SEARCH

SEARCH BY CITATION

Keywords:

  • Cre-loxP system;
  • Induced pluripotency;
  • Lentiviral vector;
  • Transcription factors

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. CONCLUSION
  8. DISCLOSURE OF POTENTIAL CONFLICTS OF INTEREST
  9. References
  10. Supporting Information

We report the derivation of induced pluripotent stem (iPS) cells from adult skin fibroblasts using a single, polycistronic lentiviral vector encoding the reprogramming factors Oct4, Sox2, and Klf4. Porcine teschovirus-1 2A sequences that trigger ribosome skipping were inserted between human cDNAs for these factors, and the polycistron was subcloned downstream of the elongation factor 1 alpha promoter in a self-inactivating (SIN) lentiviral vector containing a loxP site in the truncated 3′ long terminal repeat (LTR). Adult skin fibroblasts from a humanized mouse model of sickle cell disease were transduced with this single lentiviral vector, and iPS cell colonies were picked within 30 days. These cells expressed endogenous Oct4, Sox2, Nanog, alkaline phosphatase, stage-specific embryonic antigen-1, and other markers of pluripotency. The iPS cells produced teratomas containing tissue derived from all three germ layers after injection into immunocompromised mice and formed high-level chimeras after injection into murine blastocysts. iPS cell lines with as few as three lentiviral insertions were obtained. Expression of Cre recombinase in these iPS cells resulted in deletion of the lentiviral vector, and sequencing of insertion sites demonstrated that remnant 291-bp SIN LTRs containing a single loxP site did not interrupt coding sequences, promoters, or known regulatory elements. These results suggest that a single, polycistronic “hit and run” vector can safely and effectively reprogram adult dermal fibroblasts into iPS cells. Stem Cells 2009;27:1042–1049


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. CONCLUSION
  8. DISCLOSURE OF POTENTIAL CONFLICTS OF INTEREST
  9. References
  10. Supporting Information

Takahashi and Yamanaka initially reported the direct reprogramming of murine embryonic fibroblasts (MEFs) to induced pluripotent stem (iPS) cells in August 2006 [1]. Since this time, a large number of laboratories have derived iPS cells from somatic cells, and many important advances have been made [2–25]. However, only two recent reports have described methods that avoid stable integration of exogenous reprogramming factor genes into the iPS cell genome. Stadtfeld et al. [23] utilized adenovirus to overexpress Oct4, Sox2, Klf4, and c-Myc primarily in adult hepatocytes and Okita et al. [17] utilized a polycistronic plasmid to deliver Oct4, Klf4, and Sox2 to MEFs. Reliable reprogramming of adult skin fibroblasts by these methods was not described. Since skin biopsies from adult patients are a readily accessible source of somatic cells, we designed a single “hit and run” vector to reprogram adult dermal fibroblasts. We demonstrate that adult skin fibroblasts from a humanized mouse model of sickle cell disease [26] can be reprogrammed reliably to iPS cells by transduction with a polycistronic lentiviral vector and that the reprogramming sequences can be efficiently deleted from the iPS cell genome. These data provide a foundation for reprogramming human dermal fibroblasts from skin biopsies of patients with hereditary disorders such as sickle cell disease.

MATERIALS AND METHODS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. CONCLUSION
  8. DISCLOSURE OF POTENTIAL CONFLICTS OF INTEREST
  9. References
  10. Supporting Information

