SEARCH

SEARCH BY CITATION

Keywords:

  • induced pluripotent stem cells;
  • mesenchymal stem cells;
  • somatic stem cells;
  • embryonic stem cells;
  • adipose tissue;
  • bone marrow;
  • regenerative medicine;
  • tissue engineering

Abstract

  1. Top of page
  2. Abstract
  3. 1. Introduction
  4. 2. Materials and methods
  5. 3. Results
  6. 4. Discussion
  7. Acknowledgements
  8. References

Bone marrow-derived mesenchymal stem cells (BMSCs) and adipose tissue-derived mesenchymal stem cells (AMSCs) have been used clinically for tissue regeneration; however, their proliferation/differentiation potentials are limited. Recently, induced pluripotent stem cells (iPSCs), known to have nearly unlimited potential to proliferate and differentiate into cells of all three germ layers, have gained wide interest in regenerative medicine. Here, we generated iPSCs from frozen-stocked AMSCs and BMSCs and examined their biological characteristics by comparative analyses. Although the iPSCs were more challenging to generate from the BMSCs than the AMSCs, both iPSC populations expressed pluripotent markers, such as stage-specific embryonic antigen (SSEA)-3, SSEA-4, tumour-related antigens (TRAs) TRA-1-60 and TRA-1-81, OCT3/4 and NANOG. Furthermore, both cell populations differentiated well into three germ layer-derived cells, both in vitro and in vivo. These results indicate that iPSCs derived from frozen AMSCs/BMSCs exhibit equally acceptable iPSC characteristics and have potential in clinical applications as an alternative source of autogenous stem cells. Copyright © 2011 John Wiley & Sons, Ltd.


1. Introduction

  1. Top of page
  2. Abstract
  3. 1. Introduction
  4. 2. Materials and methods
  5. 3. Results
  6. 4. Discussion
  7. Acknowledgements
  8. References

Mesenchymal stem cells (MSCs) are somatic stem cells found in various tissues, such as bone marrow, adipose tissue, tooth germ, synovial membranes and umbilical cord blood (Kern et al., 2006), and are known to differentiate into hepatocytes, neurocytes, cardiomyocytes, osteocytes, chondrocytes and adipocytes (Salem et al., 2009). Due to their wide differentiation potential, they are currently used in regenerative medicine (Salem et al., 2009). Since 2001, we have utilized BMSCs for bone or cartilage regeneration in orthopaedic patients (Morishita et al., 2006; Ohgushi et al., 1999, 2005). MSCs are also found in adipose tissue, which is readily obtained by liposuction (Fraser et al., 2006; Hayashi et al., 2008), and the AMSCs have recently been used for various regenerative medical treatments (Garcia-Olmo et al., 2003, 2005; Gimble et al., 2003, 2007; Lendeckel et al., 2004; Yoshimura et al., 2008). It has been reported that both BMSCs and AMSCs show similar cell surface antigen patterns, although the cells have some characteristic differences. In particular, BMSCs exhibit a more extensive bone-forming potential than AMSCs (Hayashi et al., 2008). Therefore, BMSCs may be appropriate stem cells for bone tissue regeneration, whereas AMSCs may be used for treatments that do not require bone formation, such as heart repair. Concerning the clinical application of MSCs, their proliferation and differentiation potentials are limited and drastically decrease after several passages, resulting in a restriction of their application in regenerative medicine.

Alternatively, embryonic stem cells (ESCs) have unlimited proliferation and differentiation potential. However, disruption of an embryo is required to establish ESCs and thus their uses in medical applications elicit ethical concerns. Furthermore, because ESCs cannot be established from adult cells, it is impossible to make patient-derived ESCs to be used as autogenous grafts, which avoid transplantation rejection. In this regard, induced pluripotent stem cells (iPSCs) with unlimited proliferation and differentiation potential equivalent to ESCs have recently been established (Takahashi et al., 2006, 2007; Yu et al., 2007). Because iPSCs can be generated from somatic cells even after their terminal differentiation, iPSCs have been attracting attention as a new type of possible patient-derived autogenous stem cells for regenerative medicine. Many sources of adult cells in various tissues have been used for the generation of iPSCs, including skin fibroblasts, keratinocytes, blood cells (Patel et al., 2010) and MSCs. Because harvesting, depository and transport methods of the MSCs have been established, usage of the cells is feasible for clinical applications. Notably, MSCs can be frozen/stocked for a long period with high viability (Kotobuki et al., 2005). Due to the well-established characteristic features of MSCs, they are targeted as an ideal cell source for iPSC generation. In fact, we have previously reported the generation of iPSCs from frozen AMSCs (Aoki et al., 2010). However, there are no comparative studies of the efficiency and biological activities of the iPSCs that are derived from BMSCs vs. from AMSCs. In this study, we established several lines of iPSCs from frozen stocks of BMSCs and AMSCs, and compared the efficiency of the iPSC generation, as well as differentiation potentials both in vitro and in vivo.

