SEARCH

SEARCH BY CITATION

Keywords:

  • Mesenchymal stem cells;
  • Toll-like receptor 3;
  • MiR-143;
  • Sepsis

Abstract

  1. Top of page
  2. A
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgments
  9. Author Contributions
  10. Disclosure of Potential Conflicts of Interest
  11. References
  12. Supporting Information

Mesenchymal stem cells (MSCs) are attractive candidates for clinical therapeutic applications. Recent studies indicate MSCs express active Toll-like receptors (TLRs), but their effect on MSCs and the underlying mechanisms remain unclear. In this study, we found that, after treating human umbilical cord MSCs with various TLR ligands, only TLR3 ligand, poly(I:C), could significantly increase the expression of cyclooxygenase-2 (COX-2). Furthermore, poly(I:C) could enhance MSCs' anti-inflammatory effect on macrophages. Next, we focused on the regulatory roles of microRNAs (miRNAs) in the process of poly(I:C) activating MSCs. Our experiments indicated that miR-143 expression was significantly decreased in MSCs with poly(I:C) treatment, and the expression level of miR-143 could regulate the effect of poly(I:C) on MSCs' immunosuppressive function. Subsequent results showed that the reporter genes with putative miR-143 binding sites from the transforming growth factor-β-activated kinase-1 (TAK1) and COX-2 3′ untranslated regions were downregulated in the presence of miR-143. In addition, mRNA and protein expression of TAK1 and COX-2 in MSCs was also downregulated with miR-143 overexpression, suggesting that TAK1 and COX-2 are target genes of miR-143 in MSCs. Consistent with miR-143 overexpression, TAK1 interference also attenuated MSCs' immunosuppressive function enhanced by poly(I:C). Additionally, it was shown that TLR3-activated MSCs could improve survival in cecal ligation and puncture (CLP)-induced sepsis, while miR-143 overexpression reduced the effectiveness of this therapy. These results proved that poly(I:C) improved the immunosuppressive abilities of MSCs, revealed the regulatory role of miRNAs in the process, and may provide an opportunity for potential novel therapies for sepsis. Stem Cells 2014;32:521–533


Introduction

  1. Top of page
  2. A
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgments
  9. Author Contributions
  10. Disclosure of Potential Conflicts of Interest
  11. References
  12. Supporting Information

Mesenchymal stem cells (MSCs) are multipotent progenitor cells, which can differentiate into various cell types, such as osteoblasts, adipocytes, and chondroblasts, and are easily expanded and stored ex vivo [1, 2]. MSCs are considered to be immune-privileged as they express low levels of cell-surface Human leukocyte antigen (HLA) class I molecules and do not express HLA class II or costimulatory molecules, such as CD40, CD80, and CD86 [3, 4]. MSCs are also shown to exert a strong inhibitory effect on other cells belonging to either innate or adaptive immunity [5], including T cells [6-8], B cells [9, 10], NK cells [11, 12] and dendritic cells (DCs) [13, 14]. The public clinical trials database (http://clinicaltrials.gov) shows 333 clinical trials using MSCs for various types of therapeutic applications, 198 of which are open studies (accessed 20/6/2013), including those related to tissue repair and immune conditions that use MSCs' immunosuppressive properties [15-17]. As a result of these unique qualities, MSCs are attractive candidates for clinical therapeutic applications.

The immunoregulatory mechanisms of MSCs are generally considered taking effect mainly through cell contact and secretion of immunomodulatory factors such as prostaglandin E2 (PGE2), indoleamine 2,3-dioxygenase (IDO), transforming growth factor-β (TGF-β), and interleukin-6 (IL-6). Previous studies indicated that Toll-like receptor (TLR) activation in immune cells could induce the production of mentioned downstream cytokines. Moreover, recent studies indicated that MSCs express active TLRs, although the pattern of TLR expression is controversial [18-20]. Accordingly, we hypothesize that TLR activation can influence the immunoregulatory function of MSCs. Besides, TLR activation has been implicated in the pathology of a number of inflammatory diseases including rheumatoid arthritis and inflammatory bowel disease [21, 22]. Consequently, MSCs will be continuously exposed to TLR ligands when used in cell therapy for the treatment of inflammatory diseases. Therefore, it is deserved to further investigate the potential effects of TLR signaling on MSCs and their potential implications in the immunogenicity and immunosuppressive capacity, which are of special relevance in terms of therapeutic potency.

Sepsis, a common and frequently fatal condition with over 750,000 new cases and more than 200,000 deaths annually [23], is characterized by overwhelming systemic inflammation caused by severe infection. Widespread activation of inflammatory and coagulation responses progresses to multiple organ dysfunction, septic shock, and death. Despite appropriate antimicrobial therapy, sepsis-related morbidity and mortality remain intractable problems in critically ill patients. Novel therapeutic strategies are desperately needed to improve clinical outcome. In the last few years, it has been discovered that intrapulmonary delivery or i.v. injection of MSCs could attenuate endotoxin or live Escherichia coli-induced acute lung injury [24-29]. More importantly, there is new evidence that systemic administration of MSCs has beneficial effects in clinically relevant models of polymicrobial sepsis [30-33]. The protective role of MSCs in these studies has been attributed primarily to their immunomodulatory properties mediated by soluble paracrine factors such as PGE2 and IL-10. This study proved that TLR3 ligand, poly(I:C), could enhance the production of soluble immunosuppressive factors including PGE2, IDO, IL-6, and IL-8 in MSCs as well as enhance the inhibitive effect of MSCs on the production of proinflammatory cytokines in murine macrophages. Thus, we hypothesize that MSCs, pretreated with poly(I:C), would have enhanced immunomodulatory properties and exert more effective therapeutic effects on attenuating sepsis-associated inflammation, organ injury, and mortality in a clinically relevant model of sepsis.

In this study, we investigated the effects of TLR ligands on MSCs and the regulatory role of microRNAs (miRNAs) in the process. We found that TLR3 ligand, poly(I:C), promoted the production of soluble immunosuppressive factors. Meanwhile, it also enhanced the inhibitory effect of MSCs on macrophages through decreasing the expression of miR-143. Moreover, we found that TLR3-activated MSCs could more efficiently reduce sepsis-induced inflammation and organ dysfunction, and thereby improve survival in cecal ligation and puncture (CLP)-induced sepsis, while miR-143 attenuated this MSC-based therapy.