Production of OSK Polycistronic Lentiviral Vector

See supporting information Figure 1 for a complete nucleotide/amino acid map of the polycistron and polymerase chain reaction (PCR) primers used. Construction of the polycistron using PTV1 2A sequences and fusion PCR was performed essentially as described [27]. Briefly, human Oct4 cDNA (Clone 40125986; Open Biosystems, Huntsville, AL, http://www.openbiosystems. com) was PCR amplified and modified with primers OCT4-F and OCT4-R to contain Not I and Swa I restriction sites at the 5′ end and a Kozak consensus sequence. At the 3′ end, the Oct4 stop codon was eliminated and replaced with nucleotides (nt) from PTV1 2A that will form a 22-nt overlap with the 5′ end of the Sox2 amplicon. Human Sox2 cDNA (Clone 2823424; Open Biosystems) was PCR amplified and modified with primers SOX2-F and SOX2-R to overlap with the 3′ end of the Oct4 amplicon and to append 2A nt sequences upstream of the Sox2 ATG. At the 3′ end, the Sox2 stop codon was eliminated and replaced with nt from PTV1 2A that will form a 22-nt overlap with the 5′ end of the Klf4 amplicon. Human Klf4 cDNA (Clone 5111134; Open Biosystems) was PCR amplified and modified with primers KLF4-F and KLF4-R to overlap with the 3′ end of the Sox2 amplicon and to append 2A nt sequences upstream of the Klf4 ATG. At the 3′ end, the Klf4 stop codon was retained and Swa I and Sal I restriction sites were added. After PCR the individual amplicons were gel purified and used in a three-element fusion PCR at a 1:100:1 (Oct4/Sox2/Klf4) molar ratio along with primers OCT4-F and KLF4-R to produce a 3,623-bp amplicon containing the polycistron. The polycistron was gel purified and cloned into the general cloning vector pKP114 using the NotI and SalI restriction sites (enzymes from Roche Diagnostics, Basel, Switzerland, http://www.roche-applied-science.com) to produce pKP330 and sequenced for authenticity. Subsequently, the polycistron was removed from pKP330 as a SwaI (Roche Diagnostics) fragment and subcloned into a SwaI site downstream of the elongation factor 1 alpha (EF-1α) promoter in the lentiviral vector pDL171 [28] to produce the OSK polycistronic lentiviral vector pKP332, which was also sequenced for authenticity.

By the same strategy we produced a second polycistronic lentival vector, pKP333, that substitutes the PTV1 2A peptide between Sox2 and Klf4 with the Thosea asigna virus 18 amino acid 2A-like sequence: GSG (linker) EGRGSLLTCGDVEENPGP.

PCR reactions were performed using PrimeStar polymerase (Takara, Otsu, Japan, http://www.takara.co.jp). All of the oligos used in this study were synthesized by Integrated DNA Technologies (Coralville, IA, http://www.idtdna.com/Home/Home.aspx) and all DNA gel extractions were performed using QIAquick Gel Extraction Kits (Qiagen, Hilden, Germany, http://www1.qiagen.com).

Cell Culture and Viral Infections

Embryonic stem (ES) cells and iPS cells were cultured on irradiated MEFs in ES cell media consisting of Dulbecco's modified Eagle's medium supplemented with 1× nonessential amino acids, 1× penicillin–streptomycin, 1× L-glutamine (all from Mediatech, Manassas, VA, http://www.cellgro.com), 1× nucleosides (Chemicon, Temecula, CA, http://www.chemicon.com), 15% fetal bovine serum (FBS; HyClone, Logan, UT, http://www.hyclone.com), 2-mercaptoethanol (Sigma-Aldrich, St. Louis, MO, http://www.sigmaaldrich.com), and leukemia inhibitory factor (laboratory preparation).

For preparation of lentivirus, 140 μg of the polycistronic vector (pKP332), 70 μg of the envelope plasmid (pMDG), and 105 μg of the packaging plasmid (pCMBVdR8.9.1) were cotransfected into 1.7 × 107 293T cells by the CaCl2 method as previously described [28]. Virus-containing supernatant was collected 2 days after transfection, passed through a 0.45-μm filter, and concentrated by centrifugation at 26,000 rpm for 90 minutes at 8°C in an SW-28 rotor using a Beckman XL-100 ultracentrifuge.