2. Materials and methods

  1. Top of page
  2. Abstract
  3. 1. Introduction
  4. 2. Materials and methods
  5. 3. Results
  6. 4. Discussion
  7. Acknowledgements
  8. References

2.1. FACs analysis

Cell surface antigens of BMSCs and AMSCs were analysed by flow cytometric analysis (FACS Calibur, BD Biosciences, Le Pont de Claix, France). Mouse anti-human monoclonal antibodies of FITC-conjugated CD13, CD14 CD44, CD45 (BioCarta, CA, USA), CD29, CD56, CD90, CD105 (AbD Serotec, NC, USA), CD31, CD34, HLA-I (Invitrogen), PE-conjugated CD73 (BD Bioscience) and CD133 (Miltenyi Biotec, Gladbach, Germany) were used. FITC- and PE-conjugated mouse IgG (Beckman Coulter, CA, USA) were used as negative controls.

2.2. In vitro osteogenic differentiation of BMSCs and AMSCs

MSCs were seeded at a density of 5 × 103 cells/cm2 in a 12-well culture plate in minimum essential medium-α (α-MEM; Invitrogen) containing 15% fetal bovine serum (FBS; JRH Biosciences, KS, USA) and cultured overnight. Next day, the medium was changed to osteogenic differentiation medium, which was supplemented with 10 mM β-glycerophosphate (Merck KGaA, Darmstadt, Germany), 0.07 mML-ascorbic acid 2-phosphate magnesium salt n-hydrate (Wako) and 100 nM dexamethasone (Sigma). The medium was changed three times a week. As a control, the MSCs were also cultured in the medium without the ascorbic acid and dexamethasone.

After the osteogenic differentiation, the cells were used for assay for alkaline phosphatase (ALP) activity and ALP staining. For the ALP assay, the cells were washed with phosphate-buffered saline (PBS) and collected into a tube containing 500 µl TE buffer (pH 7.4, 1 mM EDTA and 100 mM NaCl). The cells in TE buffer were sonicated and 20 µl of the cell suspension was used to quantify DNA content, using Hoechst 33 258. Salmon sperm DNA (Life Technologies) was used as DNA standard. The sonicated cell suspension was centrifuged at 13 000 × g for 5 min at 4 °C, and 20 µl supernatant was used for ALP activity assay. p-Nitrophenylphosphate (pNPP; Zymed Laboratories, CA, USA) was used as the substrate, and the p-nitrophenol released during incubation for 30 min at 37 °C was measured. The ALP activity was normalized to DNA content (µmol/µg). ALP staining was done using an ALP Kit (Sigma) according to the manufacturer's instructions.

2.3. In vitro adipogenic differentiation of BMSCs and AMSCs

MSCs were seeded at a density of 2 × 104 cells/cm2 in a 12-well culture plate in α-MEM containing 15% FBS. The adipogenic differentiation was performed using the hMSC Differentiation Bullet Kit®, Adipogenid (PT-3004, Takara) according to the manufacturer's instructions. After adipogenic differentiation, the cells were fixed with 10% formaldehyde for 10 min at room temperature. The fixed cells were washed with 60% isopropanol and stained with oil red O solution for 15 min. The stained cells were washed with 60% isopropanol and PBS. As a control, the MSCs were also cultured in the medium without dexamethasone, indomethacin and 3-isobutyl-1-methylxanthine.

2.4. Plasmid construction

An open reading frame (ORF) cassette A (Invitrogen, Carlsbad, CA, USA) was introduced into the EcoRI site of the pMXs retroviral vector (Takahashi et al., 2006). The ORFs of human OCT3/4 (POU5f1 isoform-1), SOX2, KLF4 and c-MYC were amplified by RT–PCR and cloned into pENTR-D/TOPO (Invitrogen). All genes were transferred to the pMXs retroviral vector (kindly donated by Dr Kitamura), using Gateway Technology (Invitrogen) according to the manufacturer's instructions.

