15 seconds (100%), +0.3°C/circle. The data were calculated with inline image. Primer sequences are shown in Table 1. All determinations were measured in triplicates. The cycle threshold (Ct) values corresponded to the PCR cycle number at which fluorescence emission in real time reached a threshold above the base-line emission and were analyzed. The Ct value of the PCR product of interest and a control mRNA (β-actin) was then used to calculate relative quantities of mRNA between samples.

Table 1. Primer Sequences Used for PCR Gene Analysis
GenesGene bank no. Primers (5′–3′)Product size (bp)
  1. Abbreviations: ALP, alkaline phosphatase; BMP-2, bone morphogenetic protein 2; BSP, bone sialoprotein; OCN, osteocalcin; OPN, osteopontin; OSX, osterix; PEDF, pigment epithelium-derived factor.

Beta-actinBC013380FCGTCTTCCCCTCCATCG94
  RCTCGTTAATGTCACGCAC 
OPNNM_001040060.1FGGTGATAGTGTGGTTTATGG91
  RTGATGTCCTCGTCTGTAG 
OSXNM_152860FGCCAGAAGCTGTGAAACCTC160
  RGCTGCAAGCTCTCCATAACC 
Collagen I aNM_000088FGCTTCACCTACAGCGTCACT154
  RAAGCCGAATTCCTGGTCTGG 
BMP-2NM_001200.2FTTCCACCATGAAGAATCT160
  RACTGCTATTGTTTCCTAAAG 
OCNNM_199173FCGGTGCAGAGTCCAGCAAA100
  RGGCTCCCAGCCATTGATACA 
RUNX2NM_001015051FTGGGCTTCCTGCCATCAC120
  RTTGGAGAAGCGGCTCTCAGT 
BSPNM_004967FGCATCGAAGAGTCAAAATAGAGGAT100
  RTAAATGAGGATAAAAGTAGGCATGCTT 
PEDFNM_002615.5FCATTCACCGGGCTCTCTAC162
  RGGTGCCACAAAGCTGGATT 
ALPNM_000478.4FCGTTGACACCTGGAAGAGCTT120
  RGGCTCGAAGAGACCCAATAGG 

Statistical Analysis

Data were presented as means with SD. The normality assumption was verified before conducting parametric tests. Two-way analysis of variance with appropriate Tukey post hoc tests was used to compare the difference in ALP and calcium deposition and genes and protein expressions in different groups and at different time points. Sigma Plot 10.0 (Scientific Computing, San Jose, CA) was used to execute the analysis and the significance level was set at p < .05.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. DISCUSSION
  7. Conclusion
  8. Acknowledgments
  9. Disclosure of Potential Conflicts of Interest
  10. References
  11. Supporting Information

Multipotent MSCs from Bone Marrow Exhibit Stem Cell Characteristics

The cells isolated from the bone riming possessed MSCs characteristics as demonstrated by expression of surface markers attributed to MSCs and differentiation toward osteogenic, chondrogenic, and adipogenic cell lineages in vitro as well as bone formation in vivo (Supporting Information Fig. 1S). The cells were positive for CD73, CD90, and CD105, these antigens were highly expressed by the cells at the levels above 99% (Supporting Information Fig. 1S). The cells were negative for CD11, CD34, and CD45 (Supporting Information Fig. 1S). Because there are no specific markers available for identifying MSCs, these characteristics satisfy minimum requirements for designating the cells used in this study as MSCs [31]. The cells were used as such without further purification in this report.

PEDF Induces Expression of Osteogenic Genes in hMSCs

To determine whether PEDF had an effect on MSCs osteoblastic differentiation, we first examined if PEDF had an effect on the expression of several selected osteogenic genes. MSCs incubated in DMEM supplemented with 250 ng/ml of PEDF induced expression of ALP, Runx2, OPN, OSX, OCN, BSP, BMP-2, and Col1a1 genes at the days indicated for each of the genes (Fig. 1). Control cells without PEDF supplementation were assessed at each of the time points of culture and expression of respective genes in presence and absence of PEDF was compared, results are shown (Fig. 1). These data indicate that increase in expression of osteoblastic-related genes was due to PEDF stimulation (Fig. 1).