Materials and Methods

  1. Top of page
  2. A
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgments
  9. Author Contributions
  10. Disclosure of Potential Conflicts of Interest
  11. References
  12. Supporting Information

Isolation and Culture of Umbilical Cord-MSCs

Fresh human umbilical cords were obtained from full-term caesarian section births from the Department of Gynecology and Obstetrics, the Affiliated Drum Tower Hospital of Nanjing University Medical School, and collected in sterile phosphate-buffered saline (PBS) at 4°C. MSCs were isolated from human umbilical cords as previously described [34]. In brief, the umbilical cords were rinsed twice by PBS with antibiotics (penicillin 100 µg/mL and streptomycin 10 µg/mL; Invitrogen, Carlsbad, CA, http://www.invitrogen.com), and then umbilical arteries and veins were removed. The washed cords were cut into 1–2 mm3 pieces and floated in Dulbecco's modified Eagle's medium/Nutrient F-12 Ham's (Gibco, Grand Island, NY, http://www.invitrogen.com). The pieces of cords were subsequently digested by mixed enzyme (hyaluronidase 5 U/mL, collagenase 125 U/mL, and dispase 50 U/mL; Sigma-Aldrich, St. Louis, MO, http://www.sigmaaldrich.com) and incubated with gentle agitation at 37°C for 3 hours. Human umbilical cord MSCs (UC-MSCs) were harvested and planted into culture flask. The medium was replaced every 3 days after the initial planting. When well-developed colonies of fibroblast-like cells appeared after 7 days, the cultures were trypsinized and passaged into a new flask for further expansion, and the medium was replaced every 2 days ever since. MSCs between passage 4 and 7 were used for subsequent experiments.

Cell Viability and Apoptosis Analysis

Cell viability was assessed by a Cell Counting Kit 8 (Dojindo Laboratories Inc., Japan, http://www.dojindo.com) according to the recommendations of the manufacturer. Apoptosis was assayed with an Annexin V-FITC & PI Apoptosis kit (Biouniquer, China, http://www.biouniquer.com) according to the recommendations of the manufacturer.

Flow Cytometric Analysis

MSCs were stained with phycoerythrin (PE)-conjugated CD29, CD44 and HLA-DR, or fluorescein isothiocyanate (FITC)-conjugated CD31, CD45, or allophycocyanin (APC)-conjugated CD105, or isotype-matched controls. Macrophages were labeled with PE-conjugated tumor necrosis factor-α (TNF-α), IL-1β, monocyte chemoattractant protein 1 (MCP-1), or isotype-matched controls (BD Biosciences, San Diego, http://www.bdbiosciences.com). Fluorescence was measured using a FACSCalibur (Becton Dickinson, Franklin Lakes, NJ, http://www.bd.com). Data were analyzed using CELLQuest software (Becton Dickinson) or FlowJo software (Treestar, Inc., San Carlos, CA, http://www.treestar.com).

Reverse Transcription PCR and Quantitative Real-Time PCR Analysis

Total RNA was extracted using the TRIzol reagent (Invitrogen) according to the manufacturer's instructions. RNA concentrations were quantified by SmartSpecTM Plus spectrophotometer (Bio-Rad, Hercules, CA, http://www.bio-rad.com) at 260 nm. RNA integrity was determined using formaldehyde denaturalization agarose gel electrophoresis. The method to quantify mRNA and miRNA was performed as described previously [34, 35]. The primer sequences used for amplification were synthesized by Invitrogen and were listed in Table 1.

Table 1. MicroRNA and mRNA primer information
Gene nameForward primer (5′-3′)Reverse primer (5′-3′)
  1. Abbreviations: COX-2, cyclo-oxygenase 2; IDO, indoleamine 2,3-dioxygenase; IL-6, interleukin-6; TAK-1, transforming growth factor-β-activated kinase-1; TGF-β, transforming growth factor β; UTR, untranslated region.

Hsa-miR-143ACACTCCAGCTGGGTGAGATGAAGCACCTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGAGCTACA
Hsa-miR-10ACACTCCAGCTGGGTACCCTGTAGATCCGAATTTGTGCTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCACAAATTC
Hsa-miR-146aACACTCCAGCTGGGTGAGAACTGAATTCCATGGGTTCTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAACCCATGG
Hsa-miR-125bACACTCCAGCTGGGTCCCTGAGACCCTAACTTGTGACTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTCACAAGTT
Hsa-miR-194ACACTCCAGCTGGGTGTAACAGCAACTCCATGTGGACTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTCCACATGG
U6snRNACTCGCTTCGGCAGCACAAACGCTTCACGAATTTGCGT
URPTGGTGTCGTGGAGTCG 
TAK1–3′UTRTTATCTAGAGGAAAACCTTATAATGACGATTCCAATCTAGAGAGAAAACAATCCAAGAATCAC
COX-2–3′UTRCAGTCTAGAACTGCTATTTAGCTCCTCGAATCTAGATTATCTGTAATCAGCGTTTG
TAK1GACCTGAAACCACCAAACTTCCCAAAGAATAATACCC
IL-6TAGTGAGGAACAAGCCAGAGGCTACATTTGCCGAAGAG
TGF-βCAGCAACAATTCCTGGCGATACGCTAAGGCGAAAGCCCTCAAT
IDOGATGTCCGTAAGGTCTTGCCATGCAGTCTCCATCACGAAATG
COX-2TTACAATGCTGACTATGGCTACCTGATGCGTGAAGTGCTG
GAPDHAGAAGGCTGGGGCTCATTTGAGGGGCCATCCACAGTCTTC

Western Blotting and ELISA

The method of Western blotting was performed as described previously [36]. Anti-human transforming growth factor-β activated kinase-1 (TAK1), COX-2, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) for Western blot analysis were purchased from Cell Signaling Technology Inc. (Danvers, MA, http://www.cellsignal.com).

Secretion of human IL-6 and IL-8 in culture supernatants was determined by enzyme-linked immunosorbent assays (ELISA). PGE2 was quantified using a specific ELISA (Dakewe, Beijing, China, http://www.dakewe.com).

Plasmids Construction

Human genomic DNA served as template to amplify TAK1-3′untranslated region (UTR) and COX-2-3′UTR. The amplified polymerase chain reaction (PCR) products were gel-purified and digested with XbaI (Takara, Otsu, Japan, http://www.takara.co.jp). They were inserted into XbaI sites of the PGL3 vector (Promega, Madison, WI, http://www.promega.com), resulting in PGL3-TAK1-3UTR and PGL3-COX-2-3UTR.

