SEARCH

SEARCH BY CITATION

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. PREPARATION AND CHARACTERIZATION OF POLYMER NPs
  5. POLYMER NPs FOR DRUG DELIVERY
  6. POLYMER NPs FOR DRUG LOADING AND DELIVERY
  7. POLYMER NPs FOR SMALL SILENCING RNA DELIVERY IN CANCER THERAPY
  8. POLYMER NPs FOR miRNA DELIVERY
  9. POLYMER NPs FOR ANTISENSE miRNA (ANTAGOMIR) DELIVERY
  10. POLYMER NPs FOR siRNA DELIVERY
  11. POLYMER NPs FOR shRNA DELIVERY
  12. ADVANTAGES OF NPs PREPARED FROM PLGA AND PLGA-PEG POLYMERS COMPARED WITH OTHER POLYMERS
  13. ADVANTAGES AND DISADVANTAGES ASSOCIATED WITH THE USE OF POLYMER NPs FOR DRUG DELIVERY
  14. CONCLUSION
  15. ACKNOWLEDGMENTS
  16. REFERENCES

Advances in nanotechnology have provided powerful and efficient tools in the development of cancer diagnosis and therapy. There are numerous nanocarriers that are currently approved for clinical use in cancer therapy. In recent years, biodegradable polymer nanoparticles have attracted a considerable attention for their ability to function as a possible carrier for target-specific delivery of various drugs, genes, proteins, peptides, vaccines, and other biomolecules in humans without much toxicity. This review will specifically focus on the recent advances in polymer-based nanocarriers for various drugs and small silencing RNA's loading and delivery to treat different types of cancer. WIREs Nanomed Nanobiotechnol 2014, 6:40–60. doi: 10.1002/wnan.1242

Conflict of interest: The authors declare no conflicts of interest.

For further resources related to this article, please visit the WIREs website.


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. PREPARATION AND CHARACTERIZATION OF POLYMER NPs
  5. POLYMER NPs FOR DRUG DELIVERY
  6. POLYMER NPs FOR DRUG LOADING AND DELIVERY
  7. POLYMER NPs FOR SMALL SILENCING RNA DELIVERY IN CANCER THERAPY
  8. POLYMER NPs FOR miRNA DELIVERY
  9. POLYMER NPs FOR ANTISENSE miRNA (ANTAGOMIR) DELIVERY
  10. POLYMER NPs FOR siRNA DELIVERY
  11. POLYMER NPs FOR shRNA DELIVERY
  12. ADVANTAGES OF NPs PREPARED FROM PLGA AND PLGA-PEG POLYMERS COMPARED WITH OTHER POLYMERS
  13. ADVANTAGES AND DISADVANTAGES ASSOCIATED WITH THE USE OF POLYMER NPs FOR DRUG DELIVERY
  14. CONCLUSION
  15. ACKNOWLEDGMENTS
  16. REFERENCES

Cancer is one of the major worldwide diseases, with 12.4 million new cancer cases and 7.6 million cancer deaths reported in 2008.[1, 2] More than 10 million people are diagnosed with various cancers each year worldwide. Nearly 1.6 million new cancer cases are expected to be diagnosed and about 580,000 cancer deaths projected in the United States in 2013.[3] Lung, liver, stomach, colon, and breast cancers are the leading causes of cancer-related deaths each year.[1, 2] Cancer arises from single cell that is unable to repair mutations produced in DNA while avoiding normal elimination through apoptosis, and experiences abnormal cell growth and division, which later leads to invasion and metastasis. Normal cells can transform into tumor cells owing to various reasons, such as genetic factors, external influences from agents such as physical carcinogens (radiation), chemical carcinogens (asbestos, tobacco smoke, bisphenol A, etc.), and biological carcinogens (infections from viruses, bacteria, and parasites).[3] Cancer treatment requires careful screening and selection of therapies such as radiotherapy, chemotherapy, and surgery. Although radiotherapeutic and chemotherapeutic drugs are capable to shrink the tumor growth for a short period of time, they require multiple schedules of treatments. In addition, chemotherapeutic drugs not only kill the cancerous cells but also the healthy normal cells, presenting a significant toxic side effect to the patients. Hence, it would be a great benefit to develop drug delivery systems that actively or passively target only cancerous cells.[4] Nanobiotechnology could offer an ideal solution for many difficulties associated with current chemotherapy, and could provide as a new platform that may contain controlled, sustained, and targeted release of drugs and genes for cancer therapy.