image

Figure 1. PEDF induces expression of osteoblast marker genes in human mesenchymal stem cells (hMSCs). hMSCs incubated in maintenance medium in presence of 250 ng/ml of PEDF induced expression osteogenic marker genes at different days of incubation. ALP gene induction began at day 3 of incubation; its expression remained high to day 28 of analysis. Runx2 expression was maximal at day 7 and its expression decreased with time in culture. Osterix expression was highest at days 14 and 21. Osteopontin was expressed early beginning at day 3 and then declined thereafter. Maximal expression of osteocalcin was at day 28. BSP expression was maximal at day 7 and declined slowly to day 28. Maximal expression of BMP-2 was at day 7 and declined thereafter. The results demonstrate that PEDF stimulates expression of osteoblastic markers in hMSCs. hMSCs were incubated in Dulbecco's modified Eagle's medium supplemented with 10% FBS in presence of 250 ng/ml of PEDF. Q-PCR using specific primers was used to detect and quantify levels of mRNA specific for each of the factors indicated. NM+PEDF = normal medium supplemented with PEDF, NM = normal medium without PEDF. Data are presented as mean ± SD. n = 4, experiments done in triplicates. p values are indicated in the figure. Abbreviations: ALP, alkaline phosphatase; BMP-2, bone morphogenetic protein 2; BSP, bone sialoprotein; NM, normal medium; OCN, osteocalcin; OPN, osteopontin; OSX, osterix; PEDF, pigment epithelium-derived factor.

Download figure to PowerPoint

PEDF and MSCs Osteoblastic Differentiation

Next, we determine if PEDF had an effect on MSCs osteoblastic differentiation by examining ALP activity in MSCs exposed to PEDF. Initially, we determined the concentration of PEDF that was capable of inducing ALP activity in MSCs maintained in maintenance medium. The data showed that 250 ng/ml of PEDF induced 44% increase in ALP activity in hMSCs at day 14 of incubation (4.717 ± 0.488 U/μg protein, p = .014) in comparison to cells cultured without PEDF (3.318 ± 0.204 U/μg protein). The induction was however much lower when compared with MSCs incubated in osteogenic medium (49.673 ± 1,873 U/μg protein, p < .001) (Fig. 2A). Analysis of ALP activity was assessed for MSCs incubated in maintenance medium supplemented with 250 ng/ml of PEDF at 3, 7, and 14 days in comparison to MSCs incubated in osteogenic medium in absence of PEDF at the same time points. The data revealed that at day 14, PEDF induced an increase in ALP activity (52%, p = .034) in MSCs when compared with cells incubated in the same medium without PEDF. The ALP activity was however much lower (14.507 ± 1.288 U/μg protein, p < .001), when compared with MSCs incubated in osteogenic medium alone (38.089 ± 7.569 U/μg protein) (Fig. 2B). We then asked if PEDF would enhance ALP activity of MSCs cultured in osteogenic medium. The results showed that exposure of MSCs to PEDF in osteogenic medium enhanced expression of ALP activity by 19% (35.655 ± 1.827 U/μg protein, p = .041), in comparison to MSCs maintained in osteogenic medium alone (29.956 ± 2.100 U/μg protein). These data suggest that PEDF enhances differentiation of MSCs by regulating genes that play a role in MSCs osteogenic differentiation (Fig. 2C).

image

Figure 2. Recombinant PEDF stimulates ALP activity and increased mineral deposition in human mesenchymal stem cells (hMSCs). (A): Dose-dependent stimulation of ALP activity in MSCs incubated in maintenance medium. (A): 250 ng/ml of PEDF elicited an increase in ALP activity in hMSCs at day 14 of incubation. (B): hMSCs incubated in maintenance medium in presence of 250 ng/ml of PEDF at different days of incubation in comparison to cells incubated in osteogenic medium. At day 14, PEDF induced ALP activity in MSCs but MSCs incubated in osteogenic medium exhibited much higher ALP activity. (C): ALP activity of hMSCs supplemented with different concentrations of PEDF and incubated in osteogenic medium. hMSCs incubated in osteogenic medium and supplemented with 250 ng/ml of PEDF exhibited higher ALP activity than MSCs incubated in osteogenic medium without PEDF supplementation. ALP activity was assessed at day 14 of incubation. (D): PEDF exogenously supplied to osteogenically differentiating hMSCs deposited more mineral than the cells incubated without PEDF. hMSCs incubated in 1,250 ng/ml of PEDF deposited 50% more mineral than MSCs incubated in osteogenic medium alone. Mineral deposition was assessed by Alizarin Red (ARS) and von Kossa staining. Data are presented as mean ±SD. *, p < .05; **, p < .01. n = 4, experiments done in triplicates. Abbreviations: ALP, alkaline phosphatase; OM, osteogenic medium; PEDF, pigment epithelium-derived factor.

