SEARCH

SEARCH BY CITATION

Keywords:

  • SIRT6;
  • BMSCs;
  • Nuclear factor-κB;
  • Collagen/chitosan/HA scaffolds;
  • Bone regeneration;
  • Calvarial defects

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusions
  8. Acknowledgments
  9. Authors Contributions
  10. Disclosure of Potential Conflicts of Interest
  11. References
  12. Supporting Information

Sirtuin 6 (SIRT6) is a NAD-dependent deacetylase involved in lifespan regulation. To evaluate the effect of SIRT6 on osteogenesis, rat bone marrow mesenchymal stem cells (rBMSCs) with enhanced or reduced SIRT6 function were developed. We observed that SIRT6 knockdown significantly reduced the mRNA levels of several key osteogenic markers in vitro, including alkaline phosphatase (ALP), Runt-related transcription factor 2 (RUNX2), and osteocalcin, while overexpression of SIRT6 enhanced their expression. Additionally, SIRT6 knockdown activated nuclear factor-κB (NF-κB) transcriptional activity and upregulated the expression of acetyl-NF-κB p65 (Lys310). The decreased osteogenic differentiation ability of rBMSCs could be partially rescued by the addition of NF-κB inhibitor BAY 11–7082. Furthermore, SIRT6 overexpression in rBMSCs combined with the use of collagen/chitosan/hydroxyapatite scaffold could significantly boost new bone formation in rat cranial critical-sized defects, as determined by microcomputed tomography and histological examination. These data confirm that SIRT6 is mainly located in the nuclei of rBMSCs and plays an essential role in their normal osteogenic differentiation, partly by suppressing NF-κB signaling. Stem Cells 2014;32:1943–1955


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusions
  8. Acknowledgments
  9. Authors Contributions
  10. Disclosure of Potential Conflicts of Interest
  11. References
  12. Supporting Information

The balance between bone resorptive and formative processes can be disrupted by aging, resulting in faster bone resorption and osteoporosis with typically increased osteoclast formation and decreased osteoblast formation [1]. Age-related bone loss may be due to telomere shortening, decreased production of growth factors, oxidative stress, and DNA damage, which affect the self-renewal capacity of progenitors as well as the production of osteoblasts from them [2]. The understanding of genetic factors linking aging and longevity to the maintenance of sufficient bone mass throughout life has been a very active area of research.

Sirtuin 6 (SIRT6), a member of the evolutionarily conserved sirtuin family of NAD+-dependent protein deacetylases, plays an important role in lifespan regulation [3, 4]. It participates in several important biological processes including maintenance of genomic stability, DNA repair, and anti-inflammatory processes [5, 6]. An enhanced extent of DNA double-strand breaks (DSBs) can be detected during senescence induction in human mesenchymal stem cells (MSCs) [7]. SIRT6 functions as an anti-aging gene by promoting the repair of these DSBs through homologous recombination [8, 9]. SIRT6-deficient mice are small and osteoporotic with a 30% loss in bone mineral density, develop a striking degenerative phenotype, and typically die at approximately 4 weeks of age [4]. On the other hand, male transgenic mice overexpressing SIRT6 have a longer life span and improved metabolic indices [3]. It has been confirmed that human SIRT6 is chiefly expressed in bone and ovarian cells [10]. However, the expression and functional characteristics of SIRT6 in the bone marrow MSCs (BMSCs) remain to be elucidated.

NF-κB plays important roles in normal skeletal remodeling and bone homeostasis by controlling the differentiation of osteoprogenitor cells into osteoclasts, osteoblasts, osteocytes, and chondrocytes [11]. Increased NF-κB activity has been shown to decrease mature osteoblast function and impair production and maturation of bone matrix [12]. RelA/p65, a subunit of NF-κB, promotes osteoclast differentiation by blocking a RANKL-induced apoptotic JNK pathway in mice [13]. Osteoporotic SIRT1-deficient mice could be rescued by pharmacological inhibition of NF-κB [14]. Interestingly, SIRT6 binds to the NF-κB subunit RelA and attenuates NF-κB signaling by modifying the chromatin of NF-κB target genes [15]. Haploinsufficiency of RelA rescues the early lethality and aging-like phenotype of SIRT6-deficient mice [15]. SIRT6 has been shown to protect cardiomyocytes from hypertrophy through inhibition of NF-κB-dependent transcriptional activity [16]. Furthermore, nuclear expression of the NF-κB p65/RelA protein is increased after SIRT6 inhibition in human dermal fibroblasts, leading to a decrease in type I collagen synthesis [17]. It is well known that type I collagen is the major structural component of not only the dermal ECM but also of bone. Taking all these facts together, we hypothesized that SIRT6 plays an important role in regulating osteogenic differentiation of BMSCs through the NF-κB signaling pathway.

In this article, we investigated the expression and localization of SIRT6 in rat BMSCs (rBMSCs), and its effect on the osteogenic differentiation of rBMSCs. We found that SIRT6 knockdown impaired osteogenesis of rBMSCs in vitro and upregulated NF-κB transcriptional activity and the expression of acetyl-NF-κB p65 (Lys310). The decrease in osteogenic differentiation of rBMSCs as a consequence of SIRT6 knockdown could be partially rescued by the addition of NF-κB inhibitor BAY 11–7082. We also used a rat calvarial defect model for transplanting SIRT6-overexpressing rBMSCs combined with the use of collagen/chitosan/hydroxyapatite (HA) scaffold (CCHS). We found that SIRT6 overexpression could promote the osteogenic differentiation of rBMSCs in vitro and in vivo.

Materials and Methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusions
  8. Acknowledgments
  9. Authors Contributions
  10. Disclosure of Potential Conflicts of Interest
  11. References
  12. Supporting Information

Isolation of rBMSCs

The isolation and culture of rBMSCs from the tibias and femurs of 8-week old male Sprague-Dawley (SD) rats were performed as described previously [18]. Briefly, the rats were killed by cervical dislocation and sterilized using 75% ethanol for 5 minutes before surgery. After dissecting the metaphyseal ends of the bones under sterile conditions, the bone marrow cells were flushed out with Dulbecco's modified Eagle's medium (DMEM) (Catalog No. SH30022; Hyclone, Beijing, China, www.thermo.com.cn) using a 5-ml syringe, and centrifuged at 1,000 rpm for 5 minutes. The cells were resuspended and expanded in growth medium (α-minimum essential medium, Catalog No. SH30265; Hyclone) containing 10% fetal bovine serum (FBS) and 1% Penicillin/Streptomycin at a concentration of 8.5 × 107 cells per 10 cm dish (NEST, Wuxi, China, www.cell-nest.com), and incubated at 37°C under conditions of 5% CO2 until 70–80% confluence was reached. The medium was changed every 3 days. Upon reaching 70–80% confluence, adherent cells were trypsinized, harvested, and expanded in T-75 flasks (NEST, Wuxi, China). Cells that had undergone 6–9 population doublings were used in subsequent experiments.