Nanoparticle (NP) research has become a key area in drug delivery systems for the treatment of cancer and several other metabolic disorders.[5] NPs have the capability to deliver numerous drugs and genes into the various specific parts of the body for a sustained period of time. Over the past few decades, large numbers of NP-based drug delivery systems have been developed.[6, 7] Polymer-based NPs are preferred for drug delivery because of their low toxicity, sustained release, biodegradable, and available sites for various modifications. Most of the polymer-based NPs developed for drug delivery systems were around 100–200 nm mean size, and were prepared from either natural or synthetic polymers. The biodegradable polymer NPs are considered one of the best platforms for targeted and controlled drug delivery systems to treat cancer of different phenotypes. These polymer NPs displayed excellent biocompatibility, prolonged circulation time, and enhanced accumulation in tumors, with fewer side effects.[8] In most of the current studies, various polymer-based NPs have been used mainly as controlled release agents in specific target sites for drug delivery processes.

PREPARATION AND CHARACTERIZATION OF POLYMER NPs

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. PREPARATION AND CHARACTERIZATION OF POLYMER NPs
  5. POLYMER NPs FOR DRUG DELIVERY
  6. POLYMER NPs FOR DRUG LOADING AND DELIVERY
  7. POLYMER NPs FOR SMALL SILENCING RNA DELIVERY IN CANCER THERAPY
  8. POLYMER NPs FOR miRNA DELIVERY
  9. POLYMER NPs FOR ANTISENSE miRNA (ANTAGOMIR) DELIVERY
  10. POLYMER NPs FOR siRNA DELIVERY
  11. POLYMER NPs FOR shRNA DELIVERY
  12. ADVANTAGES OF NPs PREPARED FROM PLGA AND PLGA-PEG POLYMERS COMPARED WITH OTHER POLYMERS
  13. ADVANTAGES AND DISADVANTAGES ASSOCIATED WITH THE USE OF POLYMER NPs FOR DRUG DELIVERY
  14. CONCLUSION
  15. ACKNOWLEDGMENTS
  16. REFERENCES

Several methods for the preparation of polymer NPs were developed based on the drugs to be encapsulated and requirement of its application.[7, 9, 10] Most commonly used methods are emulsion-solvent evaporation or diffusion, double emulsion, nanoprecipitation, salting out, dialysis, and supercritical fluid techniques.[10] Usually, water-in-oil-in water (W/O/W) double emulsion-solvent evaporation method is widely used for encapsulation of hydrophilic drugs, and nanoprecipitation technique is used for encapsulation of hydrophobic drugs in most of polymeric NP preparations.

Physicochemical characteristics of polymer NPs such as size, shape, and zeta potential were characterized by using imaging methods such as dynamic light scattering (DLS) technique, scanning electron microscope, transmission electron microscope (TEM), and atomic force microscopy.[11] DLS measures hydrodynamic size, size distribution, and polydispersity of NPs. Although characterization of NPs using DLS is fast, reliable, repeatable, and precise for monomodal suspensions, small percentage of larger NPs scatter much more even and obscure the contribution from small NPs. TEM is an excellent technique for visualizing the NPs and provides information about its size, shape, and size distribution, but sample preparation is quite challenging and time consuming and provides poor statistical representation of NP sample. Zeta potential is a physical property demonstrated by any particle in suspension. It shows the overall charge of a particle acquired in a particular medium.[12]

POLYMER NPs FOR DRUG DELIVERY

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. PREPARATION AND CHARACTERIZATION OF POLYMER NPs
  5. POLYMER NPs FOR DRUG DELIVERY
  6. POLYMER NPs FOR DRUG LOADING AND DELIVERY
  7. POLYMER NPs FOR SMALL SILENCING RNA DELIVERY IN CANCER THERAPY
  8. POLYMER NPs FOR miRNA DELIVERY
  9. POLYMER NPs FOR ANTISENSE miRNA (ANTAGOMIR) DELIVERY
  10. POLYMER NPs FOR siRNA DELIVERY
  11. POLYMER NPs FOR shRNA DELIVERY
  12. ADVANTAGES OF NPs PREPARED FROM PLGA AND PLGA-PEG POLYMERS COMPARED WITH OTHER POLYMERS
  13. ADVANTAGES AND DISADVANTAGES ASSOCIATED WITH THE USE OF POLYMER NPs FOR DRUG DELIVERY
  14. CONCLUSION
  15. ACKNOWLEDGMENTS
  16. REFERENCES