2.5. Cell culture

This study was approved by the ethics committee of the National Institute of Advanced Industrial Science and Technology. Culture expansion of BMSCs (0801TS33M A1/BMSC No. 1, P-2c AMS0422-PF57/BMSC No. 2 and 0702TS37M A2/BMSC No. 3) were carried out from frozen stocked BMSCs after informed consent of the donors had been obtained. Human AMSC lines (AMSC No. 1 and AMSC No. 3) were purchased from Invitrogen (lot numbers 1212 and 1199), and one line (AMSC No. 2) was from Lonza Biosciences (Gaithersburg, MD, USA; lot number 7F3890). The frozen BMSCs and AMSCs were thawed and used for the generation of iPSCs. Platinum-A (Plat-A) cells were purchased from Cell Biolabs (San Diego, CA, USA) (Takahashi et al., 2007). SNL76/7 feeder cells were purchased from the European Collection of Cell Cultures (Salisbury, UK). BMSCs and AMSCs were maintained in α-MEM containing 15% FBS, 100 U/ml penicillin and 100 µg/ml streptomycin (Invitrogen). Plat-A and SNL feeder cells were maintained in Dulbecco's modified Eagle's medium (DMEM; Invitrogen) containing 10% FBS, 100 U/ml penicillin and 100 µg/ml streptomycin. The iPSCs were generated and maintained in human ESC medium (D-MEM/F-12 with GlutaMAX-I; Invitrogen), supplemented with 20% knockout serum replacement (KSR; Invitrogen), 0.1 mM non-essential amino acids (Invitrogen), 0.1 mM 2-mercaptoethanol (Invitrogen), 100 U/ml penicillin, 100 µg/ml streptomycin and 5 ng/ml recombinant human basic fibroblast growth factor (bFGF; Wako, Osaka, Japan). MSCs, Plat-A and SNL76/7 feeder cells were passaged using 0.05% trypsin/0.53 mM EDTA (Invitrogen). The iPSCs were passaged using dissociation solution [0.25% trypsin (Invitrogen), 0.1 mg/ml collagenase type IV (Invitrogen), 10 mM CaCl2 (Wako) and 20% KSR in distilled water]. The parental cells of these MSCs were free from bacterial, fungal and mycoplasma contamination because primary cultures of BMSCs were done in the clean room at our cell-processing centre and AMSC lines were obtained from the companies with certification. We also performed microbiological tests several times during the culture; furthermore, we have a system to avoid cross-contamination during iPSCs generation, evidenced by short tandem repeat (STR) profile analysis of genomic DNA (Aoki et al., 2010).

2.6. Retroviral production

Plat-A packaging cells were seeded at 8 × 106 cells/ 100 mm dish and cultured overnight. The next day, pMXs retroviral vectors containing the ORFs of human OCT3/4, SOX2, KLF4 and c-MYC were transfected into Plat-A cells using the FuGENE HD Transfection Reagent (Roche Diagnostics, Basel, Switzerland). Viral supernatants were collected 48 and 72 h post-transfection, then filtered through a 0.45 µm pore-size filter and supplemented with 4 mg/ml Polybrene (Sigma, St. Louis, MO, USA). The MSCs were transduced with a OCT3/4:SOX2:KLF4:c-MYC = 1:1:1:1 mixture of viral supernatant.

2.7. Generation of iPSCs

BMSCs and AMSCs were seeded at 5 × 104 cells/100 mm dish and cultured overnight. At this time, the passage numbers of BMSC nos 1, 2 and 3 and AMSC nos 1, 2 and 3 were P5, P7, P7, P6, P8 and P7, respectively. After the overnight culture, the culture medium was changed to viral supernatant and cultured for 24 h, then the viral supernatant was changed to fresh viral supernatant and cultured for an additional 24 h. The viral supernatant was changed to α-MEM containing 15% FBS with a daily medium change. After 3 days, the viral infected cells were seeded on SNL feeder cells at 5 × 103–5 × 105 cells/100 mm dish. The next day, the medium was changed to human ESC medium containing valproic acid (VPA; Wako). The medium was changed every other day for 2 weeks, then cultured without VPA. From 7 to 24 days post-infection, colonies were selected based on human ESC-like colony morphology. The selected colonies were subsequently expanded and maintained on SNL feeder cells in human ESC medium. Cells were always cultured in a humidified atmosphere of 95% air with 5% CO2 at 37 °C. Reprogramming efficiency was determined as the number of total human ESC-like colonies per total number of infected cells.

2.8. RNA isolation and reverse transcription

Total RNA was isolated using an RNeasy Mini Kit (Qiagen, Hilden, Germany) and treated with a TURBO DNA-free kit (Applied Biosystems, Foster City, CA, USA), according to the manufacturer's instructions. Total RNA (1 µg) was used for cDNA synthesis, using a ReverTra Ace-α kit (Toyobo, Osaka, Japan) and oligo(dT) 20 primers. PCR was performed using an ExTaq HS kit (Takara Bio, Shiga, Japan). Primer sequences are shown in Table 3.