Immunofluorescence Staining

SIRT6 expression in primary rBMSCs was examined by immunofluorescence staining. Briefly, rBMSCs in growth medium were seeded in 24-well plates (NEST, Wuxi, China) at a density of 2 × 104 cells per square centimeter. After incubation for 24 hours, the rBMSCs were fixed with 4% paraformaldehyde for 15 minutes at room temperature, and washed using phosphate-buffered saline (PBS) solution. The cells were then treated with 0.5% Triton X-100 for 15 minutes at room temperature, followed by incubation with 10% normal goat serum in PBS for 1 hour (Sigma, St. Louis, MO, www.sigmaaldrich.com). Anti-SIRT6 primary antibody (1:400; Proteintech, Wuhan, China, www.ptgcn.com) was then added and incubated for 2 hours at 37°C. For visualization, TRITC-conjugated secondary antibody (1:150; ZSGB-Bio, Beijing, China, www.zsbio.com) was used. The nuclei were visualized by staining the cells with DAPI (Sigma) for 3 minutes at room temperature. The cells were observed under a fluorescent microscope (DP71, OLYMPUS, China, www.olympusfluoview.com) and photographed (DPController, OLYMPUS, China).

Cloning of Human SIRT6

Total RNA was extracted from human bone marrow cells (Cyagen, Guangzhou, China, www.cyagen.com.cn). Reverse transcription was carried out using M-MuLV reverse transcriptase (Fermentas, Beijing, China, www.thermo.com.cn), and full-length cDNA for human SIRT6 was obtained by polymerase chain reaction (PCR) using PrimeSTAR Max DNA polymerase (Takara, Dalian, China, www.takara.com.cn) and the primers forward: 5′-CCGGAATTCATGTCGGTGAATTACGC-3′ and reverse: 5′- CGCGGATCCCAAAGTGAGACCACGAGAG-3′. EcoRI and BamHI restriction sites (underlined) were incorporated in the primers to facilitate cloning. Purified PCR products were subsequently cloned into a pLVX plasmid (Clontech, Beijing, China, www.clontech.com). The construct was verified by sequencing and designated pLVX-human-SIRT6.

Design and Cloning of shRNA Against Rat SIRT6

A pair of 59-nt long oligonucleotides (5′-GATTCGTGTAAGACGCAGTACGTGTTCAAGAGACACGTACTGCGTCTTACACTTTTTTG-3′ and 5′-AATTCAAAAAAGTGTAAGACGCAGTACGTGTCTCTTGAACACGTACTGCGTCTTACACG-3′), encoding a 19-nt-long short-hairpin RNA (shRNA) against rat SIRT6, was designed. Additional BamHI and EcoRI restriction sites were incorporated in the sequences to facilitate cloning. A BLAST search was performed using the National Center for Biotechnology Information (NCBI) Expressed Sequence Tags database to confirm that the shRNA construct specifically targeted rat Sirt6. A scrambled shRNA sequence (TTCTCCGAACGTGTCACGT), exhibiting no homology to the rat sequence database, was used as a negative control. The oligonucleotides were phosphorylated, annealed, and cloned into the pLVX-shRNA2 vector (Clontech). The resulting vectors, designated pLVX–rat-shSIRT6 and pLVX–rat-shSIRT6–Control, were subsequently verified by sequencing.

Lentiviral Packaging and Cell Infections

Human-SIRT6, rat-shSIRT6–Control, and rat-shSIRT6 lentiviral particles were produced by triple transfections of 293T cells (Invitrogen, Carlsbad, CA, www.invitrogen.com) with the vectors pLVX–human-SIRT6, pLVX–rat-shSIRT6–Control, or pLVX–rat-shSIRT6, respectively, along with psPAX2 and pMD2.G.

For infection, rBMSCs were incubated with lentiviral particles and polybrene (5 μg/ml) in growth medium. After 6 hours, the infection medium was discarded, and the cells were used for experiments. The expression of SIRT6 was quantified by real-time PCR (RT-PCR) and Western blot analyses.

MTT Cell Proliferation Assay

For cell proliferation assays, rBMSCs were cultured in growth medium in 96-well plates (NEST, Wuxi, China) at an initial density of 6 × 103 cells per square centimeter, and incubated at 37°C under conditions of 5% CO2 for 24, 48, 72, and 96 hours. At each time point, 20 μl of MTT reagent (5.0 mg/ml; Beyotime, China, www.beyotime.com) was added to the plates, followed by further incubation for 4 hours at 37°C. The supernatant was then removed and dimethylsulfoxide was added. Optical density (OD) was measured at 570 nm using a microplate reader (PowerWave XS2, BioTek).

Osteogenic Differentiation Protocol

rBMSCs were cultured in growth medium in 6-well or 12-well cell culture plates (NEST, Wuxi, China) at a density of 2 × 104 cells per square centimeter, and incubated for 72 hours at 37°C under conditions of 5% CO2. Subsequently, the cells were cultured in an osteogenic induction medium, which consists of growth medium supplemented with 50 μg/ml l-ascorbate phosphate, 10 mM β-glycerophosphate, and 10 nM dexamethasone. All three supplements were obtained from Sigma. This time point was considered as day 0. Cells were maintained with the addition of fresh osteogenic induction medium every 2 days for 21 days.

ALP Staining and ALP Activity Assay

Cells were cultured in osteogenic induction medium in 12-well plates for 7 days. For alkaline phosphatase (ALP) staining, cells were fixed with 4% paraformaldehyde for 15 minutes. Subsequently, cells were washed twice with PBS and stained with the ALP staining solution, comprising of naphthol AS-MX phosphate and fast red violet LB salt (Sigma). The percentage of ALP-positive cells in each group was calculated. For ALP activity measurement, cells were lysed in RIPA lysis buffer (Beyotime, China), and the lysate (10 μl) was incubated with 90 μl of fresh solution containing p-nitrophenyl phosphate substrate at 37°C for 30–60 minutes. The reaction was stopped by the addition of 0.5 N NaOH (100 μl), and the absorbance was measured at 405 nm using a microplate-reading spectrophotometer (PowerWave XS2, BioTek). Total protein concentration was measured using a BCA Protein Assay Kit (Beyotime, China). The relative ALP activity was expressed as the percentage change in OD per unit time per milligram of the protein; or ALP activity = (ΔOD/15 minutes/mg protein) × 100.