For iPS cell induction, 3 × 105 mouse tail-tip fibroblasts (TTFs) were seeded onto one well of a six-well plate. The next day, 2.5 μl of the concentrated virus was mixed with 2 ml of ES cell medium containing 8 μg/ml polybrene and added to the TTFs. Forty-eight hours later, the TTFs were trypsinized and transferred to a 100-mm dish without MEFs and continuously cultured on the same dish for 3 weeks with daily media changes. Potential iPS cell colonies started to appear after 2–3 weeks. These colonies were individually picked and expanded on MEFs for analysis.

To remove the integrated lentiviral and polycistronic sequences, iPS cells were either electroporated with a Cre-expressing plasmid (pCAGGS-Cre) or infected with a Cre-expressing adenovirus (rAd-Cre-IE). Individual colonies were picked and Cre-mediated removal of floxed sequences was verified by PCR and Southern blot analysis.

For the construction of rAd-Cre-IE (rAd-Cre-IRES-EGFP), Cre cDNA was PCR amplified from pCAGGS-Cre and inserted between the NheI and EcoRI sites of the expression vector pEC-IE, which contains an IRES-EGFP downstream of the MCS. The Cre-IE expression cassette is flanked by attL1 and attL2 sites, thus allowing transfer of the Cre-IE sequence from pEC-IE to pAd/pl-DEST (Invitrogen, Carlsbad, CA, http://www.invitrogen.com) by the LR reaction. The recombinant adenovirus was packaged in 293A cells according to the manufacturer's instructions.

With the exception of the pKP332 construction, all of the PCRs performed in this study used ExTaq polymerase (Takara). All of the sequencing for this study was performed by the Genomics Core Facility of the Howell and Elizabeth Heflin Center for Human Genetics of the University of Alabama at Birmingham, using the BigDye Terminator v3.1 Cycle Sequencing Ready Reaction kit as per the manufacturer's instructions (Applied Biosystems, Foster City, CA, http://www.appliedbiosystems.com). The sequencing products were run following standard protocols on an Applied Biosystems 3730 Genetic Analyzer with POP-7 polymer.

Immunostaining and Alkaline Phosphatase Staining

iPS cells were cultured on cover slips pretreated with FBS, fixed with 4% paraformaldehyde, and permeabilized with 0.5% Triton X-100. Cells were stained with primary antibodies against Nanog and stage-specific embryonic antigen-1 (SSEA1) (R&D Systems Inc., Minneapolis, MN, http://www.rndsystems.com) and incubated with fluorophore-labeled secondary antibodies (Jackson Immunoresearch Laboratories, West Grove, PA, http://www.jacksonimmuno.com).

For alkaline phosphatase staining, 100 to 200 iPS cells were seeded onto one well of a six-well plate and cultured for 1 week. iPS cells were then stained using the Vector Blue Alkaline Phosphatase Substrate Kit III (Vector Laboratories, Burlingame, CA, http://www.vectorlabs.com) according to the manufacturer's instructions.

Reverse Transcription-PCR Analysis

Total RNA was isolated from cells with Trizol reagent (Invitrogen). RNA was pretreated with RQ1 RNase-free DNase (Promega, Madison, WI, http://www.promega.com) and reverse transcribed with SuperScript First-Strand Synthesis System (Invitrogen) using oligo d(T)n. Primers used for PCR amplification of the cDNA were as follows: polycistronic transgene F, gatgaactgaccaggcacta and R, gattatcggaattccctcgag; Nanog F, accaaaggatgaagtgcaag and R, agttttgctgcaactgtacg; Oct4 F, agcttgggctagagaaggat and R, tcagtttgaatgcatgggag; Sox2 F, tgcacatggcccagcacta and R, ttctccagttcgcagtccag; Cripto F, aacttgctgtctgaatggag and R, tttgaggtcctggtccatca; Klf4 F, cagcagggactgtcaccctg and R, ggtcacatccactacgtgggat; and Nat1 F, ggagagtgcgattgcagaag and R, ggtcacatccactacgtggga.