Download figure to PowerPoint

PEDF Enhances Mineral Deposition by hMSCs Osteoblastic Cells

We assessed whether PEDF had an effect on mineral deposition. The data revealed that exposure of MSCs to 250 ng/ml of PEDF in osteogenic medium led to 50% increase in mineral deposition (2.108 ± 0.306 OD/ml per well per 1 × 104 cells per square centimeter, in comparison to MSCs incubated in the same medium without PEDF(1.398 ± 0.098 OD/ml per well per 1 × 104 cells per square centimeter, p = .017) as determined by quantitation of Alizarin Red staining (Fig. 2D). The effect of PEDF on mineral deposition was highly significant, 50 ng/ml of PEDF enhanced mineral deposition in differentiating human MSCs by 20% (1.566 ± 0.242 OD/ml per well per 5 × 104 cells, p = .020); higher concentrations of PEDF, 1,250 ng/ml increased mineral deposition by 66% (2.328 ± 0.249 OD/ml per well per 1 × 104 cells per square centimeter, p = .016) compared to osteogenic medium only (1.398 ± 0.098 OD/ml per well per 1 × 104 cells per square centimeter) (Fig. 2D). All together, the data indicate that PEDF significantly enhances mineral deposition by MSCs osteoblastic cells.

Synthesis of PEDF by hMSCs

We assessed whether MSCs synthesize PEDF, the data showed that MSCs maintained in osteogenic medium synthesized PEDF and its synthesis increased in culture (Fig. 3A). The maximal expression was at day 14 after which it began to decline when the cells became mature osteoblasts and begin to express osteocalcin and mineralize matrix from day 21 to day 28 (Fig. 3A, 3B).

image

Figure 3. PEDF is synthesized by human mesenchymal stem cells (hMSCs) and its synthesis increases in osteogenic medium. (A): Western blot demonstrating increase of PEDF synthesis by hMSCs incubated in osteogenic medium. (B): Quantitation of PEDF synthesis by hMSCs maintained in osteogenic medium. Maximal synthesis was at day 14 and declined thereafter although still significantly higher than in hMSCs maintained in maintenance medium. Medium and cell layer were harvested, separated on SDS-PAGE, transferred to PVDF membranes, and probed with antibodies to PEDF. Data are presented as mean ±SD. *, p < .01; **, p < .001. n = 4, experiments done in triplicates. Abbreviation: PEDF, pigment epithelium-derived factor.

Download figure to PowerPoint

Suppression of PEDF Synthesis in hMSCs by siRNA

Expression of PEDF by MSCs was silenced by siRNA followed by analysis of ALP activity and mineral deposition when the cells were incubated in osteogenic medium. The data showed that siRNA suppressed PEDF expression in MSCs by 63% (p < .001) based on mRNA and protein quantitation (Fig. 4A, 4B). Following PEDF suppression, the cells were assessed for ALP activity. The data demonstrated that hMSCs with reduced PEDF expression exhibited a reduction in ALP activity and this activity was restored by supplementation with exogenous PEDF protein (Fig. 4C). The reduction in ALP activity was modest 17% (33.552 ± 2.009 U/ng protein, p = .039) in comparison to MSCs transfected with scrambled siRNA (39.269 ± 3.533 U/ng protein). Because siRNA did not suppress expression of PEDF fully it was not determined if ALP activity could be reduced further by complete suppression of PEDF expression in MSCs. Reduced PEDF expression in hMSCs resulted in significant decrease in mineral deposition by differentiating MSCs. The level of reduction in mineral deposition was approximately 40% when compared with hMSCs transfected with scrambled siRNA (0.654 ± 0.050 OD/ml per well per 1 × 104 cells per square centimeter, p = .010 of knockdown group vs. 1.152 ± 0.132 OD/ml per well per 1 × 104 cells per square centimeter of wild-type group) as assessed by Alizarin Red S staining (Fig. 4D). The reduction in mineral deposition was restored by incubation of the cells in presence of 250 ng/ml of PEDF to 28 days (Fig. 4D). These data indicate that PEDF secreted by differentiating MSCs plays important role in mineral deposition and that PEDF functions in autocrine manner.

image

Figure 4. Effects of knockdown of PEDF on ALP activity and mineral deposition in human mesenchymal stem cells (hMSCs). (A): PEDF mRNA expression in hMSCs was reduced by transfection with siRNA. (B): Synthesis of PEDF was decreased to 70% in hMSCs transfected with siRNA targeted to PEDF. (C): ALP activity of hMSCs with PED knockdown was significantly reduced and was rescued by supplementation with exogenous PEDF. (D): Mineral deposition by hMSCs deficient in PEDF expression was reduced to 50% of hMSCs transfected with scrambled siRNA (Mock). Reduced mineral deposition was restored by exogenous PEDF protein. The data indicate that PEDF is necessary for MSCs differentiation and mineral deposition. Data are presented as mean ±SD. *, p < .05; **, p < .01. n = 4, experiments done in triplicates. Abbreviations: ALP, alkaline phosphatase; OM, osteogenic medium; PEDF, pigment epithelium-derived factor.