Alizarin Red and von Kossa Staining

After osteogenic induction, mineral deposition was assessed by staining with Alizarin-red or von Kossa on day 21. Cells were fixed with 4% paraformaldehyde for 15 minutes at room temperature and then washed with distilled water. A 1% solution of alizarin red was added and incubated for 10–20 minutes at room temperature, followed by rinsing with distilled water. The stain was desorbed with 10% cetylpyridinium chloride (Sigma) for 1 hour. The solution was collected and 200 μl was plated on 96-well plates, and read at 590 nm using a spectrophotometer. The readings were normalized to total protein concentration. For von Kossa staining, 5% silver nitrate solution (Aladdin, Shanghai, China, www.aladdin-reagent.com) was added to the fixed cells and exposed to UV radiation for 1 hour. To remove the nonspecific staining, 2% sodium thiosulfate (Aladdin, Shanghai, China) was added. The plate was visualized and photographed using a light microscope.

Real-Time Quantitative Polymerase Chain Reaction

Total RNA was extracted from cultured cells using Trizol (Invitrogen, Carlsbad). First-strand cDNA was transcribed from 1 μg of RNA using M-MuLV reverse transcriptase (Fermentas) according to the manufacturer's protocol. Quantitative RT-PCR (qRT-PCR) was performed in triplicate using SYBR Premix Ex Taq (Takara, Japan) on an ABI 7500 Real-Time PCR System (Applied Biosystems, Foster City, CA, www.appliedbiosystems.com). The thermal cycling conditions included 30 seconds at 95°C, followed by 40 cycles of 95°C for 5 seconds and 60°C for 34 seconds. The primers (Anygene Biological Technology, Wuhan, China, www.anygene.net) for the rat genes were listed in Table 1. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and eukaryotic translation elongation factor 1α (EF-1α) were used as internal control genes (ICGs), and relative gene expression levels were determined using the 2−ΔΔCt method with the aid of ABI 7500 Software (Applied Biosystems, Foster City, CA) [19]. Briefly, the mean cycle threshold (Ct) value of the target gene was normalized to that of ICGs to obtain a ΔCt value, which was further normalized to the control samples to obtain the ΔΔCt value. The value of 2−ΔΔCt was used to calculate the relative fold change of gene expression.

Table 1. Primer sequences for real-time quantitative polymerase chain reaction
GenesPrimer sequence (5′–3′) (forward/reverse)Product size (bp)
  1. Abbreviations: ALP, alkaline phosphatase; EF-1α, eukaryotic translational elongation factor 1α; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; OCN, osteocalcin; RUNX2, Runt-related transcription factor 2; SIRT6, Sirtuin 6.

SIRT6CGTGGATGAGGTGATGTG158
GGCTTATAGGAACCATTGAGA
ALPGAAGGAGGCAGGATTGAC141
ATCAGCAGTAACCACAGTC
RUNX2CCGCACGACAACCGCACCAT289
CGCTCCGGCCCACAAATCTC
OCNCAGGAGGGCAGTAAGGTGG84
CAGGGGATCTGGGTAGGG
EF-1αCTCCACTTGGTCGTTTTGCTGT165
AGACTGGGGTGGCAGGTGTT
GAPDHTGCACCACCAACTGCTTAGC87
GGCATGGACTGTGGTCATGAG
   

Western Blot Analysis

rBMSCs were infected with four different lentiviral vectors. After 48 hours, cells were lysed in RIPA buffer (Beyotime, China) and centrifuged, and the supernatant was collected to examine SIRT6 protein expression. After treatment with NF-kB inhibitor BAY 11–7082 for 12 hours, the SIRT6-knockdown rBMSCs were lysed in RIPA buffer as mentioned above, and the supernatant was collected to examine the levels of acetyl-NF-κB p65 (Lys310). Protein concentrations were determined using a BCA Protein Assay Kit (Beyotime, China). In total, 40 µg of protein from each sample diluted in loading buffer (Beyotime, China) was boiled for 5 minutes at 95°C, separated by SDS polyacrylamide gel electrophoresis (10% SDS-PAGE, Beyotime, China), and wetly transferred onto a polyvinylidene fluoride membrane using a glycine transfer buffer (192 mM glycine, 25 mM Tris, 20% methanol [v/v]) for 2 hours at 200 mA, 4°C. Nonspecific reactivity was blocked using 5% bovine serum albumin in Tris-buffered saline containing Tween-20 (TBST). The blots were incubated with primary antibodies against SIRT6 (1:1000; Proteintech, Wuhan, China) or acetyl-NF-κB p65 (Lys310; 1:1000; Cell Signaling Technology, Shanghai, China, www.cellsignal.com) overnight at 4°C. An anti-β-actin polyclonal antibody (1:2000; Santa Cruz Biotechnology Santa Cruz, CA, www.scbt.com) was used as an internal loading control. Following washing in TBST, a horseradish peroxidase-conjugated secondary antibody (1:5000; Cwbio, Beijing, China, www.cwbiotech.com) was incubated for 1 hour at room temperature to detect bound antibodies. Blots were developed using ECL reagent (Cwbio, Beijing, China) and detected with X-ray film (Kodak, Rochester, NY, www.kodak.com). Protein bands were visualized using LiDE 100 scanner (Canon, Japan, www.canon.com), and quantified by densitometry analysis using Image J software (National Institutes of Health). Western blot experiments were repeated at least three times to confirm the results.

NF-κB Luciferase Assay

rBMSCs were cultured in 6-well plates (plating density 3 × 104 cells per square centimeter) for 12 hours. TurboFect transfection reagent (Fermentas, Shanghai, China) was used for cotransfection of cells with 1 μg/ml of the reporter plasmid pNF-κB-luc and the internal control plasmid pRL-TK (Promega, Beijing, China, www.promega.com.cn) at a ratio of 10:1 in serum- and antibiotic-free DMEM (Catalog No. 30022; Hyclone). After 6 hours, the cells were rinsed with PBS and incubated for an additional 6 hours in DMEM containing 10% FBS. Cells were lysed in RIPA buffer, and firefly and Renilla luciferase activities were assessed using a dual-luciferase reporter assay (Beyotime, China) and GloMax 20/20 Luminometer (Promega, Wuhan, China), according to the manufacturers' instructions. NF-κB inhibitor BAY 11–7082 was bought from Beyotime (China). rBMSCs were treated with BAY 11–7082 at a concentration of 2 μM. NF-κB transcriptional activity (relative light units of firefly luciferase/relative light units of renilla luciferase, fRLU/rRLU) was expressed as fold induction relative to the control cells.

Preparation of the CCHS and Microstructure Observation

Chitosan (average molecular weight of 1.0 × 105 to 1.7 × 105, 75–85% deacetylation degree) was purchased from Sigma. The 25% glutaraldehyde (GA) aqueous solution, Ca(NO3)2, and (NH4)2HPO4 were purchased from Shanghai Pharm. Co. (China, www.pharm-sh.com.cn).