Bisulfite Modification and Sequencing

Bisulfite treatment of DNA was performed with the CpGenome Fast DNA Modification Kit (Chemicon) according to the manufacturer's instructions. The Oct4 and Nanog gene promoter regions were amplified by nested PCR using the Oct4 primers F1, gttgttttgttttggttttggatat, F2, atgggttgaaatattgggtttattta and R, ccaccctctaaccttaacctctaac or the Nanog primers F1, gaggatgttttttaagtttttttt, F2, aatgtttatggtggattttgtaggt, and R, cccacactcatatcaatataataac. Amplified PCR products were purified using a Gel Extraction Kit (Qiagen), cloned into a Topo TA vector (Invitrogen), and sequenced with T7 and M13R primers.

Southern Blot Analysis

Ten micrograms of genomic DNA were digested with BamHI or KpnI (Roche Diagnostics), separated on a 0.8% agarose gel, and blotted onto Hybond-N + membrane (Amersham Biosciences, Piscataway, NJ, http://www.amersham.com). The polycistronic vector served as template to PCR for amplification of a 0.3-kb self-inactivating long terminal repeat (SIN LTR) probe using the primers F, gctcggtacctttaagaccaatgac and R, atgctgctagagattttccacactg. To produce the internal probe, the polycistronic vector was digested with SalI and XhoI (Roche Diagnostics) and the 1-kb fragment containing the EF-1α promoter was gel purified. Probes were labeled using the Random Primed DNA Labeling Kit (Roche Diagnostics) with 32P-α-dCTP and blots were hybridized in MiracleHyb solution (Stratagene, La Jolla, CA, http://www.stratagene.com).

Inverse PCR

About 1–2 μg of total genomic DNA was digested with the tetranucleotide-recognizing restriction enzymes MseI or AluI (New England Biolabs, http://www.neb.com). The digested fragments were diluted and incubated with T4 DNA Ligase (Roche Diagnostics) to obtain self-ligated monomers, which were then linearized with the hexanucleotide-recognizing restriction enzymes NcoI or XmnI (NEB). These fragments were isolated by ethanol precipitation and used as templates in PCR reactions using the primers 5LentiR1, tgaattgatcccatcttgtcttcg and 5LentiF1, tgctgctttttgcttgtactgg. The PCR products were run on a 2% agarose gel in the presence of ethidium bromide (0.5 μg/ml). All bands visible under UV light were gel purified and sequenced.

Teratoma Formation

One million iPS cells in 100 μl of PBS were injected via a 21-G needle into the dorsal flanks of severe combined immunodeficiency (SCID) mice. Teratomas were recovered 4–5 weeks postinjection and processed for histological analysis.

Production and Analysis of Chimeric Mice

C57BL/6 blastocysts were injected with iPS cells and then transferred to pseudopregnant CD-1 females. After 2 weeks, embryos were collected for photographs and analyzed for chimerism using PCR. Embryos were individually minced and lysed overnight at 55°C in a solution of ProteinaseK and SDS. DNA was then purified from the lysate by phenol/chloroform extraction and ethanol precipitation. PCR was performed using the primers mbeta KI F, ttgagcaatgtggacagagaagg, Mbeta KI R, gtcagaagcaaatgtgaggagca, and 1400gamma R, aattctggcttatcggaggcaag.

RESULTS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. CONCLUSION
  8. DISCLOSURE OF POTENTIAL CONFLICTS OF INTEREST
  9. References
  10. Supporting Information