2.9. Alkaline phosphatase (ALP) staining and immunofluorescence microscopy

ALP staining was performed using a Leukocyte ALP Kit (Sigma) according to the manufacturer's instructions. For immunofluorescent microscopy, cells were fixed with PBS containing 4% paraformaldehyde for 10 min at room temperature. After washing with PBS, the cells were treated with PBS containing 0.1% Triton X-100 for 10 min and then 1% bovine serum albumin (BSA, A2153, Sigma) for 10 min at room temperature. The cells were incubated with a primary antibody overnight at 4 °C, washed and incubated with a secondary antibody for 30 min. The primary antibodies used were SSEA-3 (1:200, MAB4303; Millipore, Billerica, MA, USA), SSEA-4 (1:200, MAB4304; Millipore), TRA-1-60 (1:200, ab16288-200; Abcam, Cambridge, UK), TRA-1-81 (1:200, ab16289-200; Abcam), OCT4 (1:200, ab19857-100; Abcam), NANOG (1:50, ab21624; Abcam), SOX17 (1:200, AF1924; RD̈ Systems, Minneapolis, MN, USA), α-smooth muscle actin (pre-diluted, N1584; Dako, Glostrup, Denmark) and βIII-tubulin (1:200, CBL412; Millipore). Secondary antibodies used were from the Invitrogen AlexaFluor series (1:300). Nuclei were detected with 0.2 µg/ml Hoechst 33 342 (Molecular Probes, Eugene, OR, USA).

2.10. In vitro differentiation

For embryoid body (EB) formation, human ESC-like colonies were harvested by treatment with dissociation solution and transferred to a low attachment culture dish (Prime Surface; Sumitomo Bakelite, Tokyo, Japan) in human ESC medium without recombinant bFGF. The medium was changed every other day. After 9–12 days of floating culture, EBs were found and transferred onto gelatin-coated plates for an additional 10 days of culture in the same medium.

2.11. Teratoma formation

Clumps of ESC-like colonies from one 100 mm dish were suspended in 60 µl human ESC medium without human recombinant bFGF. The cell clump suspension (25 µl) was injected into each testis of a severe combined immunodeficient (SCID) mouse. Tumours were collected 8–12 weeks after injection and fixed with 10% paraformaldehyde. The paraffin-embedded tumours were sectioned and stained with haematoxylin and eosin (HË).

2.12. Karyotype analysis

Chromosomal G-band analyses and multicolour Fluorescence in situ hybridization (FISH) were performed at the Nihon Gene Research Laboratories (Sendai, Japan). At this time, the passage numbers of BMSC nos 1 and 2 and AMSC nos1, 2 and 3 were P7, P12, P11, P9 and P9, respectively.

3. Results

  1. Top of page
  2. Abstract
  3. 1. Introduction
  4. 2. Materials and methods
  5. 3. Results
  6. 4. Discussion
  7. Acknowledgements
  8. References

3.1. FACs analysis of MSCs

Three lines of BMSCs and AMSC no. 2 were analysed by flow cytometry (Table 1). These numbers in Table 2 represent the percentages of marker-positive cells. All cell lines were positive for well-known mesencymal markers, such as CD13, CD29, CD44, CD73, CD90, CD105 and HLA-I. Meanwhile, they were negative for CD14, CD31, CD34, CD45, CD56 and CD133. These data indicate that these MSC lines were mesenchymal-type cells.

Table 1. Analyses of cell surface antigens on BMSCs and AMSCsThumbnail image of
Table 2. Efficiency of iPSC generation from BMSCs and AMSCs
Parental cellsPassage No.Number of colonyReprogramming efficiency
  1. No statistically significant differences between BMSCs and AMSCs by Mann–Whitney U-test and χ2 test, probably due to small sample size.