Type I collagen was isolated from rat tail tendons according to a previously published method [20]. Briefly, crude collagen fibers were dissolved in 0.02 M acetic acid. The collagen solution was centrifuged to remove insoluble impurities. The supernatant was dialyzed against double distilled water for 1 week, with a solution change every 2 days. Finally, it was frozen at −20°C and lyophilized to obtain a sponge. CCHS was synthesized according to the methods published by Wang and Ma [21, 22], with minor modifications. Briefly, collagen and chitosan were dissolved in 0.5 M acetic acid solution to prepare a blend. This was followed by the drop-wise addition of 1 M Ca(NO3)2 and 0.6 M (NH4)2HPO4 solutions into the blend to produce HA, such that the ratio of collagen: chitosan: HA equaled 4:4:2. The blend was maintained for 20 hours at 30°C to generate an elastic composite gel, which was subsequently de-aerated to remove entrapped air bubbles. The gel was injected into a 24-well plate (NEST, Wuxi, China), frozen at −20°C for 2 hours, and then lyophilized for 24 hours to obtain a porous scaffold. The CCHS was further cross-linked with 2% GA to improve biostability, washed with PBS (3 minutes × 15 times), and then lyophilized once again to obtain the GA-treated CCHS.

Cells were seeded as follows. Modified rBMSCs were trypsinized and centrifuged, following which the supernatant was removed. The cells were resuspended in growth medium at a density of 2 × 106 cells/ml, and added drop-wise into dry, cylindrical CCHS in a 24-well plate (1 ml/well; NEST, Wuxi, China). The cells were cultured overnight prior to observation. Twelve cell-seeded CCHS scaffolds and six unseeded ones were fixed with 2.5% GA. They were subsequently dehydrated in graded ethanol solutions and sputter-coated with gold/palladium. The microstructure of the scaffolds and cells was observed using scanning electron microscope (SEM, VEGA 3 LMU, TESCAN, Brno, Czech, www.tescan.com) operated at an accelerating voltage of 30 kV using the secondary electron detector. Cells attached to the scaffold upon culturing for 24 hours in vitro were also observed under a fluorescence microscope (Zeiss, Jena, Germany, www.corporate.zeiss.com).

In Vivo Evaluation in Animals

The bone-forming ability of different cells in scaffolds was assessed in a calvarial defect model in SD rats. Animal handling and surgical procedures were conducted according to the guidelines established by the Animal Care and Use Committee of Wuhan University, People's Republic of China, and approved by the Ethics Committee at the School of Dentistry. The 2% GA-treated CCHS was immersed in 75% ethanol for 12 hours for sterilization, followed by a solvent exchange in PBS for a total of 6 times. It was then cut into 5 × 5 × 1 mm pieces and transferred into a 96-well polystyrene plate, and seeded with 200 µl of rBMSCs suspension at a density of 5 × 106 cells/ml. Twenty-four hours later, the complex was implanted into the bone defect. Twelve rats with two critical-sized calvarial defects were generated and randomly allocated into the following graft study groups: (1) Blank (n = 6); (2) CCHS (n = 6); (3) CCHS–rBMSCs–green fluorescent protein (GFP) (n = 6); and (4) CCHS–rBMSCs–SIRT6 Overexpression (n = 6).

Micro-CT Evaluation

Animals were euthanized 8 weeks after surgery, and the defect areas were collected. All samples were scanned for bone formation with a µCT50 imaging system (Scanco Medical, Switzerland, www.scanco.ch) with the following scan parameters: 70 kVp X-ray energy setting, 1024 reconstruction matrix, 0.02 mm slice thickness, and a 250-milliseconds integration time. Bone volume per defect (BV; mm3) was recorded as a measure of bone regeneration.

Histological Evaluation

Following the micro-CT scan, the samples were fixed with 4% paraformaldehyde for 24 hours at room temperature and then decalcified using 10% EDTA, with a solution change twice a week for 2 weeks, before being embedded in paraffin. Serial sections of 5 µm thickness were cut and mounted on polylysine-coated slides. Hematoxylin and eosin (H&E) and Masson staining were performed separately on consecutive tissue sections, and images were taken using a microscope. For histomorphometry, three midsagittal Masson's-stained sections were selected from the Blank, CCHS, CCHS–rBMSCs–GFP, and CCHS–rBMSCs–SIRT6 Overexpression groups. For double immunofluorescence staining of osteocalcin (OCN) and GFP, sections were incubated with a rabbit polyclonal antibody against OCN (1:100; Santa Cruz) and a mouse monoclonal antibody against GFP (1:100; Santa Cruz) overnight at 4°C. Bound primary antibodies were detected using FITC-conjugated goat anti-rabbit (1:150; ZSGB-Bio, Beijing, China) and TRITC-conjugated goat anti-mouse (1:150; ZSGB-Bio, Beijing, China) secondary antibodies, following 60 minutes incubation. The sections were then incubated with 1 µg/ml DAPI to visualize the nuclei, mounted using Antifade Mounting Medium (Beyotime, China), and photographed using a fluorescence microscope (DP71, OLYMPUS, China).

Statistical Analyses

All experiments were performed at least six times and in triplicate. Data were analyzed with SPSS version 16.0 and GraphPad Prism Version 5.0. Shapiro–Wilk and Kolmogorov–Smirnov tests were used to analyze the data for normal distribution. If the data showed normal distribution, statistical significance of the differences among groups was examined using one-way analysis of variance (ANOVA) and homogeneity of variance tests. A post hoc Tukey's test (equal variances) or Games-Howell (unequal variances) test was performed when the ANOVA test indicated a significant difference. The nonparametric Kruskal-Wallis test was used when the variables did not show a normal distribution with a post hoc Dunn's test. The final results were expressed as mean ± standard deviations (SD) of six independent experiments. Values were considered significantly different if p < .05.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusions
  8. Acknowledgments
  9. Authors Contributions
  10. Disclosure of Potential Conflicts of Interest
  11. References
  12. Supporting Information

Endogenous SIRT6 Expression

Immunofluorescence staining demonstrated that SIRT6 was localized in nuclei (Fig. 1Aa1–1Aa3). Primary rBMSCs were treated with osteogenic medium to investigate whether SIRT6 plays a relevant role in osteogenic differentiation. Compared with control, rBMSCs grown in osteogenic medium showed a significant upregulation of SIRT6 mRNA levels at days 4 and 7 (Fig. 1F).