Figure 1A illustrates the lentiviral vector that we constructed for transduction of adult skin fibroblasts. Human Oct4, Sox2, and Klf4 cDNAs were linked with porcine teschovirus-1 (PTV1) 2A sequences that function as cis-acting hydrolase elements (CHYSELs) to trigger ribosome skipping [29, 30]. The 2A peptide sequences (Fig. 1B) are cleaved during translation, and Oct4 and Sox2 proteins containing an additional 21 amino acids at the carboxy termini were produced. A single proline is also appended to the amino-termini of Sox2 and Klf4. The OSK polycistron was subcloned downstream of an EF-1α promoter in a SIN lentiviral vector containing a loxP site in the truncated 3′ LTR [28, 31]. After lentivirus production, 1 million adult skin fibroblasts derived from tail tips of humanized sickle mice were transduced with the polycistronic vector, and four colonies with highly defined borders and tightly packed cells were picked at 19–30 days post-transduction. These colonies were expanded and stained for alkaline phosphatase, Nanog, and SSEA1, which are characteristic markers of pluripotent stem cells. Figures 2A and 2B illustrate the staining pattern of typical colonies (iPS-1 and iPS-2). The colonies stained intensely for alkaline phosphatase and strongly with antibodies to Nanog and SSEA1.

Figure 1. OSK lentiviral vector for reprogramming adult skin fibroblast to iPS cells. (A): Human Oct4, Sox2, and Klf4 cDNAs were linked with porcine teschovirus-1 2A sequences that function as cis-acting hydrolase elements to trigger “cleavage” and ribosome skipping. This polycistron was subcloned downstream of an EF-1α promoter in a SIN lentiviral vector containing a loxP site in the truncated 3′ LTR. (B): The amino acid sequence of the 2A polypeptide is listed; the arrow marks the site of “cleavage” during translation. Abbreviations: cPPT, central PolyPurine Tract; EF-1α, elongation factor 1 alpha; LTR, long terminal repeat; RRE, rev response element; SA, splice acceptor; SD, splice donor; SIN LTR, self-inactivating LTR; WPRE, woodchuck hepatitis virus post-transcriptional regulatory element.

Download figure to PowerPoint

thumbnail image

Figure 2. iPS cell colonies stained for markers of pluripotency. Following OSK lentiviral transduction of adult fibroblasts, colonies were picked, expanded, and stained for alkaline phosphatase, Nanog, and SSEA1. iPS-1 and iPS-2 are independent colonies derived from the original transduction. iPS-1 Cre1 is one of many colonies obtained after Cre recombinase-mediated deletion of the OSK lentiviral vector in iPS-1 cells. Abbreviations: DAPI, 4′-6-diamidino-2-phenylindole; iPS, induced pluripotent stem; SSEA1, stage-specific embryonic antigen-1.

Download figure to PowerPoint

thumbnail image

Reverse transcription (RT)-PCR assays for expression of additional iPS cell markers are shown in Figure 3. iPS-1, -2, and -3 cells expressed polycistronic OSK RNA and endogenous Oct4, Sox2, Klf4, Nanog, and Cripto RNA (Fig. 3A). Consistent with these results, bisulfite sequencing of the endogenous Oct4 and Nanog promoters in iPS-1 and iPS-2 cells demonstrated hypomethylation of these sequences (Fig. 3B). CpGs in the endogenous Oct4 and Nanog promoters of TTFs were highly methylated (Fig. 3B) and endogenous Oct4, Sox2, Nanog, and Cripto RNAs were not detected (Fig. 3A).

Figure 3. Reverse transcription-polymerase chain reaction (RT-PCR) analysis and bisulfite sequence analysis of iPS cells derived by OSK lentiviral transduction of adult skin fibroblasts. (A): RT-PCR assays of polycistronic OSK RNA and endogenous Oct4, Sox2, Klf4, Nanog, and Cripto RNA in iPS cells from three independent colonies (iPS-1, iPS-2, and iPS-3) and from iPS-1 cells after Cre recombinase-mediated deletion of the OSK lentiviral vector (iPS-1 Cre1). (B): Bisulfite sequencing of the endogenous Oct4 and Nanog promoters in iPS-1, iPS-2, and iPS-1 Cre1 cells compared with control TTF and wild-type ES cells. Filled circles represent methylated CpGs and open circles represent unmethylated CpGs. Abbreviations: ES, embryonic stem; iPS, induced pluripotent stem; -RT, minus reverse transcriptase; TTF, tail-tip fibroblast.