BMSC No.1 (0801TS33MA1)P580.0008
BMSC No.2 (P-2cAMS0422-PF57)P710.0002
BMSC No.3 (0702TS37MA2)P700
AMSC No.1 (Invitrogen #1212)P6880.0293
AMSC No.2 (Lonza #7F3890)P8310.0022
AMSC No.3 (Invitrogen #1199)P750.0005
Table 3. PCR primers
PrimerSequence (5′ to 3′)ApplicationsTm
hOCT4–S842CTGCAGCAGATCAGCCACATCGCCCAGCAGOCT3/4 endo and transgene RT–PCR73
hOCT4–AS1283CTTCCCTCCAACCAGTTGCCCCAAACEndo OCT3/4 RT–PCR65
hSOX2–S1430GGGAAATGGGAGGGGTGCAAAAGAGG 65
  Endo SOX2 RT–PCR 
hSOX2–AS1555TTGCGTGAGTGTGGATGGGATTGGTG 63
hSOX2–S1004CAGATGCAGCCCATGCACCGCTACGACGTGSOX2 transgene RT–PCR73
hKLF4–S1457ACGATCGTGGCCCCGGAAAAGGACCKLF4 endo and transgene RT–PCR67
hKLF4–AS1826TGATTGTAGTGCTTTCTGGCTGGGCTCCEndo KLF4 RT–PCR65
pMXs–AS3201TAAAATCTTTTATTTTATCGTCGACCACTGTransgene RT–PCR53
hMYC–S253GCGTCCTGGGAAGGGAGATCCGGAGC 71
  c–MYC transgene RT–PCR 
hMYC–AS555TTGAGGGGCATCGTCGCGGGAGGCTG 71
hMYC–S1580CAACAACCGAAAATGCACCAGCCCCAGc–MYC transgene RT–PCR65
hNANOG–S968CAGCCCCGATTCTTCCACCAGTCCC 67
  NANOG RT–PCR 
hNANOG–AS1334CGGAAGATTCCCAGTCGGGTTCACC 65
hREX1–SCAGATCCTAAACAGCTCGCAGAAT 57
  RET1 RT–PCR 
hREX1–ASGCGTACGCAAATTAAAGTCCAGA 55
hUTF1–S832CCGTCGCTGAACACCGCCCTGCTG 69
  UTF1 RT–PCR 
hUTF1–AS979CGCGCTGCCCAGAATGAAGCCCAC 67
hGDF3–S243CTTATGCTACGTAAAGGAGCTGGG 59
  GDF3 RT–PCR 
hGDF3–AS850GTGCCAACCCAGGTCCCGGAAGTT 65
hDPPA2–S85CCGTCCCCGCAATCTCCTTCCATC 65
  DPPA2 RT–PCR 
hDPPA2–AS667ATGATGCCAACATGGCTCCCGGTG 63
hDPPA4–S532GGAGCCGCCTGCCCTGGAAAATTC 65
  DPPA4 RT–PCR 
hDPPA4–AS916TTTTTCCTGATATTCTATTCCCAT 49
hDPPA5–S40ATATCCCGCCGTGGGTGAAAGTTC 61
  DPPA5 RT–PCR 
hDPPA5–AS259ACTCAGCCATGGACTGGAGCATCC 63
hAFP–S948GAATGCTGCAAACTGACCACGCTGGAAC 65
  AFP RT–PCR 
hAFP–AS1201TGGCATTCAAGAGGGTTTTCAGTCTGGA 61
hSOX17–S423CGCTTTCATGGTGTGGGCTAAGGACG 65
  SOX17 RT–PCR 
hSOX17–AS583TAGTTGGGGTGGTCCTGCATGTGCTG 65
hFOXA2–S208TGGGAGCGGTGAAGATGGAAGGGCAC 67
  FOXA2 RT–PCR 
hFOXA2–AS398TCATGCCAGCGCCCACGTACGACGAC 69
hBRACHYURY–S1292GCCCTCTCCCTCCCCTCCACGCACAG 73
  BRACHYURY RT–PCR 
hBRACHYURY–AS1540CGGCGCCGTTGCTCACAGACCACAGG 71
hTNTC–S524ATGAGCGGGAGAAGGAGCGGCAGAAC 67
  TNTC RT–PCR 
hTNTC–AS730TCAATGGCCAGCACCTTCCTCCTCTC 65
hMAP2–S5401CAGGTGGCGGACGTGTGAAAATTGAGAGTG 67
  MAP2 RT–PCR 
hMAP2–AS5587CACGCTGGATCTGCCTGGGGACTGTG 69
hPAX6–S1206ACCCATTATCCAGATGTGTTTGCCCGAG 63
  PAX6 RT–PCR 
hPAX6–AS1497ATGGTGAAGCTGGGCATAGGCGGCAG 67
human beta–actin FAGAAAATCTGGCACCACAC 53
  β–ACTIN RT–PCR 
human beta–actin RCTCCTTAATGTCACGCACG 55

3.2 Differentiation analysis of MSCs

We examined the differentiation potentials of these MSCs from BMSCs and AMSCs. When three lines of BMSCs and AMSC no. 1 were cultured with osteogenic differentiation medium, all MSCs showed strong ALP staining and high ALP activity (upper left and right panels in Figure 1). Likewise, when cultured with adipogenic differentiation medium, these MSCs showed positive staining for oil red O (lower left panels in Figure 1). These data showed that all MSCs used for iPSCs generation had at least osteogenic and adipogenic differentiation potentials.

thumbnail image

Figure 1. Osteogenic and adipogenic differentiation potential of BMSCs and AMSCs. MSCs were cultured with (induction+) or without (induction) differentiation medium. ALP as a marker of osteogenic differentiation and oil red stain as a maker of adipogenic differentiation are seen in figures at left. Scale bars = 200 µm. ALP activity measurements are seen in figure at right