image

Figure 1. Immunofluorescence staining for Sirtuin 6 (SIRT6) of rat bone marrow mesenchymal stem cells (rBMSCs), lentiviral infection of rBMSCs, SIRT6 expression, MTT, and alkaline phosphatase (ALP) activity. (Aa1–Aa3): DAPI staining, TRITC-conjugated secondary antibody staining, and merge. (Bb1–Ee1): DAPI staining of rBMSCs-green fluorescent protein (GFP), rBMSCs–Knockdown–Control, rBMSCs–SIRT6–Knockdown, and rBMSCs-SIRT6-Overexpression groups. (Bb2–Ee2): GFP-positive cells in rBMSCs-GFP, rBMSCs–Knockdown–Control, rBMSCs–SIRT6–Knockdown, and rBMSCs–SIRT6–Overexpression groups. (Bb3–Ee3): Merge of DAPI staining and GFP-positive cells in rBMSCs-GFP, rBMSCs–Knockdown–Control, rBMSCs–SIRT6–Knockdown, and rBMSCs–SIRT6–Overexpression groups. (F): Endogenous SIRT6 expression during osteogenic process. Upregulation of SIRT6 mRNA was significant at days 4 and 7. (G): SIRT6 expression determined by qRT-PCR in rBMSCs-GFP, rBMSCs–Knockdown–Control, rBMSCs–SIRT6–Knockdown, and rBMSCs–SIRT6–Overexpression groups. (H): SIRT6 protein expression by Western blot in rBMSCs-GFP, rBMSCs–Knockdown–Control, rBMSCs–SIRT6–Knockdown, and rBMSCs–SIRT6–Overexpression groups. (I): Quantification of Western blot by densitometry analysis using Image J software, (J): Effect of SIRT6 on the proliferation ability of rBMSCs in vitro, (K): ALP activity was measured at day 7 in rBMSCs. Scale bar = 50 μm. * and [diaf] indicate a significant difference from the control group (*, p < .05, [diaf], p < .01). Abbreviations: ALP, alkaline phosphatase; DAPI, 4',6-diamidino-2-phenylindole; EF-1α, eukaryotic translational elongation factor 1α; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GFP, green fluorescent protein; OD, optical density; rBMSCs, rat bone marrow mesenchymal stem cells; SIRT6, Sirtuin 6; TRITC, tetramethylrhodamine isothiocyanate.

Download figure to PowerPoint

SIRT6 Overexpression or Knockdown in rBMSCs

We used a lentiviral vector system to efficiently overexpress SIRT6 in primary rBMSCs (rBMSCs–SIRT6-Overexpression) in >95% of the cells, which was quantified by evaluating the ratio of GFP-positive cells to the total cell number (Fig. 1Ee1–1Ee3). In addition, SIRT6 expression was quantitated by real-time PCR and Western blot analyses 48 hours post-infection. SIRT6 mRNA and protein were overexpressed over 19- and 2.5-fold, respectively (Fig. 1G–1I).

rBMSCs were infected with lentivirus harboring shRNA targeting SIRT6 (rBMSCs–SIRT6–Knockdown), and the ratio of GFP-positive cells to the total cell number was once again >95% (Fig. 1Dd1–1Dd3). The efficiency of the shRNA-mediated knockdown was confirmed by real time RT-PCR and Western blot analyses. SIRT6 mRNA levels were knocked-down by over 70% 48 hours post-infection, with a concomitant decrease in SIRT6 protein levels (Fig. 1G–1I). Cells infected with GFP-expressing vector pLVX-rat-shSIRT6-Control, empty vector, and wild-type rBMSCs were designated as rBMSCs–GFP (Fig. 1Bb1–1Bb3), rBMSCs–Knockdown–Control (Fig. 1Cc1–1Cc3), and rBMSCs–WT, respectively. Significant differences were not found among these groups in the follow-up experiments; therefore, only the rBMSCs–Knockdown–Control was selected as the negative control for subsequent experiments.

Effect of SIRT6 on the Proliferation of rBMSCs

Growth curves revealed that the expression of SIRT6 shRNA resulted in a significant increase in cell proliferation at 72 and 96 hours following culture in normal growth medium, while SIRT6-overexpression inhibited proliferation significantly at the same time points when compared with the control group (Fig. 1J).

SIRT6 is Essential for Normal Osteogenesis of rBMSCs In Vitro

SIRT6 knockdown led to a decrease in ALP activity and staining at day 7, compared with the control groups (p < .05; Figs. 1K, 2A–2D, 2M). Absorbance at 590 nm and mineralization nodule area of the SIRT6-knockdown group were 61.8% and 63.5% that of the control group, respectively, at day 21, as assessed by Alizarin red (p < .05; Fig. 2E–2H, 2N) and von Kossa (p < .05; Fig. 2I–2L, 2O) staining.

image

Figure 2. Sirtuin 6 (SIRT6)-overexpression enhanced the rat bone marrow mesenchymal stem cells (rBMSCs) osteogenic differentiation, while SIRT6–knockdown was on the contrary. (A–D): Alkaline phosphatase (ALP) staining of the cultured rBMSCs in rBMSCs-green fluorescent protein (GFP), rBMSCs–Knockdown–Control, rBMSCs–SIRT6–Knockdown, and rBMSCs–SIRT6–Overexpression groups (left to right). (E–H): Alizarin red staining of the cultured rBMSCs in rBMSCs–GFP, rBMSCs–Knockdown–Control, rBMSCs–SIRT6–Knockdown, and rBMSCs–SIRT6–Overexpression groups (left to right). (I-L): von Kossa staining of mineralization nodules in rBMSCs–GFP, rBMSCs–Knockdown–Control, rBMSCs–SIRT6–Knockdown, and rBMSCs–SIRT6–Overexpression groups (left to right). (M): The percentage of ALP-positive cells area. (N): Alizarin red absorbance at 590 nm staining area, (O): Mineralized matrix areas. (P–R): ALP, RUNX2, and osteocalcin mRNA expression during osteogenic differentiation. The histogram shows the relative quantification of gene expression in rBMSCs–GFP, rBMSCs–Knockdown–Control, rBMSCs–SIRT6–Knockdown, and rBMSCs–SIRT6–Overexpression groups (left to right) and is presented as fold changes compared with control group at days 0, 4, 7, and 14. * and [diaf] indicate a significant difference from the control group (*p < .05, [diaf], p < .01). Scale bar = 200 μm. Abbreviations: ALP, alkaline phosphatase; EF-1α, eukaryotic translational elongation factor 1α; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GFP, green fluorescent protein; OCN, osteocalcin; rBMSCs, rat bone marrow mesenchymal stem cells; SIRT6, Sirtuin 6.

Download figure to PowerPoint

SIRT6 Overexpression Enhances Osteogenesis of rBMSCs In Vitro

When SIRT6 was overexpressed, we observed an enhancement in ALP activity and staining compared with the control group, after 7 days of culture in osteogenic medium (p < .05; Figs. 1K, 2A–2D, 2M).