Download figure to PowerPoint

thumbnail image

When these iPS cells were injected into the dorsal flanks of nonobese diabetic (NOD)/SCID IL-2gammaR −/− mice, teratomas containing tissue derived from all three germ layers were obtained (Fig. 5). These results demonstrate that the polycistronic OSK lentiviral vector effectively reprograms adult skin fibroblasts to iPS cells.

The polycistronic vector was deleted by electroporation of iPS cells with a Cre recombinase-expressing plasmid or by infection of iPS cells with adenovirus that expresses Cre recombinase (Adeno/Cre). Subsequently, individual colonies were picked and expanded and iPS cell DNA was analyzed by Southern blot hybridization (Fig. 4A and 4B). DNA isolated before (iPS-1) and after (iPS-1 Cre) Cre expression was digested with Kpn I, which cuts once within the OSK polycistron, and probed with a DNA fragment containing EF-1α sequences. Four bands are observed for iPS-1 DNA, indicating that four copies of the polycistronic OSK vector are integrated into the genome. None of these four bands are observed in iPS-1 Cre DNA; only a band representing endogenous EF-1α sequences is detected. Similar results were observed when iPS-2 and iPS-2 Cre DNAs were analyzed except that only three bands indicating three insertion sites were detected before Cre deletion (data not shown). iPS-1 Cre and iPS-2 Cre DNAs were also digested with BamHI and probed with LTR sequences. Figures 4C and 4D demonstrate that iPS-1 Cre cells contain four copies of the remnant SIN LTR and iPS-2 Cre cells contain three copies of this sequence. These results demonstrate that transient Cre expression effectively deletes all copies of the polycistronic OSK lentiviral vector.

Figure 4. Map and Southern blot hybridization of iPS cell DNA before and after OSK vector deletion. (A, B): iPS-1 cell DNA was digested with KpnI and probed with EF-1α promoter sequences. The asterisk marks the position of the endogenous EF-1α fragment. TTF and ES cell DNAs are controls. iPS-1 cells contain four copies of the OSK lentiviral vector. All four copies of the vector are deleted after transient Cre recombinase expression. (C, D): iPS-1 Cre and iPS-2 Cre cell DNAs were digested with BamHI and probed with LTR sequences. iPS-1 Cre cells contain four copies of the remnant 291-bp SIN LTR and iPS-2 Cre cells contain three copies of this 291-bp fragment. Table 1 lists the genomic locations of these sequences. None of the integration sites are in promoters, exons, or known regulatory elements. Also, the small SIN LTR does not contain a promoter or enhancer; therefore, the probability of insertional activation or inactivation of endogenous genes is low. Abbreviations: EF-1αP, elongation factor 1 alpha promoter; ES, embryonic stem; iPS, induced pluripotent stem; SIN LTR, self-inactivating long terminal repeat; TTF, tail-tip fibroblast.

Download figure to PowerPoint

thumbnail image

Junctions of the four iPS-1 insertion sites and the three iPS-2 insertion sites were cloned by inverse PCR and sequenced [32, 33]. Table 1 lists the locations of these sites. Three of the iPS-1 insertion sites are within introns, and one is located in an intergenic region that is 2 Mb downstream of the transcription start site (TSS) of the NMBr gene and 1 Mb upstream of the TSS of the Cited2 gene. All three iPS-2 insertions are located in introns. These results demonstrate that iPS cells can be readily obtained by this procedure without interruption of coding sequences, promoters, or known regulatory elements. Cloning and sequencing of the insertion sites from iPS-1 Cre cells demonstrated that only the 291-bp 3′ LTR of the polycistronic vector remains in the genome. This small SIN LTR does not contain a promoter or enhancer; therefore, the probability of insertional activation or inactivation of endogenous genes is low.

Table 1. OSK lentiviral integration sites
  1. Integration sites were cloned by inverse polymerase chain reaction and sequenced. Location of the sequences was determined by searching GenBank with the NCBI/Blast search engine.