Biodegradable polymer NPs for controlled drug delivery have already shown important improvements in cancer therapy.[13] These polymer NP-based delivery systems have been shown capable of delivering wide range of drugs for a sustained period of time in the target sites in a slow-release manner to provide enhanced antitumor efficacy with reduced systemic side effects (Figure 1). Moreover, these nanocarriers can protect drugs from their rapid metabolism while in the systemic circulation, and clearance by liver, kidney, and reticuloendothelial system, which further enhances drugs' stability and target specificity.[14, 15] Several polymer-based NPs such as poly(lactic-co-glycolic acid) or poly(lactide-co-glycolide) (PLGA), polylactic acid or polylactide (PLA), polyglycolic acid or polyglycolide, polycaprolactone (PCL), poly(d,l-lactide) (PDLLA), chitosan, and PLGA-polyethylene glycol (PEG) have been developed for the drug delivery and are in various stages of clinical trials, with a few of them having been approved by FDA for clinical use (Table 1).

image

Figure 1. Schematic illustration of polymer nanoparticles (NPs) formulation for efficient drug delivery for cancer therapy in mouse tumor model.

Download figure to PowerPoint

Table 1. Polymer Nanoparticles Developed for the Delivery of Drugs to Treat Various Cancers
Polymer NanoparticlesNanoparticles Preparation MethodDrugTargeting LigandCellular TargetCancer/Cell LinesIn Vitro/In VivoReferences
  1. PLGA, poly(lactide-co-glycolide); PEG, polyethylene glycol; PLA, polylactide; mPEG, methoxy polyethylene glycol; CMC, carboxymethyl cellulose; HA, hyaluronic acid; PBLG, poly(γ-benzyl-l-glutamate; HCL, hydroxyl-ε-caprolactone; CL, ε-caprolactone; HSA, human serum albumin; PLC, poly(d,l-lactide-co-caprolactone); PDLLA, poly(d,l-lactide); PAA, poly(amidoamine); PEO, polyethyleneoxide; PCL, polycaprolactone.