Transient Transfection and Reporter Assay

MiR-143-specific precursor, pre-miR-143 (Pre-143), pre-miR control #1 (Pre-NC), miR-143-specific inhibitor, anti-miR-143 (Anti-143), and anti-miR negative control #1 (Anti-NC) were obtained from Ambion (Austin, TX, http://www.ambion.com). Three small interfering RNA (siRNA) sequences used for silencing human TAK1 and the siRNA negative control were obtained from RiboBio (Guangzhou, China, www.ribobio.com). The sense sequences of the siRNA duplex were as follows: for siTAK1-001, 5-GGUAGUAAU UACAGUGAAAdTdT-3; for siTKA1-002, 5-GAGUGAAUCUG GACGUUUAdTdT-3; and for siTAK1-003, 5-GGAGUUGUUUG CAAAGCUAdTdT-3. The miRNAs and siRNAs were facilitated by Lipofectamine 2000 according to the recommendations of the manufacturer (Invitrogen).

HEK293A cells were cotransfected with the luciferase reporter constructs described above (200 ng), pRL-CMV (20 ng, Promega), and the appropriate miRNA. After 36 hours, the cells were washed and lysed with passive lysis buffer (Promega), and f-luc and Renilla luciferase (r-luc) activities were determined using the dual-luciferase reporter assay system (Promega). The relative reporter activity was obtained by normalization to the r-luc activity.

CLP Model of Sepsis

C57BL/6 male mice (25–30 g) were purchased from the Animal Model Research Institute of Nanjing University (Nanjing, China). Mice were fed a standard rodent chow diet and bred in a pathogen-free barrier facility. Procedures for animal care and use in this study were approved by the Committee on the Ethics of Animal Experiments of Nanjing University. We performed CLP as previously described [37]. Mice were randomly assigned to injections of sterile saline or MSCs into the tail vein 1 hour after the operation. In the sham-operated group and the CLP group, 100 µL sterile saline was administrated. In the three MSC-treated groups, 1 × 106 control MSCs (C-MSCs), poly(I:C)-pretreated MSCs (P-MSCs), and poly(I:C)-pretreated Pre-143-transfected MSCs (P-143-MSCs) in 100 µL sterile saline were administrated, respectively, after the CLP procedure. At the end of the experiment, the mice were humanely sacrificed for collection of samples. Poly(I:C) (10 µg/mL) used in our research was purchased from Invivogen (San Diego, CA).

Statistical Analysis

Data were analyzed with Prism 5 (GraphPad Software, Inc., San Diego, CA) and expressed as means ± SEM. Statistical significance between groups was analyzed by one-way ANOVA followed by the Student-Newman-Keuls multiple comparison tests. Differences with p < .05 were considered significant.

Results

  1. Top of page
  2. A
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgments
  9. Author Contributions
  10. Disclosure of Potential Conflicts of Interest
  11. References
  12. Supporting Information

Expression of TLRs in Human UC-MSCs

The expression of TLRs in MSCs remains controversial. In our experiments, PCR primers specific to TLR-1 to TLR-10 were designed to detect the expression of TLRs from total RNA in UC-MSCs. As shown in Figure 1A, all the TLRs were detected except TLR7, among which TLR3 was highly expressed.

image

Figure 1. TLR-specific ligands induce cytokine production in UC-MSCs. (A): Relative expression of TLR1–10 mRNA in MSCs measured by quantitative polymerase chain reaction (qPCR). MSCs were treated with poly(I:C), LPS, R848, or CpG for 6 hours, 12 hours, or 24 hours, respectively. MSCs without the treatment of TLR ligands were used as control. Then mRNAs were collected, and relative expression of COX-2 (B), IL-6 (C), IDO (D), IL-8 (E), and TGF-β (F) were measured by qPCR. Results of three independent experiments each performed in triplicate are shown. *, p < .05; **, p < .01; ***, p < .001, TLR ligands-treated groups versus control. Abbreviations: COX-2, prostaglandin-endoperoxide synthase 2/cyclo-oxygenase 2; IDO, indoleamine 2,3-dioxygenase; IL, interleukin; LPS, lipopolysaccharide; MSCs, mesenchymal stem cells; TGFβ, transforming growth factor β; TLR, Toll-like receptor; UC-MSC, MSCs from umbilical cord tissues.

Download figure to PowerPoint

Poly(I:C) Enhances the Expression of COX-2, IDO, IL-6, and IL-8 in MSCs

At present, the effect of TLR ligands on the immunoregulatory function of MSCs remains unclear. As is known, MSCs can exert immunosuppressive properties by secreting several soluble factors. To determine the effect of TLR ligation on the expression of these secreted soluble factors in MSCs, we stimulated MSCs with the ligands of TLR3, TLR4, TLR8, and TLR9, which are poly(I:C) (10 µg/mL), lipopolysaccharide (LPS) (1 µg/mL), R848 (3 µg/mL), and CpG (2 µg/mL), respectively. Then the expression of IL-6, IL-8, COX-2, IDO, and TGF-β in MSCs at 6 hours, 12 hours, and 24 hours was measured by quantitative PCR (qPCR). PGE2, IDO, and TGF-β are considered as important immunomodulatory factors produced by MSCs. COX-2 is the key molecule in the synthesis and generation of PGE2. IL-6 and IL-8 are the primary proinflammatory cytokines produced by MSCs. Moreover, IL-6 is considered to be involved in the immunoregulatory mechanism mediated by MSCs through a partial inhibition of DC differentiation. Our results indicated that, compared with control, poly(I:C) significantly promoted the expression of COX-2 (2.5-fold) in MSCs, while LPS and R848 had little effect on its expression, but CpG exerted inhibitive effect (Fig. 1B). As shown in Figure 1D, poly(I:C) had more significantly promotive effects on the expression of IDO (273-fold higher than control), compared with LPS (31-fold), R848 (41-fold), and CpG (44-fold). Poly(I:C) and LPS exposure upregulated the expression of IL-6 and IL-8, while R848 increased the expression of IL-6 without affecting IL-8. By contrast, CpG inhibited the expression of IL-8 without affecting IL-6 (Fig. 1C, 1E). Besides, we also discovered that the expression of TGF-β in MSCs decreased after stimulated by all the TLR ligands (Fig. 1F). The upregulation of COX-2, IDO, and IL-6 suggested that the activation of TLR3 by poly(I:C) may enhance the immunosuppressive properties of MSCs.