SIRT6 expression also increased calcium deposition, as assessed by Alizarin red (Fig. 2E–2H) and von Kossa (Fig. 2I–2L) staining at day 21. Absorbance at 590 nm and bone nodule area of the SIRT6-overexpression group were 1.6 and 1.7 times higher, respectively, than those of the control group at day 21, as assessed by Alizarin red (p < .05; Fig. 2N) and von Kossa (p < .05; Fig. 2O) staining.

Effect of SIRT6 Expression Levels on ALP, RUNX2, and OCN Gene Expression

qRT-PCR analysis revealed that SIRT6-overexpression increased ALP and RUNX2 mRNA levels at days 7 and 14 (p < .05; Fig. 2P, 2Q) as well as OCN mRNA levels at days 7 and 14 (p < .05; Fig. 2R). On the other hand, SIRT6 knockdown decreased ALP, RUNX2, and OCN mRNA levels at days 7 and 14 (p < .05; Fig. 2P–2R).

SIRT6 Knockdown Activated NF-κB Pathway

We assessed the impact of SIRT6 on NF-κB transcriptional activity using a dual-luciferase reporter assay system. As shown in Figure 3A, silencing of SIRT6 increased the luciferase activity of the NF-κB reporter by 2.2-fold in the SIRT6–Knockdown group. Additionally, the acetylation of lysine 310 of the p65 subunit of NF-κB was also increased (Fig. 3B), confirming that NF-κB is a target of SIRT6 in rBMSCs.

image

Figure 3. The effect of nuclear factor-κB (NF-κB) signaling on rat bone marrow mesenchymal stem cells (rBMSCs). (A): NF-κB transcriptional activity in rBMSCs–green fluorescent protein (GFP), rBMSCs–Knockdown–Control, rBMSCs–Sirtuin 6 (SIRT6)–Knockdown, and rBMSCs–SIRT6–Knockdown + BAY 11–7082 groups. (B): Acetyl-NF-κB p65 (Lys310) and p65 protein expression by Western blot in rBMSCs–GFP, rBMSCs–Knockdown–Control, rBMSCs–SIRT6–Knockdown, and rBMSCs–SIRT6–Knockdown + BAY 11–7082 groups. (C): Alkaline phosphatase (ALP), RUNX2, and osteocalcin mRNA expression by qRT-PCR in rBMSCs–GFP, rBMSCs–Knockdown–Control, rBMSCs–SIRT6–Knockdown, and rBMSCs–SIRT6–Knockdown + BAY 11–7082 groups. (D): ALP activity in rBMSCs–GFP, rBMSCs–Knockdown–Control, rBMSCs–SIRT6–Knockdown, and rBMSCs–SIRT6–Knockdown + BAY 11–7082 groups. (E–I): ALP staining positive cells in rBMSCs–GFP, rBMSCs–Knockdown–Control, rBMSCs–SIRT6–Knockdown, and rBMSCs–SIRT6–Knockdown + BAY 11–7082 groups. (J–N): Alizarin red staining in rBMSCs–GFP, rBMSCs–Knockdown–Control, rBMSCs–SIRT6–Knockdown, and rBMSCs–SIRT6–Knockdown + BAY 11–7082 groups. *indicates a significant difference between rBMSCs–SIRT6–Knockdown and rBMSCs–SIRT6–Knockdown + BAY 11–7082 groups. [trif] indicates a significant difference between control and rBMSCs–SIRT6–Knockdown + BAY 11–7082 groups. Scale bar = 200 μm. Abbreviations: ALP, alkaline phosphatase; EF-1α, eukaryotic translational elongation factor 1α; fRLU, relative light units of firefly luciferase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GFP, green fluorescent protein; NF-kB, nuclear factor-κB; OD, optical density; rBMSCs, rat bone marrow mesenchymal stem cells; rRLU, relative light units of renilla luciferase; SIRT6, Sirtuin 6.

Download figure to PowerPoint

Decreased Osteogenic Differentiation Ability of rBMSCs Could Be Partially Rescued by the Addition of NF-κB Inhibitor

To further elucidate the functional connection between SIRT6 and NF-κB signaling in the osteogenic differentiation of rBMSCs, we examined the effect of NF-κB inhibition on osteogenesis in SIRT6-knockdown rBMSCs. Upon treatment of SIRT6–Knockdown rBMSCs with the NF-κB inhibitor BAY 11–7082 for 12 hours, NF-κB transcriptional activity and the expression of acetyl-NF-κB p65 (Lys310) showed a significant decrease when compared with the rBMSCs–SIRT6–Knockdown cells without the inhibitor (Fig. 3A, 3B). In addition, inhibition of NF-κB activity partially reversed the decrease in osteogenic differentiation ability of rBMSCs, which was indicated by the expression of osteogenesis-related genes (Fig. 3C) at days 7 and 14, ALP activity and staining (Fig. 3D–3I) at day 7, and Alizarin red staining (Fig. 3J–3N) at day 21.

Adhesion of rBMSCs on the Scaffold

The morphology of the composite scaffold was examined by SEM. As shown in Supporting Information Figure S1A and S1B, CCHS exhibited a spongy appearance and high porosity throughout the cross-section. The pores were interconnected with a pore size of approximately 80 μm.

SEM revealed that rBMSCs seeded on the scaffolds after 24 hours grew into the scaffolds and displayed polygon morphology (Supporting Information Fig. S1C, S1D). Fluorescence microscopy revealed that rBMSCs–GFP and rBMSCs–SIRT6–Overexpression cells could be clearly seen to be uniformly distributed in the CHHS and were of a spindle shape (Supporting Information Fig. S1E, S1F).

Micro-CT Measurement

The morphology of new bone formation was reconstructed using micro-CT 8 weeks after implantation into the skull. Representative photographs of each group are shown in Figure 4. From coronal to sagittal, micro-CT showed that the CCHS–rBMSCs–SIRT6 Overexpression group displayed more bone growth in the skull defect compared with the CCHS–rBMSCs–GFP group at 8 weeks post-operation (Fig. 4C, 4D, 4G, 4H). There was almost no bone formation in the blank group (Fig. 4A, 4E) and some bone formation in the CCHS group (Fig. 4B, 4F). Quantification of the mineralized areas in skull bone defects showed a significant increase in calcified tissues in the defects filled with CCHS–rBMSCs–SIRT6 Overexpression constructs compared with the defects filled with CCHS or CCHS–rBMSCs–GFP constructs (p < .05, Fig. 4Y).

image

Figure 4. Micro-CT and histological assessment of in vivo bone formation. (A–D), coronal; (E–H), sagittal; (A, E), Blank; (B, F), collagen/chitosan/hydroxyapatite scaffold (CCHS) constructs. (C, G): CCHS with rat bone marrow mesenchymal stem cells (rBMSCs)–green fluorescent protein (GFP) constructs; (D, H), CCHS with rBMSCs–Sirtuin 6 (SIRT6)–Overexpression constructs. HE staining (I–L, Q–T) and Masson staining (M–P, U–X). From left to right: Blank, CHHS constructs, CCHS–rBMSCs–GFP constructs, and CCHS–rBMSCs–SIRT6–Overexpression constructs (Scale bar = 200 μm [I–X]). (Y): Quantification of new bone formation volume by Micro-CT. (Z): Quantification of new bone formation area by Masson staining. [diaf] indicates a significant difference between two groups (p < .01). Abbreviations: CCHS, collagen/chitosan/hydroxyapatite scaffold; GFP, green fluorescent protein; rBMSCs, rat bone marrow mesenchymal stem cells; SIRT6, Sirtuin 6.