Download figure to PowerPoint

3.3. Generation of iPSCs from BMSCs and AMSCs

After approximately 22 days from the viral infection, we found several colonies displaying human ESC-like morphologies. The ratio of the number of colony formations (i.e. the reprogramming efficiency) in the BMSCs (nos 1, 2 and 3) and AMSCs (nos 1, 2 and 3) were 0.0008%, 0.0002%, 0%, 0.0293%, 0.0022% and 0.0005%, respectively (Table 2). Some of the human ESC-like colonies were selected, expanded for several passages (Figure 2Ab) and then stained for ALP activity. Almost all the colonies showed high ALP activity (Figure 2Ab). The data in the following sections were obtained from the putative ESC-like colonies derived from the corresponding culture-expanded MSCs. For example, the colonies named BMSC1 and AMSC3 were derived from BMSC no. 1 and AMSC no. 3, respectively.

3.4. Characterization of iPSCs from BMSCs and AMSCs

To confirm that the colonies derived from the BMSCs and AMSCs contained authentic iPSCs, we evaluated human ESC marker expressions, using immunofluorescent microscopy and RT–PCR. Immunofluorescent microscopy showed that the colonies expressed the following human ESC-specific surface antigens: stage-specific embryonic antigen (SSEA)-3; SSEA-4; tumour-related antigen (TRA)-1-60; and TRA-1-81. The cells also showed the ESC-specific transcription factors, OCT3/4 and NANOG (Figure 2B).

thumbnail image

Figure 2. Morphology of the parental cells of BMSCs (BMSC nos 1 and 2) and AMSCs (AMSC nos 1–3) and ESC-like colonies (BMSC nos 1 and 2 and AMSC nos 1–3) from the corresponding parental cells. (A) (a) Typical microscopic view of parental cells at low density (upper) and high density (lower); (b) ESC-like colonies before (upper) and after (lower) ALP staining. Scale bar = 200 µm. (B) Immunofluorescent microscopy of ESC-like colonies for SSEA-3, SSEA-4, TRA-1-60, TRA-1-81, OCT3/4 and NANOG. Nuclei were stained with Hoechst 33342. Scale bar = 200 µm

Download figure to PowerPoint

RT–PCR analysis showed that the colonies expressed human ESC marker genes OCT3/4, SOX2, NANOG, reduced expression 1 (REX1), undifferentiated embryonic cell transcription factor 1 (UTF1), growth and differentiation factor 3 (GDF3), developmental pluripotency associated 2 (DPPA2), DPPA4, DPPA5 and telomerase reverse transcriptase (TERT). The retroviral transgenes (Tg) of Tg-OCT3/4, Tg-SOX2 and Tg-MYC were not expressed, and a trace of Tg-KLF4 was detected in the colonies (Figure 3).

thumbnail image

Figure 3. RT–PCR analysis of expressions of ESC marker genes, endogenous KLF4 and c-MYC, and retroviral transgenes (Tg). P, parental cells

Download figure to PowerPoint

3.5. EB formation and in vitro differentiation

To examine differentiation potential, we induced EB formation. After 9–12 days of floating culture of the dissociated cells from ESC-like colonies, the cells formed spherical structures (EBs; Figure 4A). The EBs were transferred onto gelatin-coated plates and cultured for an additional 9–12 days. Immunofluorescence microscopy showed that the cells were βIII-tubulin- (a marker of ectoderm), α-smooth muscle actin- (α-SMA, mesoderm), Vimentin- (mesoderm and parietal endoderm) and SOX17 (endoderm)-positive (Figure 4A). RT–PCR analysis confirmed that the cells expressed MAP2, PAX6 (endoderm), TNTC, BRACHURY, FOXA2 (mesoderm), SOX17 and AFP (endoderm) (Figure 4B). These data imply that the ESC-like colonies had the potential to differentiate into various cells of the three germ layers in vitro.

thumbnail image

Figure 4. In vitro differentiation of ESC-like colonies from BMSCs and AMSCs. (A) EB formation. Immunofluorescent microscopy showing βIII-tubulin (green), α-SMA (green) and SOX17 (red). Nuclei were stained with Hoechst 33342. Scale bars = 200 µm. (B) RT–PCR analysis of expressions of differentiation marker genes: MAP2, PAX6 (ectoderm), TNTC, BRACHURY, FOXA2 (mesoderm), SOX17 and AFP (endoderm). P, parental cells; U, undifferentiated cells; and D, differentiated cells via EB