PLGASimple emulsion and nanoprecipitationPaclitaxelHuman cervical carcinoma cells (HeLa)In vitro and in vivo[16]
PLGA-b-PEGNanoprecipitationDocetaxelA10 aptamerProstate-specific membrane antigen (PSMA)Prostate cancer (LNCaP) cellsIn vivo in nude mice[17]
PLGA-b-PEGNanoprecipitation14C-PaclitaxelA10 aptamerPSMAProstate cancer/LNCaP cellsIn vitro and in vivo in mice[17]
PLGA-b-PEGNanoprecipitationDocetaxelA10 2′-Fluoropyridine RNA aptamerPSMAProstate cancer (LNCaP) cellsIn vitro and in vivo in mice[18]
PLGA-b-PEG and PLA-b-PEGSingle emulsionDocetaxelS,S-2-[3-[5-amino-1-carboxypentyl]-ureido]-pentanedioic acid (ACUPA)PSMAProstate cancer/LNCaP cellsIn vitro and in vivo in mice, rats, non-human primates, and phase 1 clinical trials in humans[19]
PLGA-mPEGDouble emulsionCisplatinProstate cancer (LNCaP) cellsIn vitro[20]
PLGA-mPEG + CMCW/O/W double emulsion-solvent evaporationCisplatinOvarian cancer (IGROV1-CP) cellsIn vitro and in vivo in mice[21]
PLGA-b-PEGNanoprecipitationPt (IV) prodrugA10 aptamerPSMAProstate cancer (LNCaP) cellsIn vitro[22]
PLGA-b-PEGNanoprecipitationPt (IV) prodrugA10 aptamerPSMAProstate cancer (LNCaP) cellsIn vivo in mice and rats[23]
PLGA-b-PEGNanoprecipitationCisplatinCyclic Arg-Gly-Asp (cRGD) peptideαvβ3 IntegrinBreast (MCF-7) and prostate cancer (PC3 and DU145) cellsIn vitro and in vivo in nude mice[24]
PLGAW/O/W double emulsion-solvent evaporationCisplatinColon adenocarcinoma cellsIn vitro and in vivo in mice[25, 26]
PLGAW/O/W double emulsion-solvent evaporation5-Fluorouracil (5-FU)Glioma (U87MG) and breast adenocarcinoma (MCF7) cell linesIn vitro[27]
Glycosylated chitosan (GCS)Single emulsion5-FUHepatocellular carcinoma (HCC)/SMMC-7721 cellsIn vitro and in vivo in mouse model[28, 29]
HA-PEG-PLGANanoprecipitation5-FUEhrlich ascites tumor (EAT) cell linesIn vitro and in vivo in mice[30]
PBLG-PEGDialysis5-FUHuman colon cancer (LoVo) cell lines and squamous carcinoma (Tca 8113) cellIn vitro and in vivo in mice[31]
PLGANanoprecipitationDoxorubicin (DOX)MDA-MB-231 breast cancer cellsIn vitro[32]
mPEG-b-P(CL-co-HCLDialysisDOXHepG2 cellsIn vitro[33]
L-PLGA-HSAHigh-pressure homogenization-emulsificationDOXRat glioblastomaIn vivo in rat[34]
PLGASolvent displacementDOXcLABLICAM-1Lung epithelial cancer cells (A549) [35]
PLGASingle emulsion-spin castingDOXHeLa cellsIn vitro[36]
PLGAW/O/W double emulsion-solvent evaporationDOXFibroblast cellsIn vitro[37]
PLGA-PEGOil in water-solvent evaporationDOXNovel peptideEpidermal growth factor receptor (EGFR)Human ovarian cancer (SKOV3) cellsIn vitro and in vivo in mice[38]
PLC and PDLLATamoxifen (TMX)HeLa and MCF-7 cellsIn vitro[39]
PAA-CholesterolElectrosprayTMXMCF-7 cellsIn vitro[40]
PLGAEmulsion-diffusion evaporationTMXBreast cancer (C1271) cellsIn vivo in mouse[41]
PLGASolvent displacementTMXMCF-7 cellsIn vivo in mouse[42]
PEO-PCLSolvent displacementPaclitaxel and TMXOvarian adenocarcinoma (SKOV3) and MDR-1-positive (SKOV3TR) cell linesIn vitro and in vivo in nude mice[43]
Chitosan (CS)GemcitabineHER2Pancreatic cancer (Mia Paca 2 and PANC 1) cellsIn vitro[44]
Chitosan (CS)CoacervationGemcitabineMurine lymphocytic tumor (L1210wt) cellsIn vivo in mice[45]
PLGAGemcitabineAnti-EGFR monoclonal antibodyEGFRPancreatic cancer cellsIn vitro[46]
PLGAEmulsion-solvent evaporationGemcitabinePancreatic cancer cells (PANC1)In vitro[47]
PEG-PDLLAW/O/W double emulsionGemcitabineHuman pancreatic cancer (SW1990) cellsIn vitro[48]
mPEGIonic gelation and chemical cross-linkingMitomycin C (MMC)Folic acid (FA)HeLa cellsIn vivo in mice[49]
Poly(butyl cyanoacrylate)NanoprecipitationEpirubicin (EPI)Human carcinoma (HeLa and A549) cell linesIn vitro[50]
Pullulan acetate (PA)Solvent diffusionEPIFAFolate receptorNasopharyngeal epidermal carcinoma (KB) cell linesIn vitro[51]
CelluloseNanoprecipitationCurcuminProstate cancer (C4-2, LnCAP, PC3, and DU145) cellsIn vitro[52]
PLGASolid/oil/water emulsion-solvent evaporationCurcuminProstate cancer (LnCAP, PC3, and DU145)In vitro[53]

POLYMER NPs FOR DRUG LOADING AND DELIVERY

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. PREPARATION AND CHARACTERIZATION OF POLYMER NPs
  5. POLYMER NPs FOR DRUG DELIVERY
  6. POLYMER NPs FOR DRUG LOADING AND DELIVERY
  7. POLYMER NPs FOR SMALL SILENCING RNA DELIVERY IN CANCER THERAPY
  8. POLYMER NPs FOR miRNA DELIVERY
  9. POLYMER NPs FOR ANTISENSE miRNA (ANTAGOMIR) DELIVERY
  10. POLYMER NPs FOR siRNA DELIVERY
  11. POLYMER NPs FOR shRNA DELIVERY
  12. ADVANTAGES OF NPs PREPARED FROM PLGA AND PLGA-PEG POLYMERS COMPARED WITH OTHER POLYMERS
  13. ADVANTAGES AND DISADVANTAGES ASSOCIATED WITH THE USE OF POLYMER NPs FOR DRUG DELIVERY
  14. CONCLUSION
  15. ACKNOWLEDGMENTS
  16. REFERENCES