Download figure to PowerPoint

Histological Analysis of Bone Regeneration

Representative histological photographs of each group are shown in Figure 4. Sections were stained with H&E (Fig. 4I–4L, 4Q–4T) and Masson (Fig. 4M–4P, 4U–4X), respectively. Under the light microscope, the bone formation area in the rBMSCs–SIRT6 Overexpression group was 1.8 times greater than that in the CCHS–rBMSC–GFP group after 8 weeks (p < .05, Fig. 4Z). The CCHS group had increased formation of new bone compared with the blank group. There was almost no new bone formation and only a thin mucous membrane layer observed in the blank group.

Presence of Transplanted Cells in the Newly Formed Bone

The direct participation of donor cells in new bone formation was examined by double immunofluorescence staining for OCN and GFP (Fig. 5). GFP-positive cells were not found in the blank (Fig. 5Aa1–5Aa4) and CCHS (Fig. 5Bb1–5Bb4) groups. GFP-positive donor cells were clearly detected in new bone formation in the CCHS–rBMSCs–GFP (Fig. 5Cc1–5Cc4) and CCHS–rBMSCs–SIRT6 Overexpression (Fig. 5Dd1–5Dd4) groups. The merged image showed that GFP-positive donor cells colocalized with osteocytes expressing OCN (Fig. 5Cc4, 5Dd4).

image

Figure 5. Double immunofluorescence staining for osteocalcin (OCN) plus green fluorescent protein (GFP) analysis in tissue sections in Blank (Aa1–Aa4), CHHS constructs (Bb1–Bb4), collagen/chitosan/hydroxyapatite scaffold (CCHS)–rat bone marrow mesenchymal stem cells (rBMSCs)–GFP constructs (Cc1–Cc4), and CCHS–rBMSCs–Sirtuin 6 (SIRT6)–Overexpression constructs (Dd1–Dd4). (Aa1–Dd1): DAPI staining for nuclei. (Aa2–Dd2): immunofluorescence staining for OCN in the same section by FITC–conjugated goat anti-rabbit secondary antibody. (Aa3–Dd3): Immunofluorescence staining for GFP in the same section by TRITC-conjugated goat anti-mouse secondary antibody. (Aa4–Dd4): Overlay images of Aa1–Aa3, Bb1–Bb3, Cc1–Cc3, and Dd1–Dd3. Arrows show location of OCN- and GFP-positive cells, which represent the donor cells. Scale bar = 50 μm.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusions
  8. Acknowledgments
  9. Authors Contributions
  10. Disclosure of Potential Conflicts of Interest
  11. References
  12. Supporting Information

Bone tissue engineering, which involves the culture of seed cells within an appropriate scaffold material under conditions that optimize bone formation, is a promising approach to overcoming the disadvantages of using autologous, allogeneic, or synthetic bone grafts to treat large bone defects [23]. Adult stem cells harboring modifications in potent osteogenic genes have improved fracture repair and boosted bone formation in vivo [24]. However, we are still a long way from understanding the complex regulatory mechanism of osteogenesis.

Sirtuins are members of the Sir2 (silent information regulator 2) family, and include a group of class III deacetylases consisting of seven sirtuins (SIRT1–7) that share homology with yeast Sir2. Among them, SIRT1, SIRT3, and SIRT6 are induced under conditions of caloric restriction and are considered anti-aging molecules [25]. All sirtuins consist of an enzymatic core for intrinsic catalytic activity and in some instances a C-terminal extension (CTE) [26, 27]. However, SIRT6 comprises a unique small splayed domain, a more general large domain, the Rossmann fold, and a stable single helix replacing the conserved NAD+ binding loop of sirtuins [28]. These unique structures are crucial to the screening of potential activators of SIRT6 [26]. Conditional knockout of SIRT1 resulted in decreased bone mass due to increased resorption and reduced bone formation in mice [14]. Similarly, mice homozygous for SIRT6 deletion are osteoporotic with a 30% loss in bone mineral density, and possibly exhibit defects in glucose homeostasis and fat metabolism [29-31], suggesting a protective role for SIRT6 against metabolic diseases. SIRT6 overexpression has a protective role against the metabolic pathologies caused by diet-induced obesity in mice [29]. Studies have demonstrated that there is a close inverse correlation between obesity and bone mass [32, 33]. SIRT6 is also involved in the direct regulation of proliferation and differentiation of chondrocytes through Indian hedgehog (Ihh) signaling [34]. These results suggest that SIRT6 plays important roles in regulating mammalian longevity and its activation may have a potentially beneficial effect on age-related osteoporosis [29]. In this study, we demonstrated that SIRT6 plays an important role in osteogenesis in vitro and that its overexpression promoted bone formation in vivo.

Immunofluorescence staining performed in this study revealed that SIRT6 was localized within the nucleus, which is consistent with the observations of Michishita et al. [35] that SIRT6 is mainly expressed within the nucleus of normal human fibroblasts. CTE is responsible for proper nuclear localization of SIRT6 and its mutation results in cytoplasmic transfer of SIRT6 [36]. To study the role of SIRT6 in rBMSCs during osteogenesis, endogenous SIRT6 expression was detected and found to be significantly upregulated at days 4 and 7 after osteogenic induction. SIRT6 overexpression and knockdown rBMSCs were then constructed, and subjected to osteogenic induction. SIRT6-knockdown cells exhibited increased proliferation, which is consistent with the previous observation that MEFs with SIRT6 deletion exhibit increased proliferation and even form tumors when implanted into SCID mice [37]. This can be attributed to the inhibitory effect of SIRT6 on the expression of ribosomal genes through corepression of c-Myc and suppression of cancer metabolism [37].