Poly(I:C) Can Enhance the Immunosuppressive Function of MSCs by Suppressing MiR-143

In order to exclude the influence of cell proliferation or apoptosis in the regulation of the immunosuppressive function of MSCs by poly(I:C), we examined the effect of poly(I:C) on cell proliferation and apoptosis of MSCs and found that poly(I:C) did not affect the phenotype or proliferation of MSCs, and the concentration of poly(I:C) used in our experiments did not cause MSC apoptosis (Supporting Information Fig. 1). To understand how poly(I:C) regulates MSCs immune function, we focused on TNF receptor-associated factor 6 (TRAF6) and TAK1 which were known as the key factors in TLR3 signaling pathway that would cause the production of cytokines and soluble immunoregulatory factors and studied whether miRNAs participate in the regulation of the immunosuppressive function of MSCs induced by poly(I:C). To find the miRNAs that target at the 3′UTR of TRAF6 and TAK1, we used Targetscan (http://www.targetscan.org) and PITA (http://genie.weizmann.ac.il/pubs/mir07/mir07_prediction.html) to identify candidate miRNAs. We found several miRNAs with most potential that can bind to the 3′UTR noncoding regions of TRAF6 (miR-125b, miR-146a, miR-194) and TAK1 (miR-10, miR-143). The expression of these miRNAs in MSCs with the treatment of poly(I:C) was examined. The results indicated that, compared with other miRNAs, the expression of miR-143 was decreased significantly with 80% reduction 24 hours after the stimulation of poly(I:C) (Fig. 2A). This suggested us that miR-143 may affect the production of soluble immunosuppressive factors of MSCs via affecting TAK1 in TLR3 signaling pathway.

image

Figure 2. Poly(I:C) affects the immunosuppressive properties of MSCs through suppressing miR-143 in vitro. (A): Quantitative polymerase chain reaction (qPCR) analysis of miR-143, miR-125b, miR-10, miR-194, and miR-146a expression in human MSCs after activated by poly(I:C). qPCR analysis of COX-2 (B), IDO (C), IL-8 (D), IL-6 (E) mRNA expression in Pre-143-transfected and Anti-143-transfected MSCs. The secretion levels of IL-6 (F), IL-8 (G), and PGE2 (H) protein in Pre-143-transfected and Anti-143-transfected MSCs. MSCs were transfected with Pre-143 and activated by poly(I:C) for 24 hours and then cocultured in vitro with mouse peritoneal macrophages and stimulated with LPS. The production of TNF-α (I), MCP-1 (J), and IL-1β (K) in macrophages was examined by flow cytometry. Results of three independent experiments each performed in triplicate are shown. *, p < .05; **, p < .01; ***, p < .001. Abbreviations: Anti-NC, anti-miR negative control; Anti-143, anti-miR-143, miR-143-specific inhibitor; COX-2, prostaglandin-endoperoxide synthase 2/cyclo-oxygenase 2; IDO, indoleamine 2,3-dioxygenase; IL, interleukin; LPS, lipopolysaccharide; MSC, mesenchymal stem cells; MFI, mean fluorescence intensity; Mφ, macrophages; MCP-1, monocyte chemoattractant protein 1; NC-MSC, MSCs transfected with Pre-NC; Pre-NC, pre-miR negative control; Pre-143, pre-miR-143, miR-143-specific precursor; PGE2, prostaglandin E2; P-NC-MSC, MSCs transfected with Pre-NC and stimulated by poly(I:C); P-Pre-143-MSC, MSCs transfected with Pre-143 and stimulated by poly(I:C); TNFα, tumor necrosis factor-α.

Download figure to PowerPoint

To discover the role of miR-143 in MSC function, pre-miR-143 (Pre-143) and anti-miR-143 (Anti-143) were transfected into MSCs, and the transfection efficiency was measured (Supporting Information Fig. 2B). The mRNA expression levels of miR-143 were clearly increased and decreased after Pre-143 and Anti-143 transfection, respectively (Supporting Information Fig. 2A). The cell phenotype, proliferation, and apoptosis of MSCs were examined by flow cytometry. Results showed that Pre-143-transfected and Anti-143-transfected MSCs maintained similar phenotypic surface antigens to control MSCs (Supporting Information Fig. 2C). It was also found that neither elevation nor reduction of miR-143 expression affected MSC proliferation and apoptosis (Supporting Information Fig. 2D, 2E).

Subsequently, to test whether miR-143 affects the immunoregulatory function of MSCs, mRNA expression levels of immunosuppressive factors were examined. As shown in Figure 2B–2E, the expressions of COX-2, IDO, IL-6, and IL-8 mRNA were decreased significantly in Pre-143-transfected MSCs compared with those in Pre-NC-transfected ones in the presence of poly(I:C). Pre-143-transfected MSCs also secreted less IL-6, IL-8, and PGE2 protein than Pre-NC-transfected ones in the presence of poly(I:C) (Fig. 2F–2H). Furthermore, Pre-143 transfection alone also suppressed the production of mRNA and protein for these factors in MSCs, while Anti-143 transfection enhanced their production. However, IDO protein could not be detected by ELISA in MSCs transfected with Pre-143 or Anti-143 (data not shown).

For further verification, Pre-143-transfected and Anti-143-transfected MSCs were pretreated with poly(I:C) and then cocultured in vitro with mouse peritoneal macrophages. As shown in Figure 2I, 2J, LPS could induce the production of TNF-α, MCP-1, and IL-1β in macrophages. Importantly, when pretreated with poly(I:C), MSCs could more significantly suppress the production of these inflammatory cytokines in macrophages, while Pre-143 transfection attenuated the effect of poly(I:C) (Fig. 2I–2K). The above data suggested that poly(I:C) can enhance the immunosuppressive function of MSCs by suppressing miR-143, while high expression of miR-143 attenuates the effect of poly(I:C).