Download figure to PowerPoint

3.6. Teratoma formation

To identify in vivo pluripotency, we injected the colonies from the AMSCs and BMSCs into the testes of SCID mice. We used three or four mice for each MSC cell line. More than half of the testes showed tumour formations 8–12 weeks after injection. Histological examination of the tumours revealed tissues representative of the three germ layers: gut-like epithelium (endoderm), cartilage (mesoderm) and neuroepithelial rosettes (ectoderm) (Figure 5). These findings indicate that the tumours were teratoma formations. Thus, the colonies from the BMSCs and AMSCs had the potential to differentiate into the three germ layers in vivo.

thumbnail image

Figure 5. Teratoma formations of ESC-like colonies from BMSCs and AMSCs after their injection into mice testes. HË staining showed neuroepithelial rosettes (ectoderm), cartilage (mesoderm) and gut-like epithelium (endoderm)

Download figure to PowerPoint

Collectively, the in vitro and in vivo data confirmed that the ESC-like colonies obtained after retroviral transduction of OCT3/4, SOX2, KLF4 and c-MYC into either AMSCs or BMSCs were indeed authentic iPSCs.

3.7. Karyotype analysis

We performed karyotype investigations by chromosomal G-band analysis (Figure 6) and multicolour FISH analysis (data not shown). Four lines of iPSCs of BMSC1, AMSC1, AMSC2 and AMSC3 showed normal karyotypes. BMSC2 showed chromosome 3 trisomy in only one cell out of 20 cells investigated.

thumbnail image

Figure 6. Karyotype (G-band) analyses of ESC-like colonies from BMSCs and AMSCs. BMSC1, AMSC1, AMSC2 and AMSC3 showed normal karyotypes. BMSC2 showed a partially abnormal karyotype

Download figure to PowerPoint

4. Discussion

  1. Top of page
  2. Abstract
  3. 1. Introduction
  4. 2. Materials and methods
  5. 3. Results
  6. 4. Discussion
  7. Acknowledgements
  8. References

In the first report of mouse iPSC generation, the authors generated iPSCs using four transcription factors (OCT3/4, SOX2, KLF4 and c-MYC) (Takahashi et al., 2006). In 2007, they also generated human iPSCs using the same set of four factors (Takahashi et al., 2007). Simultaneously, other investigators generated human iPSCs using another set of four factors (OCT3/4, SOX2, NANOG and LIN28) (Yu et al., 2007). Since then, iPSC generation using three transcription factors (OCT3/4, SOX2 and KLF4) without c-MYC (an oncogene) has been reported (Nakagawa et al., 2008; Wernig et al., 2008). Utilization of neural stem cells (NSCs) as a cell source resulted in successful iPSC generation using two transcription factors (OCT3/4 and KLF4 or OCT3/4 and c-MYC) (Kim et al., 2008). Furthermore, the same group also reported the generation of mouse, as well as human, iPSCs from MSCs using only one factor, OCT3/4 (Kim et al., 2009b, 2009c). Based on these reports, it is possible to decrease the number of transcription factors for iPSC generation by the selection of the parental cell source. In particular, cells having characteristic features of ‘stemness’ might be valuable for iPSC generation.

Various tissues in the human body contain MSCs. Although their proliferation/differentiation potentials are much less than those of ESCs and iPSCs, MSCs are adult cells and thus useful for clinical applications in regenerative medicine. As such, we have used BMSCs for bone/cartilage regeneration. We speculate that the proliferation/differentiation limitations of MSCs may be overcome by generation of iPSCs from MSCs. In our preliminary experiments, we transduced three transcription factors (OCT3/4, SOX2 and KLF4) without c-MYC into human BMSCs; however it was extremely difficult to detect the iPSC-like colonies. Because MSCs also reside in adipose tissue, we then successfully generated iPSCs from AMSCs, using the same three factors (Aoki et al., 2010). If BMSC-derived iPSCs have genuine iPSC properties, they could be useful for clinical applications despite their low efficiency of iPSC generation, because the iPSCs will have an infinite proliferative potential. In this study, we tried to generate iPSCs from both AMSCs and BMSCs using four transcription factors (OCT3/4, SOX2, KLF4 and c-MYC), and we examined cellular biological characteristics by comparative analyses.