Download figure to PowerPoint

ERK and AKT Signaling

The mechanism by which PEDF plays a role in osteogenesis is not known. The hypothesis from these studies is that PEDF regulates genes that play a role in osteogenesis. Because PEDF has been shown to signal through ERK/MAPK pathway in other systems, we assessed whether it activates this pathway to regulate osteogenic genes. hMSCs treated with PEDF activated ERK phosphorylation as well as AKT, suggesting that PEDF regulates osteogenesis through these pathways (Fig. 5). Inhibition of ERK and AKT activation following exposure to PEDF demonstrated specificity of PEDF in activating these pathways (Fig. 5). These data indicated that PEDF signals through ERK and AKT pathways to enhance MSCs differentiation and mineral deposition.

image

Figure 5. Immunoblotting analyses of pigment epithelium-derived factor (PEDF)-mediated activation of ERK and AKT signaling pathways in human mesenchymal stem cells (hMSCs). Incubation of hMSCs in presence of PEDF at 250 ng/ml activated ERK and AKT signaling pathways. ERK docking domain inhibitor (294675-79-9) and AKT kinase inhibitor (612847-09-3) blocked activation of ERK and AKT following exposure of hMSCs to PEDF.

Download figure to PowerPoint

PEDF Activates ERK/MAPK and AKT Signaling and Regulates Osteoblastic Gene Expression

Next, we asked whether ERK/MAP and AKT activation had an effect on expression of osteogenic genes. Exposure of human MSCs to PEDF induced expression of genes that play a role in osteogenic differentiation (Fig. 6). Inhibition of ERK following PEDF activation decreased expression of osteogenic genes thus indicating that PEDF regulates expression of these genes through ERK signaling pathway. The results from ERK and AKT signaling suggest PEDF enhances expression of genes that play a role in osteogenesis through these pathways.

image

Figure 6. Real-time RT-PCR and ERK and AKT signaling analyses of osteogenic marker expression by human mesenchymal stem cells (hMSCs) exposed to PEDF. hMSCs incubated in a medium supplemented with 250 ng/ml of PEDF induced expression of osteoblasts markers via ERK and AKT signaling pathways. The genes assessed were for ALP, OCN, BSP, OPN, BMP-2, OSX, and Col1a2. Inhibition of ERK downregulated expression of RUNX2 at 3 hours but it rebounded by 24 hours. Blocking ERK with specific inhibitor reduced expression of respective genes; blocking AKT signaling pathway maintained gene expression indicating that ERK and AKT play a role in regulation of osteogenic genes. Data are presented as mean ± SD. *, p < .01; **, p < .001. n = 4, experiments done in triplicate. Abbreviations: ALP, alkaline phosphatase; BMP-2, bone morphogenetic protein 2; BSP, bone sialoprotein; OCN, osteocalcin; OPN, osteopontin; OSX, osterix; PEDF, pigment epithelium-derived factor.

Download figure to PowerPoint

DISCUSSION

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. DISCUSSION
  7. Conclusion
  8. Acknowledgments
  9. Disclosure of Potential Conflicts of Interest
  10. References
  11. Supporting Information

In this report, we have shown that PEDF enhances expression of genes that play a role in osteoblasts differentiation and mineral deposition. Examination of effects of PEDF on MSCs differentiation as assessed by ALP activity showed that PEDF alone weakly induced MSCs differentiation at day 14 of culture. Addition of PEDF to osteogenic differentiating MSCs enhanced expression of ALP activity and this activity was higher than in MSCs maintained in osteogenic medium without PEDF supplementation. These data suggested that PEDF enhances MSCs differentiation and bone deposition by enhancing expression of genes and proteins that play a role in osteogenesis. The effect of PEDF on osteogenesis was more pronounced on mineral deposition. The data suggest that PEDF enhances the process of osteogenesis by induction of MSCs osteoblastic maturation. PEDF may accomplish MSCs osteoblastic maturation by accelerating MSCs differentiation through enhancing expression of genes that participate in osteoblastic differentiation.

PEDF is synthesized by many cell types thus it is not specific for MSCs [4, 32, 33]. Analysis of PEDF synthesis by MSCs in osteogenic culture showed that PEDF increases in synthesis during culture. However, its synthesis declined as the cells began to deposit mineral. These data suggest that PEDF is highly expressed by osteoprogenitors and support the hypothesis that it enhances osteogenic primed cells to osteoblastic differentiation.