MiR-143 Involves in the Regulatory Effect of Poly(I:C) on the Immunosuppressive Function of MSCs by Targeting at TAK1

According to the Targetscan database, the target site in TAK1–3′-UTR and COX-2–3′UTR is conserved in vertebrates and partially complementary to miR-143 (Fig. 3A). The luciferase reporter system was used to validate the target site. TAK1–3′UTR, which contains a putative miR-143 binding site, was subcloned downstream of the f-luc open reading frame in the PGL3 vector. The complete COX-2–3′UTR was subcloned similarly. These reporter constructs (PGL3-TAK1–3′UTR and PGL3-COX-2–3′UTR) were each cotransfected in the HEK293A cell line with pRL-CMV (to normalize for transfection differences) and either Pre-143, Pre-NC, Anti-143, or Anti-NC. Compared with the negative control, overexpression of miR-143 resulted in a 54% reduction of luciferase activity in cells cotransfected with PGL3-TAK1–3′UTR and a 39% reduction in cells cotransfected with PGL3-COX-2-3′UTR. Inhibiting the expression of miR-143 induced a 1.7-fold higher luciferase activity in cells cotransfected with PGL3-TAK1-3′UTR and a 1.3-fold higher luciferase activity in cells cotransfected with PGL3-COX-2-3′UTR (Fig. 3B). Subsequently, mRNA and protein expression levels of TAK1 and COX-2 in MSCs transfected with Pre-143 and Anti-143 were also examined by quantitative real-time PCR and Western blot analysis. Consistent with the luciferase activity findings, miR-143 overexpression also caused significant downregulation of TAK1 and COX-2 mRNA and protein levels. Inhibiting the expression of miR-143 caused significant upregulation of TAK1 and COX-2 mRNA (Fig. 3C) and protein levels (Fig. 3D). These results confirmed that TAK1 and COX-2 are target genes of miR-143.

image

Figure 3. miR-143 targets TLR3 signaling pathway members TAK1 and COX-2. (A): Predicted consequential pairing of target region and miR-143 with Targetscan. (B): Direct recognition of TAK1 and COX-2 3′-UTR by miR-143 was assayed by luciferase assay kits. (C): Quantitative polymerase chain reaction analysis of the expression of predicted target genes TAK1 and COX-2 24 hours after Pre-143 and Anti-143 transfection of MSCs. (D): Analysis of the expression of miR-143 target genes TAK1 and COX-2 by Western blot 48 hours after Pre-143 and Anti-143 transfection of MSCs. *, p < .05; **, p < .01; ***, p < .001. Abbreviations: Anti-NC anti-miR negative control; Anti-143, anti-miR-143, miR-143 specific inhibitor; COX-2, prostaglandin-endoperoxide synthase 2/cyclo-oxygenase 2; Pre-NC, pre-miR negative control; Pre-143, pre-miR-143, miR-143 specific precursor; TAK1, TGF-beta activated kinase 1; UTR, untranslated region.

Download figure to PowerPoint

Since TAK1 is the target gene of miR-143, to investigate whether miR-143 affects TLR3 signaling pathway via regulating TAK1, we designed three TAK1 small interfering RNAs (siTAK1). Each of the siTAK1-001, siTAK1–002, and siTAK1–003 significantly reduced the levels of TAK1 mRNA and protein (Fig. 4A, 4B), without interfering with cell proliferation (Supporting Information Fig. 3). siTAK1-001 was chosen to be used in subsequent experiments. Our results indicated that, with the treatment of poly(I:C), the production of IL-6, IL-8, COX-2, and IDO was significantly diminished in MSCs transfected with siTAK1, compared with MSCs transfected with negative control siRNA (siNC) (Fig. 4C–4F). Since TAK1 interference and miR-143 overexpression both affect the production of immunoregulatory factors of MSCs, it is considerable whether TAK1 interference also affects the regulation function of MSCs on macrophages. Thus, TAK1 was knocked down in MSCs, and then MSCs were pretreated with poly(I:C) and cocultured in vitro with mouse peritoneal macrophages. As shown in Figure 4G–4I, pretreatment with poly(I:C) could enhance the suppressive effect of MSCs on the production of inflammatory cytokines in mouse peritoneal macrophages, while TAK1 interference would reverse the effects of poly(I:C).

image

Figure 4. miR-143 regulates the immunosuppressive function of MSCs by targeting TAK1. (A): TAK1 mRNA levels in MSCs transfected with siTAK1, determined by quantitative polymerase chain reaction (qPCR) and normalized to GAPDH levels. (B): TAK1 protein levels in MSCs transfected with siTAK1, normalized to GAPDH levels. Relative mRNA expression of COX-2 (C), IDO (D), IL-6 (E), and IL-8 (F) in MSCs with TAK1 interference was measured by qPCR. MSCs without transfection were used as control. MSCs were transfected with siTAK1 and stimulated by poly(I:C) for 24 hours, and then cocultured in vitro with macrophages from mouse peritoneal fluid and stimulated with LPS. Flow cytometry was used to detect MCP-1 (G), TNF-α (H), and IL-1β (I) production of macrophages cocultured with MSCs. * p < .05, ** p < .01 and *** p < .001. Abbreviations: COX-2, cyclo-oxygenase 2; IDO, indoleamine 2,3-dioxygenase; IL, interleukin; LPS, lipopolysaccharide; MCP-1, monocyte chemoattractant protein 1; Mϕ, macrophage; MSCs, mesenchymal stem cells; MFI, mean fluorescence intensity; OD, optical density; P-siNC-MSC, MSCs transfected with siNC and stimulated by poly(I:C), P-siTAK1-MSC, MSCs transfected with siTAK1 and stimulated by poly(I:C); siNC, small interfering RNA negative control; siTAK1, TAK1 small interfering RNA; siNC-MSC, MSCs transfected with siNC; TAK1, TGF-beta activated kinase 1; TNF α, tumor necrosis factor-α.

Download figure to PowerPoint

These results indicated that poly(I:C) can enhance the production of soluble immunosuppressive factors in MSCs, as well as enhance the suppressive function of MSCs on the secretion of inflammatory cytokines in macrophages. MiR-143 can reverse the enhancement effect of poly(I:C) on the immunosuppressive function of MSCs via targeting at TAK1.

Poly(I:C) Can Effectively Improve the Therapeutic Effect of MSCs on the CLP Model

Our in vitro experiments showed that poly(I:C) can induce more production of soluble immunosuppressive factors in MSCs and enhance the inhibition of MSCs on the production of proinflammatory cytokines in macrophages. We wondered if there is a beneficial effect of poly(I:C)-pretreated MSCs on sepsis therapy in vivo. We hypothesized that poly(I:C)-activated MSCs, which have been shown to have enhanced immunosuppressive properties, may reduce the symptoms of sepsis and improve survival rate more efficiently, and high expression of Pre-143 would block the improving effect of poly(I:C) on MSCs.