  2. Abbreviations: iPS, induced pluripotent stem; TSS, transcription start site.

inline image

Figure 2 demonstrates that iPS-1 Cre cells continue to stain positive for alkaline phosphatase, Nanog, and SSEA1 after OSK deletion, and Figure 3 demonstrates that expression of endogenous Oct4, Sox2, Klf4, Nanog, and Cripto was maintained in the absence of OSK expression. As expected, the endogenous Oct4 and Nanog promoters remained hypomethylated after OSK deletion (Fig. 3B and 3C).

Finally, two iPS-1 Cre cell lines were injected into wild-type blastocysts, and these blastocysts were transferred into the uteri of pseudopregnant female mice. After 2 weeks, embryos were analyzed for chimerism by PCR with primers specific for human and mouse β-globin genes. Figure 5B demonstrates that several high-level chimeras were obtained; most tissues of these embryos were derived from iPS-1 Cre cells which contain only human β-globin genes. One pregnancy was allowed to proceed to term, and Figure 5C shows an adult high-level chimera (right) derived from iPS-1 Cre 2 cells. These results strongly suggest that adult skin fibroblasts can be effectively reprogrammed to iPS cells with our “hit and run” polycistronic lentiviral vector and that tissues from all three germ layers can be derived from these cells.

Figure 5. Teratomas and chimeras derived from iPS cells. (A): Teratomas containing tissue derived from all three germ layers were obtained when iPS cells were injected into the dorsal flanks of nonobese diabetic/severe combined immunodeficiency IL-2gammaR −/− mice. (a): Intestine-like epithelium, with pancreatic acini in iPS-3 teratoma; (b): respiratory epithelium; (c): skeletal muscle; (d): bone, with hyaline cartilage in iPS-2 teratoma; (e): nervous tissue; (f): skin-like stratified squamous epithelium. (B): Chimeric embryos were obtained following injection of iPS-1 Cre 1 and iPS-1 Cre 2 cells into wild-type blastocysts and transfer of these blastocysts into the uteri of pseudopregnant female mice. Two weeks after injection, embryos were analyzed for chimerism by polymerase chain reaction with primers specific for hβ and mβ genes. iPS cells contain only hβ genes. (C): Adult chimeric animal (right) obtained by injection of iPS-1 Cre 1 cells into murine blastocysts and transfer of the blastocysts into pseudopregnant recipients. Nonchimeric littermate (left). Abbreviations: hβ, human β-globin; iPS, induced pluripotent stem; mβ, mouse β-globin.

Download figure to PowerPoint

thumbnail image

DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. CONCLUSION
  8. DISCLOSURE OF POTENTIAL CONFLICTS OF INTEREST
  9. References
  10. Supporting Information

Direct reprogramming of adult somatic cells to pluripotent stem cells has tremendous therapeutic potential. We recently demonstrated that adult skin fibroblasts from our humanized sickle mice can be reprogrammed into iPS cells and that the sickle mutation can be corrected in these cells by gene replacement. Hematopoietic progenitors derived from corrected iPS cells were transplanted into irradiated sickle mouse recipients, which corrected the severe anemia and organ pathology that characterize sickle cell disease in humans [2]. Although these results provided a foundation for a similar approach in humans, the reprogramming vectors that we used previously cannot be employed in human cells that will ultimately be used for therapy. Therefore, we developed and tested a single, polycistronic lentiviral vector that can be deleted after reprogramming adult fibroblasts into iPS cells.