ALP and RUNX2 are regarded as early and key osteogenesis-related genes [38, 39]. SIRT1 is also mainly localized within the nucleus [35] and can be activated by the phytoestrogen resveratrol to enhance osteogenic differentiation of MSCs through deacetylation of RUNX2 [40]. SIRT1 can also promote osteogenic differentiation of mouse MSCs by deacetylating β-catenin to increase its nuclear accumulation [41]. Additionally, resveratrol promotes osteogenesis of human MSCs by increasing RUNX2 promoter activity mediated by the SIRT1/Forkhead box O3 (FOXO3A) biological axis, which is associated with longevity [42, 43]. Interestingly, by forming a complex with nuclear respiratory factor 1 and FOXO3A on the SIRT6 promoter, SIRT1 can upregulate SIRT6 expression [44]. The similarities between SIRT1 and SIRT6 in localization and function [43] indicate that SIRT6 may have the same roles in regulating RUNX2 or β-catenin. In this study, not only ALP and RUNX2 but also OCN, the most specific osteogenic differentiation marker that was subsequently characterized [45], was significantly upregulated in the rBMSCs–SIRT6– Overexpression group and downregulated in the rBMSCs–SIRT6–Knockdown group.

The next question that we addressed was how SIRT6 promotes osteogenesis. Studies have indicated that SIRT6 suppresses certain NF-κB target genes by modifying the chromatin structures of their promoter regions [46]. However, wild-type SIRT6 overexpression does not change the transcriptional activity of NF-κB in human embryonic kidney 293 cells [47]. This discrepancy could be due to the use of different cell types in these studies. In this study, SIRT6 knockdown in the rBMSCs activated NF-κB transcriptional activity and increased acetyl-NF-κB p65. Additionally, the impaired osteogenic differentiation of these rBMSCs could be partially rescued by the addition of NF-κB inhibitor. These results highlight the fact that SIRT6 modulates the function of rBMSCs in vitro. NF-κB signaling was first discovered by Sen and Baltimore, and plays important roles in regulating both innate and adaptive immunity [48, 49]. Older rodents have elevated nuclear expression of NF-κB components p52 and p65 compared with the young ones [50]. In addition, the transcriptional activity of NF-κB correlates positively with aging in the major lymphoid tissues and bone marrow [51]. Proinflammatory cytokines such as IL-1β and tumor necrosis factor alpha (TNFα) can also result in excessive activation of NF-κB signaling which leads to excessive inflammation, which in turn works against the healing process in the host [52]. Dysregulation of NF-κB target gene expression results in severe erosive colitis, and may be responsible for the death of mice harboring SIRT6 deletion [53], underscoring the importance of strictly regulating NF-κB signaling. It has been demonstrated that acetylation of lysine 310 is essential for p65 transcriptional activity, and functions by increasing DNA binding of NF-κB and decreasing its interaction with IκBα [52, 54]. SIRT6 overexpression can suppress the production of IL-1β and TNFα involved in the pathogenesis of collagen-induced arthritis as well as excessive osteoclast activity, a hallmark feature of age-related osteoporosis [55]. To sum up, it is reasonable to speculate that SIRT6 attenuates hyperactive NF-κB signaling, brought about by aging and autoimmune diseases, through inhibition of p65 acetylation. SIRT6 could therefore be investigated as a potential therapeutic target for age-related osteoporosis. As NF-κB inhibitor only partially rescues the reduced osteogenic ability of rBMSCs, additional experiments are needed to elucidate other signal pathways involved in this process, such as RUNX2, Wnt, and Ihh.

The in vivo bone repair abilities of modified rBMSCs harboring SIRT6 overexpression or GFP constructs were examined by combining them with the use of CCHS to repair a critical-sized defect in rat skull. The micro- or nanosized HA present in this scaffold has been shown to promote differentiation of rBMSCs into osteoblasts [56]. Chitosan has been used as a carrier for drug delivery, wound healing material, and in cartilage and bone tissue engineering [57-59]. Type I collagen and HA are the main components of bone and the most commonly used biomaterials in bone tissue engineering due to their biocompatibility [60]. CCHS has been regarded as a promising scaffold for bone regeneration [21]. In this study, CCHS was used as a carrier for modified rBMSCs, and GFP was used for tracing the growth of the transplanted cells. The transplanted cells could either directly differentiate into osteocytes to produce bone matrix, or indirectly increase bone formation through the production of factors that promote osteogenic differentiation of host cells [61, 62]. The detection of GFP in the osteocytes showed that modified rBMSCs directly enhance bone defect repair by generating bone matrix. However, GFP expression was not detectable in some OCN-positive cells, suggesting that the new bone was formed through the collective action of both exogenous and endogenous cells. Further studies are required for confirming whether SIRT6-overexpressing cells promote bone defect repair through a paracrine effect on the progenitor cells of the host; moreover, the mechanism of such a repair process needs to be elucidated.

Conclusions

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusions
  8. Acknowledgments
  9. Authors Contributions
  10. Disclosure of Potential Conflicts of Interest
  11. References
  12. Supporting Information

We have demonstrated that SIRT6 is expressed in rBMSCs, which is a novel finding. We show by in vitro experiments that SIRT6 modulates the function of rBMSCs partially by suppressing NF-κB signaling. Moreover, SIRT6-overexpressing rBMSCs combined with the use of CCHS promote calvarial defect repair in rats. SIRT6 could therefore be investigated as a potential therapeutic target for age-related osteoporosis. Additional experiments are required to address the effect of SIRT6 on other developmental pathways in BMSCs.

Acknowledgments

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusions
  8. Acknowledgments
  9. Authors Contributions
  10. Disclosure of Potential Conflicts of Interest
  11. References
  12. Supporting Information

This work was supported by the National Natural Science Foundation of China (grants 81070852 and 81171010) and the Fundamental Research Fund for the Central Universities. (2012304020204).

Authors Contributions

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusions
  8. Acknowledgments
  9. Authors Contributions
  10. Disclosure of Potential Conflicts of Interest
  11. References
  12. Supporting Information

H.S.: conception and design, data analysis and interpretation, manuscript writing; Y.W.: conception and design, collection and assembly of data, manuscript writing; D.F. and Y.L.: provision of study material; C.H.: conception and design, financial support, provision of study material, final approval of manuscript. H.S. and Y.W. contributed equally to this article.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusions
  8. Acknowledgments
  9. Authors Contributions
  10. Disclosure of Potential Conflicts of Interest
  11. References
  12. Supporting Information

Supporting Information

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusions
  8. Acknowledgments
  9. Authors Contributions
  10. Disclosure of Potential Conflicts of Interest
  11. References
  12. Supporting Information

Additional Supporting Information may be found in the online version of this article.

FilenameFormatSizeDescription
stem1671-sup-0001-suppinfofigS1.tif10908KSupplementary Information Figure 1

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.