In this study, we choose CLP as a model of sepsis to explore the protective effect of human UC-MSCs. One hour after CLP procedure, mice were randomly assigned to injections of saline, control MSCs (C-MSCs), poly(I:C)-pretreated MSCs (P-MSCs), or poly(I:C)-pretreated Pre-143-transfected MSCs (P-143-MSCs) into the tail vein (Fig. 5A). We delightedly found that, at 48 hours postoperation, the survival rate of septic mice treated with P-MSCs increased to 75%, compared with 25% in CLP group and 58% with C-MSC treatment. Besides, only 50% of mice treated by P-143-MSCs survived, lower than mice treated with P-MSCs or C-MSCs. At 72 hours postoperation, only 17% of mice survived in CLP group, and the survival rate of septic mice treated with P-143-MSCs decreased to 42% (Fig. 5B). This demonstrated that poly(I:C)-activated MSCs can exert more protective effect on septic mice, while Pre-143 overexpression in MSCs weakens the effect of poly(I:C).

image

Figure 5. Poly(I:C) more effectively inhibits bacterial counts and improves the survival rate of septic mice. (A): Experimental design for the in vivo study. Male C57Bl/6J mice were anesthetized, and sepsis was induced by CLP. Sham-operated mice underwent the same procedure without ligation and puncture of the cecum. Saline or a suspension of MSCs (106 cells in 100 µL saline) was slowly infused via the tail vein 1 hour after CLP operation. 25 hours after CLP procedure, animals were sacrificed for collection of samples. (B): Survival curves of mice after CLP and a variety of treatments using umbilical cord-derived MSCs. Animals were monitored for 96 hours. (C): Bacterial counts in blood and in peritoneal space. n = 12 for each group. *, p < .05; **, p < .01; ***, p < .001. Abbreviations: CLP, cecal ligation and puncture; C-MSCs, control MSCs; CFU, colony forming unit; MSCs, mesenchymal stem cells; P-MSCs, poly(I:C)-pretreated MSCs; P-143-MSCs, poly(I:C)-pretreated Pre-143-transfected MSCs.

Download figure to PowerPoint

To see whether a change in bacterial burden could contribute to P-MSC-related protection, we measured the bacterial colony forming unit (CFU) counts in blood and peritoneal fluid which were collected 25 hours after CLP operation. We found that the bacterial CFU counts significantly increased in blood of CLP-induced septic mice than those in sham-operated mice. With the treatment of P-MSCs, CFU counts had more remarkable reduction than those with C-MSC treatment. The results of bacterial CFU counts in peritoneal fluid were consistent with those in blood, that is, treatment with P-MSCs caused more significant reduction of CFU counts in peritoneal fluid than C-MSCs. However, P-143-MSCs had no significant effect on reducing CFU counts in blood or peritoneal fluid (Fig. 5C). These results suggested that poly(I:C) may enhance the suppression effect of MSCs on bacterial counts in blood and enterocoelia of septic mice, while miR-143 attenuates the effect of poly(I:C).

To evaluate systemic inflammatory response, magnetic bead-based multiplex assay was used to measure multiple cytokines/chemokines in plasma samples collected 25 hours post-CLP. Compared to sham-operated mice, plasma concentrations of IL-6, TNF-α, keratinocyte-derived chemokine (KC), and CC chemokine ligand 5 (CCL5) were all markedly elevated in CLP-induced septic mice. After the administration of P-MSCs, plasma concentrations of cytokines/chemokines including IL-6, TNF-α, keratinocyte-derived chemokine (KC), and CC chemokine ligand 5 (CCL5) were all markedly decreased and almost reduced to the levels in sham-operated mice. Meanwhile, with the treatment of C-MSCs, plasma concentrations of IL-6 and TNF-α were declined, but the variation of chemokine levels did not have statistical significance. Moreover, with P-143-MSC treatment, only the reduction of TNF-α level had statistical significance (Fig. 6A–6D). These results illustrated that poly(I:C)-activated MSCs can more effectively alleviate the inflammatory symptoms of mice, whereas miR-143 suppresses the functions of poly(I:C).

image

Figure 6. Poly(I:C) improves MSC-based therapy on systemic inflammation and multiorgan dysfunction in septic mice. (A–D): Levels of the proinflammatory cytokine IL-6, IL-1β, and chemokines KC, JE, and CCL5 in plasma were measured by magnetic bead-based multiplex assay. (E–J): Biochemical indicators of organ function including creatinine, urea, AST, ALT, bilirubin, and amylase were measured in plasma which was collected 25 hours after CLP operation. n = 10 each group. #, p < .05; ##, p < .01; ###, p < .001, sham-operated versus CLP group. *, p < .05; **, p < .01, CLP versus MSC-treated groups. Abbreviations: AST, aspartate aminotransferase; ALT, alanine aminotransferase CCL5, CC chemokine ligand 5; CLP, cecal ligation and puncture; C-MSCs, control MSCs; IL, interleukin; KC, keratinocyte-derived chemokine; P-MSCs, poly(I:C)-pretreated MSCs; P-143-MSCs, poly(I:C)-pretreated Pre-143-transfected MSCs; TNFα, tumor necrosis factor-α.

Download figure to PowerPoint

The necrosis and apoptosis of peritoneal cells were determined by flow cytometry analysis. CLP-induced septic mice exhibited a significant increase in the proportion of necrotic and apoptotic cells compared to sham-operated mice. The proportion of apoptosis cells was more significantly reduced in mice treated with P-MSCs than that in mice treated with C-MSCs. Administration of P-143-MSCs only brought a slight decrease of necrotic and apoptotic cell proportion without statistical differences (Supporting Information Fig. 4). The production of inflammatory factors IL-1β and TNF-α in monocytes/macrophages of peritoneal CD11b+ cells were also examined. The production of these factors in peritoneal monocytes/macrophages was significantly increased in CLP-induced septic mice. With the administration of MSCs, IL-1β level was downregulated, while the decline of TNF-α level did not have statistical significance. Compared to C-MSC-treated mice, the decrease of IL-1β and TNF-α in peritoneal monocytes/macrophages was more remarkable in mice treated with P-MSCs. Besides, treatment with P-143-MSCs did not cause a significant reduction of either IL-1β or TNF-α (Supporting Information Fig. 5).