Suppression of PEDF synthesis in MSCs using siRNA led to decreased ALP activity and significant reduction in mineral deposition. These activities were restored by exogenous supply of PEDF. These data suggest that PEDF functions extracellularly in autocrine fashion by binding to specific receptors on MSCs and thereby initiating cellular osteogenic activities. Interestingly, murine MSCs were not responsive to PEDF (data not shown). Because we used a human recombinant protein, it is likely that murine MSCs do not respond to human PEDF. But PEDF sequence is conserved among species [34, 35], these data may also mean that murine MSCs do not respond to PEDF to initiate osteogenesis. Nevertheless, these findings that reduced PEDF expression in MSCs leads to significant reduction in mineral deposition are in agreement with the findings that bone matrix of patients with OI type VI are under-mineralized [14, 15].

In these studies, we investigated whether PEDF signals through ERK and AKT signaling pathways to regulate osteogenic genes that play a role in hMSCs differentiation. The data showed that PEDF signals through ERK/MAPK and AKT signaling pathways in MSCs to enhance osteoblastic gene expression and mineral deposition. Activation of ERK/MAPK and AKT signaling cascades has been demonstrated to be associated with osteogenic differentiation and cellular signaling events [36-44]. This report is the first to demonstrate that these pathways play a role in PEDF-regulated differentiation of hMSCs toward osteoblasts. As one of the major signaling pathways in bone, the ERK/MAPK pathway is able to integrate stimuli from a variety of signals initiated by cell-Extracellular matrix binding, hormone/growth factor signaling, and mechanical loading [37, 45, 46]. It also has important functions in the differentiation of postmitotic mesenchymal and neuronal cells [47, 48] and regulates the activity of several tissue-specific transcription factors including muscle-related MyoD [49, 50], chondrogenic-related Sox9 [51-53], adipogenic-related peroxisome proliferator-activated receptor γ [54, 55], and osteogenic-related RunX2 and OSX [39, 40]. AKT signaling pathway has been shown to play a role during BMP-2-induced proliferation and osteogenic differentiation of MSCs [56-59]. Here, we have shown that addition of PEDF to hMSCs upregulated mRNA expression of osteogenic-related genes RUNX2, OSX, OPN, OCN, ALP, Col1A2, and BSP. We did not determine specific gene targets of PEDF that initiate expression of osteogenic genes; it is however, likely that either Runx2 or OSX may be the gene targets for PEDF. Previous reports indicated endogenous RUNX2 activity in endothelial cells through a phosphatidylinositol 3-kinase/ERK-dependent and Akt-independent signaling pathway [56]. In this report, we have shown that addition of PEDF to hMSCs maintained in regular medium up to day 7 did not accelerate cell proliferation (data not shown) and there was limited differentiation at this time period. Induction of ALP activity was more apparent on day 14. These data suggest that PEDF regulates MSCs differentiation through ERK signaling pathway and AKT pathway may play a role of inhibiting differentiation at early stages.

Future studies will examine if other pathways, for example, Wnt signaling, are activated by PEDF. The results from these studies however suggest that PEDF could be a potential therapeutic anabolic agent for osteoporosis or other bone-related diseases. The data also suggest that OI type VI could be treated by supplying the protein to the patients.

Conclusion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. DISCUSSION
  7. Conclusion
  8. Acknowledgments
  9. Disclosure of Potential Conflicts of Interest
  10. References
  11. Supporting Information

In summary, we have demonstrated that PEDF enhances expression of hMSCs osteogenic genes and mineral deposition. The mechanisms by which PEDF accomplishes these activities appear to be through ERK/MAPK and AKT signaling pathways. PEDF exhibited a major effect on mineral deposition by differentiating MSCs suggesting that it may play an important role in MSCs osteoblastic maturation.

Acknowledgments

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. DISCUSSION
  7. Conclusion
  8. Acknowledgments
  9. Disclosure of Potential Conflicts of Interest
  10. References
  11. Supporting Information

We would like to thank Dr. Charles Davis for supplying bone marrow for cell isolation and support from department of Orthopaedics and Rehabilitation, Penn State College of Medicine.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. DISCUSSION
  7. Conclusion
  8. Acknowledgments
  9. Disclosure of Potential Conflicts of Interest
  10. References
  11. Supporting Information

Supporting Information

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. DISCUSSION
  7. Conclusion
  8. Acknowledgments
  9. Disclosure of Potential Conflicts of Interest
  10. References
  11. Supporting Information

Additional Supporting Information may be found in the online version of this article.

FilenameFormatSizeDescription
stem1505-sup-0001-suppfig.tif1568KSupporting Information Figure

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.