Porcine teschovirus-1 2A sequences that trigger ribosome skipping were inserted between human Oct4, Sox2, and Klf4 cDNAs, and the polycistron was subcloned downstream of an EF-1α promoter in a SIN lentiviral vector containing a loxP site in the truncated 3′ LTR. The 2A peptide CHYSEL sequences signal the ribosome to skip formation of a peptide linkage between a glycine and a proline during translation and produce Oct4 and Sox2 proteins containing additional 21 amino acids at the carboxy termini (supporting information Fig. 1). A single proline is also appended to the amino termini of Sox2 and Klf4. Our results demonstrate that Oct4, Sox2, and Klf4 with these terminal modifications are fully capable of reprogramming adult skin fibroblast into iPS cells. Both transient Cre expression from a plasmid and Adeno/Cre infection of iPS cells effectively deleted the OSK polycistronic lentival vector. Importantly, after OSK deletion and injection into NOD/SCIDIL2R−/− mice, individual clones of iPS cells were capable of forming tissues derived from all three germ layers. These tissues included endoderm-derived intestine epithelium, ciliated respiratory epithelium and pancreatic acini, mesoderm-derived skeletal muscle, cartilage and bone, and ectoderm-derived nervous tissue and skin-like stratified squamous epithelium. Furthermore, after lenti/OSK deletion, high-level chimeric embryos and adults were obtained when iPS cells were injected into wild-type blastocysts.

Yamanaka's group recently reported that a similar polycistronic vector containing foot and mouth disease virus 2A peptides could reprogram MEFs to iPS cells [17]. In these experiments, an OKS polycistronic plasmid was transiently cotransfected with a c-Myc plasmid into MEFs, and these embryonic cells were successfully reprogrammed into iPS cells. Remarkably, no vector DNA was stably integrated into the iPS cell genome. However, the reprogramming of adult skin fibroblasts was not reported in the paper and may be difficult to achieve by transient transfection. Reprogramming of adult skin fibroblasts is less efficient than reprogramming of MEFs [6]. The combination of inefficient transient transfection of adult dermal fibroblasts and inefficient reprogramming by this method may inhibit the practical application of this protocol to adult cells.

Recently, Sommner et al. [34] and Carey et al. [35] reported the derivation of iPS cells from adult skin fibroblasts using polycistronic lentiviral vectors. Both groups demonstrated that individual clones of iPS cells were capable of forming tissues derived from all three germ layers after injection into immunocompromised mice and that high-level chimeras were formed after injection of iPS cells into wild-type murine blastocysts. However, in neither case was the polycistronic vector deleted from the genome. Also, insertion sites were not cloned, sequenced, or mapped to specific genomic locations. These steps are important for clinical application of this technology. We have demonstrated that our “hit and run” vector is capable of reliably reprogramming adult skin fibroblasts and that the vector can be efficiently deleted from the genome. In addition, we have cloned, sequenced, and mapped the small sequences remaining after vector deletion and demonstrated that these remnant sequences do not interrupt exons, promoters, or known regulatory elements.

CONCLUSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. CONCLUSION
  8. DISCLOSURE OF POTENTIAL CONFLICTS OF INTEREST
  9. References
  10. Supporting Information

In summary, we have demonstrated that iPS cells can be reliably produced from adult dermal fibroblasts of humanized sickle mice with a single, “hit and run” polycistronic lentiviral vector encoding the human reprogramming factors Oct4, Sox2, and Klf4. After deletion of the vector, small remnant fragments (291 bp) remain in the iPS cell genome; however, these DNA fragments do not contain promoter or enhancer sequences and do not interrupt coding sequences, promoters, or regulatory elements. Therefore, the probability of insertional activation or inactivation of endogenous genes is low. These results provide a foundation for reprogramming skin fibroblasts of pediatric and adult sickle cell patients and bring gene replacement therapy [2, 26, 36] a step closer to reality for this devastating disease.

References

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. CONCLUSION
  8. DISCLOSURE OF POTENTIAL CONFLICTS OF INTEREST
  9. References
  10. Supporting Information

Supporting Information

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. CONCLUSION
  8. DISCLOSURE OF POTENTIAL CONFLICTS OF INTEREST
  9. References
  10. Supporting Information

Additional supporting information available online.

FilenameFormatSizeDescription
STEM_00039_sm_suppfigure1.doc54KSupporting Information Figure 1
STEM_00039_sm_suppLeg.doc42KSupporting Information Figure Legend

Please note: Wiley-Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.