Organ dysfunction was determined by measurement of biochemical indicators of organ function in plasma samples, including plasma levels of blood urea nitrogen (BUN), creatinine (indicators of renal dysfunction), aspartate aminotransferase (AST), alanine aminotransferase (ALT), bilirubin (indicators of hepatic dysfunction), and amylase (indicator of pancreatic dysfunction). Compared to sham-operated group, all biochemical indicators were increased in septic mice, reaching statistical significance except for bilirubin. When administration of C-MSCs and P-MSCs could both significantly reduce systemic levels of creatinine and amylase, P-MSCs treatment led to more remarkable decrease of amylase and BUN. In addition, both C-MSC and P-MSC treatment induced a downward trend in ALT without statistical differences, whereas AST was not altered. Treatment with P-143-MSCs only brought a marked reduction of creatinine (Fig. 6E–6J). Pathological examination of tissue samples from the mice with P-MSC and C-MSC treatment, particularly in the P-MSC group, showed substantial suppression of CLP-induced pathology in terms of both inflammatory infiltration and damage in lung, liver, and kidney. The recovery of lung was not so significant with P-143-MSC treatment (Supporting Information Fig. 6). The results above suggested that poly(I:C) can effectively improve the therapeutic effect of MSCs on the CLP model, while miR-143 overexpression reverses this protective effect.

Discussion

  1. Top of page
  2. A
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgments
  9. Author Contributions
  10. Disclosure of Potential Conflicts of Interest
  11. References
  12. Supporting Information

Recent studies indicate that MSCs express active TLRs. Pevsner-Fischer et al. [38] found that mouse bone marrow-derived MSCs (BM-MSCs) express TLR molecules 1–8, but not TLR9. Human BM- [19, 20, 39], adipose-derived [18, 40], and UC-derived [41] MSCs were also found to express TLR molecules 1–6, however, the expression of TLR7–10 remains controversial. We used qPCR to analyze the TLR expression patterns of human UC-MSCs and found human UC-MSCs can express TLR1–6, which is consistent with former studies on human BM-, adipose-, and UC-derived MSCs. Interestingly, TLR3 was highly expressed. Furthermore, we also detected the expression of TLR8, TLR9, and TLR10 using qPCR and found that UC-MSCs do not express TLR7.

The effect of TLRs on MSC functions and its underlying mechanism require further investigation. Some researchers suggested that the activation of TLRs would enhance the suppressive function of MSCs. Waterman et al. [42] reported that short-term stimulation with specific TLR3 agonists would enhance the production of IDO and PGE2 of MSCs, as well as the suppression on T-cell proliferation of MSCs, while the activation of TLR4 inclines MSCs toward to be proinflammatory mediators. The research of Opitz et al. [19] suggested that the activation of both TLR3 and TLR4 could enhance the production of IDO in MSCs, thus enhance the suppressive activity of MSCs on T-cell proliferation. Moreover, the contrary view is that the activation of TLRs reduces or has no effect on the suppressive function of MSCs. Liotta et al. [20] reported that the addition in culture of TLR3 or TLR4 ligand, but not of TLR7/8 or TLR9 ligand, could significantly reduce the suppressive activity of human BM-MSCs on T-cell proliferation. Mastri et al. indicated that poly(I:C) improved the production of trophic factors by porcine BM-MSCs, including IL-6, IL-10, IL-11, Leukemia inhibitory factor (LIF), vascular endothelial growth factor (VEGF), and stromal cell-derived factor-1 (SDF-1), and thus enhanced low-dose MSC therapy for hamster heart failure. Moreover, they showed that poly(I:C)-mediated TLR3 activation did not appreciably affect the immunomodulatory function of MSCs [43]. Based on these findings, it can be deduced that the activation of TLRs does have effects on MSC functions, although it might be affected by a series of conditions and different experimental approaches, such as TLR ligand concentration and stimulation time. We used different TLR ligands to stimulate MSCs for different intensity and duration and found that the stimulation of poly(I:C) could enhance the production of IL6, IL8, COX-2, and IDO in MSCs. COX-2 is the key molecule in the synthesis and generation of PGE2, while PGE2 is considered to be the key molecule in the immunomodulatory function of MSCs [5, 44]. PGE2 in vitro can suppress the maturation and activation of DCs [45], suppress T-cell proliferation and the production of IL-2 [46], enhance the differentiation of macrophages toward M2 type [30], and participate in the protection of autoimmune encephalomyelitis [47] and sepsis [30]. Nemeth et al. [30] cocultured BM-MSCs with peritoneal macrophages and found that the activation of TLR4 could enhance the production of PGE2 in MSCs, which has inflammation suppression effect by binding to EP2 and EP4 receptors to enhance the production of IL-10 in macrophages. IDO produced by MSCs could catalyze the conversion of tryptophan to kynurenine and inhibit T-cell responses by tryptophan depletion [48]. IL-6 and IL-8 are the primary proinflammatory cytokines and chemokines produced by MSCs, whose functions remain unclear. It has been reported that, IL-6 is involved in the immunoregulatory mechanism mediated by MSCs through a partial inhibition on DC differentiation [14, 49, 50]. Furthermore, we cocultured human UC-MSCs with peritoneal macrophages and found that the activation of TLR-3 leads to an enhanced suppression effect of MSCs on peritoneal macrophages, which showed a significant reduction in the production of proinflammatory cytokines TNF-α, IL-1β, and MCP-1.

miRNAs are short (19–25 nucleotides) single-stranded non-protein-coding RNAs, which play an important role in the post-transcriptional regulation of target mRNAs and the translational repression of target proteins [51]. miRNAs regulate gene expression by binding to the 3′UTR of target mRNAs [52]. They take effect in diverse biological processes, including development, differentiation, apoptosis, and oncogenesis. Previous studies indicated that stem cells have unique miRNA expression patterns, which might explain their self-renewal and multidifferentiation properties [53]. A subset of miRNAs regulated during osteogenic differentiation of MSCs is responsive to perturbation of the platelet-derived growth factor pathway [54]. miRNAs can regulate synthesis of the neurotransmitter substance P in human MSC-derived neuronal cells [55]. However, most of these studies focused on the regulation of miRNAs on MSC differentiation, with little attention paid to their regulation on the immunomodulatory functions of MSCs. Noteworthily, our previous research demonstrated that miR-181a could affect the proliferation of MSCs via targeting the TGF-β pathway. High expression levels of miR-181a in MSCs could also promote T-cell proliferation and interferon (IFN)-γ secretion, as well as reduce the protection function on experimental colitis of MSCs [56]. In this study, we provided data on the regulatory role of miRNAs in the process of MSC being activated by poly(I:C). As is well known, TLR3 signaling pathway is a TRIF-dependent pathway. When TLR3 recognizes double-stranded RNA, it will recruit TRIF, which will conduct the signal toward TRAF3 and TRAF6. The activation of IRF3 downstream of TRAF3 can regulate the production of type I IFNs. TRAF6 can recruit TAK1 and TAB2 to form a complex, which then translocates to the cytosol where TAK1 is phosphorylated and activated. This leads to the activation of downstream nuclear factor (NF)-κB and mitogen-activated protein kinase (MAPK) (JNK, p38, and extracellular signal-regulated kinases (ERKs) 1/2) signaling pathways, which then induce the production of cytokines, such as IL-6, IL-8, and COX-2 [57-59]. To investigate the potential regulatory mechanisms how poly(I:C) regulates MSCs immune function, we focused on TRAF6 and TAK1 and studied the regulatory role of miRNAs in the process of poly(I:C) activating MSCs. We examined the expression of a group of miRNAs which have sequence complementarity to the 3′-UTR of TRAF6 and TAK1, namely miR-125b, miR-194, miR-146a, miR-143, and miR-10. Strikingly, the experimental results indicated that stimulation with TLR3 agonist, poly(I:C), could significantly downregulate the expression of miR-143 in MSCs. By luciferase experiments and the examination of mRNA and protein expression levels, we verified that TAK1 is the target gene of miR-143. TAK1 is a serine/threonine kinase in the mitogen-activated protein kinase kinase family. TAK1 protein can regulate the growth, differentiation, and inflammatory response of cells via a series of particular transcription factors [60]. With conditional knockout of TAK1 protein in B cells, TLR3-, TLR4-, and TLR9-mediated NF-κB activation disappears [61]. In embryonic fibroblasts lacking TAK1, NF-κB activation mediated by TNFR1, IL-1R, TLR3, and TLR4 is also severely impaired. These facts indicate that TAK1 protein is essential to TLR3 pathway-mediated activation.