We determined the efficiency of iPSC generation from AMSCs and BMSCs using four factors. We found that the total number of ESC-like colonies in the AMSCs was more than that in the BMSCs, indicating a higher tendency of iPSC generation potential in AMSCs than in BMSCs (Table 2). We recently reported upregulation of some genes regarding DNA repair/histone conformational change in the high iPSC generation cells of mesenchymal types (Oda et al., 2010). Difference of the gene expression profiles between AMSCS and BMSCs might be seen, although further extensive studies are needed to confirm this assumption. We also examined whether the obtained ESC-like colonies had sufficient pluripotent properties. Cells in the colonies from both BMSCs and AMSCs exhibited a human ESC-like morphology (Figure 2Ab), and the colonies exhibited high ALP activity (Figure 2Ab) as well as expressions of undifferentiated markers (Figures 2B, 3). Concerning the differentiation potentials of the ESC-like colonies, we made EBs from the colonies and demonstrated that the cells in the EBs differentiated well into three germ layer-derived cells. The in vitro differentiation potentials were also confirmed by in vivo transplantation of the ESC-like colonies into mouse testes. Histological findings of the transplants showed gut-like epithelium (endoderm), cartilage (mesoderm) and neuroepithelial rosettes (ectoderm) (Figure 5). The in vitro, as well as in vivo, differentiation potentials were well demonstrated using parental cells of both BMSCs and AMSCs. Collectively, these results indicate that the ESC-like colonies derived from both BMSCs and AMSCs were iPSCs, although there was a difference in the efficiency of iPSC generation.

The low generation efficiency of BMSCs may be improved by using other factors in the process of iPSC generation. It has been reported that small molecule compounds, such as histone deacetylase inhibitor (Huangfu et al., 2008), GSK3 inhibitor (Li et al., 2009), TGFβ signalling inhibitor (Lin et al., 2009) and butyric acid (Mali et al., 2010) enhance iPSC generation. We used c-MYC for iPSC generation, particularly for iPSC generation from BMSCs. c-MYC is a known oncogene, and Okita et al. (2007) reported that iPSCs can give rise to cancer by re-expression of the c-MYC transgene. This problem, which is crucial for clinical application, might be solved by using the Sendai virus method without insertion of transgenes into the genome (Fusaki et al., 2009) or a protein transduction method without gene transfection (Kim et al., 2009a; Zhou et al., 2009).

One of the significant findings of this study was that we could generate iPSCs from frozen/stocked MSCs. According to our experience, MSCs can be stocked for several years, even at − 80 °C, with high cell viability (Kotobuki et al., 2005). In the future, we will provide regenerative medicine using patients' MSCs and at the same time we will stock some of the MSCs. If the MSC therapy is not effective by their proliferation/differentiation limitations, it will be possible to use iPSCs generated from the stocked MSCs. For clinical applications of iPSCs, we should consider possible complications, such as tumourigenicity of iPSCs, because iPSC transplantation can cause teratoma formation. Miura et al. (2009) reported that iPSC-derived secondary neurosphere transplantation to the striatum of a NOD/SCID mouse caused tumour formations. Interestingly, the frequency of the teratoma formation was related to the number of undifferentiated cells that resided in their preparation. Consequently, if undifferentiated cells can be removed, the tumourigenicity might be prevented. Indeed, there are methods to remove undifferentiated cells, and therefore clinical application of human iPSCs derived from MSCs might be possible in the future. The application could be done using differentiated cells of interest derived from the iPSCs and some have already reported differentiation methods towards neural cells (Vierbuchen et al., 2010) and beating cardiomyocites (Ieda et al., 2010). Interestingly, these differentiations from adult cells without iPS generation can be done. Vierbuchen et al. (2010) converted dermal fibroblasts to functional neurons using three factors (Ascl1, Brn2 and Myt1l) and Ieda et al. (2010) generated beating cardiomyocytes using three factors (Gata4, Mef2c and Tbx5). These direct reprogramming methods might be alternative methods to show functional differentiation from adult cells and circumvent the tumourigeneicity.

In conclusion, BMSCs tended to show a lower efficiency in the generation of iPSCs than AMSCs; however, iPSCs derived from both AMSCs and BMSCs exhibited equal differentiation potentials into cells of three germ layers. Therefore, we believe iPSCs generated from BMSCs or AMSCs can be used as patient-derived autogenous stem cells, although further studies are needed for consideration of clinical applications.

Acknowledgements

  1. Top of page
  2. Abstract
  3. 1. Introduction
  4. 2. Materials and methods
  5. 3. Results
  6. 4. Discussion
  7. Acknowledgements
  8. References

We warmly thank Dr Toshio Kitamura for providing the retroviral system. We also thank our colleagues in the Tissue Engineering Group, Health Research Institute, National Institute of Advanced Industrial Science and Technology (AIST). This work was partly supported by the Project for Realization of Regenerative Medicine from the Ministry of Education, Culture, Sports, Science and Technology of Japan. The study sponsors had no role in the study design, data analysis or data interpretation, or in the writing of the report.

References

  1. Top of page
  2. Abstract
  3. 1. Introduction
  4. 2. Materials and methods
  5. 3. Results
  6. 4. Discussion
  7. Acknowledgements
  8. References