Through high-expressing and low-expressing miR-143, respectively, we found that miR-143 could regulate the effect of poly(I:C) on the immunosuppressive function of MSCs. miR-143 overexpression suppressed the production of MSC immune molecules and the regulating effect of MSCs on macrophages enhanced by poly(I:C). Afterward, by interfering TAK1, we found poly(I:C) could not promote the production of immunomodulatory molecules in MSCs, and the suppression effect of MSCs on macrophages was also significantly reduced. This is consistent with the effect on MSCs of miR-143 overexpression, which verifies that poly(I:C) can enhance the immunomodulatory functions of MSCs by suppressing miR-143 and promoting the functions of TAK1.

The immunosuppressive effects of MSCs have been demonstrated in the treatment of several animal models of disease, including graft-versus-host disease, diabetes, rheumatoid arthritis, autoimmune encephalomyelitis, systemic lupus erythematosus, periodontitis, inflammatory bowel disease, and sepsis [62-65]. In this study, a CLP-induced polymicrobial model of sepsis, which closely resembles the human disease [66-70] and is considered as the current standard in sepsis research, was used to examine the roles of TLR3 and miR-143 in MSC-based therapy. As is known, this model may cause bacterial peritonitis, which is followed by translocation of mixed enteric bacteria into the blood compartment, triggering systemic activation of the inflammatory response, subsequent multiple organs dysfunction, septic shock and, finally, death. Of note, Mei et al. found that when they administered MSCs intravenously 6 hours after performing CLP, MSC treatment significantly reduced systemic levels of creatinine in septic mice at 28 hours after CLP. There was also a trend toward improvement in BUN by MSC treatment, whereas amylase, AST, and ALT were not altered [32]. However, our in vivo experimental results showed that, TLR3-activated MSCs can more efficiently ameliorate bacterial counts and systemic inflammation, and thereby improve survival in CLP-induced sepsis, while miR-143 overexpression attenuates this MSC-based therapy. TLR3-activated MSCs can also significantly reduce systemic levels of creatinine and amylase and induced a downward trend in ALT, which has no statistical differences compared to MSCs alone. Nonetheless, P-MSCs treatment led to more remarkable decrease of amylase and BUN compared to CLP group than C-MSCs treatment. It is possible that the time point of collecting plasma sample may influence the levels of these biochemical indicators of organ function. We obtained the plasma from MSC-treated mice at 25 hours after CLP operation, when these levels of biochemical indicators might have reached the value of no significant difference between naïve MSCs and TLR3-activated MSCs. So further studies will need to evaluate what suitable timing of sampling provides ideal benefit.

Conclusion

  1. Top of page
  2. A
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgments
  9. Author Contributions
  10. Disclosure of Potential Conflicts of Interest
  11. References
  12. Supporting Information

In conclusion, TLR3 activation can enhance the immunosuppressive and anti-inflammatory effects of MSCs through downregulation of miR-143 in vivo and in vitro, thus improve the therapeutic effect of MSCs on CLP model of sepsis. These findings will aid in our understanding of TLR and miRNA functions in MSCs and may provide an opportunity for potential novel therapies for sepsis.

Acknowledgments

  1. Top of page
  2. A
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgments
  9. Author Contributions
  10. Disclosure of Potential Conflicts of Interest
  11. References
  12. Supporting Information

This work was supported by grants from the National Natural Science Foundation (project number: 81072410) and the Special Research Grant of Jiangsu Province Department of Health (project number: XK200709 and JHB2011-1).

Author Contributions

  1. Top of page
  2. A
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgments
  9. Author Contributions
  10. Disclosure of Potential Conflicts of Interest
  11. References
  12. Supporting Information

X.Z.: conception and design, collection and/or assembly of data, data analysis and interpretation, manuscript writing, and final approval of the manuscript; D.L.: collection and/or assembly of data and provision of study material or patients; W.G.: collection and/or assembly of data and data analysis and interpretation, G.Z.: conception and design; L.L.: conception and design and provision of study material or patients; L.Y.: collection and/or assembly of data; Y.H.: conception and design, financial support, manuscript writing, and final approval of manuscript.

References

  1. Top of page
  2. A
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgments
  9. Author Contributions
  10. Disclosure of Potential Conflicts of Interest
  11. References
  12. Supporting Information

Supporting Information

  1. Top of page
  2. A
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgments
  9. Author Contributions
  10. Disclosure of Potential Conflicts of Interest
  11. References
  12. Supporting Information

Additional Supporting information may be found in the online version of this article.

FilenameFormatSizeDescription
stem1543-sup-0001-suppfig1.tif2291KSupporting Information Figure 1.
stem1543-sup-0002-suppfig2.tif3619KSupporting Information Figure 2.
stem1543-sup-0003-suppfig3.tif874KSupporting Information Figure 3.
stem1543-sup-0004-suppfig4.tif2457KSupporting Information Figure 4.
stem1543-sup-0005-suppfig5.tif2375KSupporting Information Figure 5.
stem1543-sup-0006-suppfig6.tif2904KSupporting Information Figure 6.

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.