Paclitaxel (PTX)- and Docetaxel (DTXL)-Loaded Polymer NPs

PTX-loaded PEGylated PLGA NPs was developed by Danhier et al.[16] They prepared the PTX-loaded PEGylated PLGA-based NPs using simple emulsion and nanoprecipitation techniques, with subsequent in vitro and in vivo testing against human cervical carcinoma cells (HeLa). The drug release behavior of PTX-loaded NPs showed a biphasic pattern with an initial burst release followed by a slower and continuous release. Exposure of HeLa cells to PTX-loaded NPs induced the same percentage of apoptotic cells in vitro, and showed a greater tumor growth inhibition effect in vivo compared with free PTX.[16] Cheng et al. reported the synthesis, preparation, and size optimization of 14C-PTX- and DTXL-loaded carboxy-terminated PLGA-b-PEG-COOH block copolymer NPs using nanoprecipitation method. They also conjugated these NPs to A10 RNA aptamer for in vivo drug delivery for prostate cancer (PCa; Figure 2). A10 aptamer binds to prostate-specific membrane antigen (PSMA) protein on the surface of the PCa cells. NP and NP–aptamer biodistribution was estimated in an LNCaP (PSMA+) xenograft mouse model for PCa. A10 RNA aptamer-conjugated NPs showed enhanced NP delivery to the prostate tumors compared to that of corresponding nontargeted NPs.[17] In a similar study, the same group reported synthesis of the DTXL-loaded PLGA-b-PEG-COOH NPs conjugated with A10 2′-fluoropyridine RNA aptamer. These NPs showed remarkable efficiency, reduced toxicity, and more tumor reduction in LNCaP xenograft nude mice.[18] The same group reported a preparation of combinatorial library of DTXL-loaded PSMA ligand-targeted NPs of varying polymer compositions, concentrations, sizes, targeting ligand density, surface hydrophilicity, and other processing parameters using the single emulsion method.[19] These targeted NPs contain the PDLLA or PLGA and PEG in which DTXL was physically entrapped, and a targeted ligand that mediated the molecular interactions between NPs and PSMA. They found that optimized DTXL PSMA ligand-loaded NPs could release chemotherapeutic DTXL in a controlled manner in vitro as well as in live mice, rats, and non-human primates against the PCa cells without any cytotoxicity to the animals. These DTXL NPs also slowed the inhibition of prostate tumor growth of up to 26% compared with the free DTXL-delivered animals in which tumor grew to 100% in a 7-week period in mouse. These NPs were used in the treatment of 12 cancer patients (phase 1 clinical trials) and demonstrated clearance results similar to those in animals.[19]

image

Figure 2. Docetaxel encapsulated within poly(lactide-co-glycolide)-block-polyethylene glycol-COOH (PLGA-b-PEG-COOH) polymer nanoparticles (NPs) using the nanoprecipitation method, and conjugated to aptamer for selective delivery to treat prostate cancer. (Reprinted with permission from Ref [17]. Copyright 2007 Elsevier Ltd)

Download figure to PowerPoint

Cisplatin-Loaded Polymer NPs

Cisplatin is one of the most widely used anticancer agents, particularly for the ovarian, breast, prostate, and testicular cancers. But their therapeutic effects are dose limiting because of many serious side effects, notably liver and kidney toxicity, when administered directly as a free drug. To overcome these side effects, a more selective administration to cancer cell is required. For this purpose, several cisplatin-entrapped NPs were developed for slow delivery of drug without loss of activity.[20-24, 54] Gryparis et al. reported a preparation of PLGA-methoxy PEG (mPEG) NPs of cisplatin using the double emulsion method.[54] These cisplatin-loaded NPs showed in vitro anticancer activity against human PCa LNCaP cells similar to that of a free drug.[20] Cheng et al. reported that cisplatin-loaded carboxymethyl cellulose (CMC) core PLGA-mPEG NPs synthesized using the double emulsion method showed activity against the IGROV1-CP ovarian cancer cells in vitro and in vivo in nude mice[21] (Figure 3).

image

Figure 3. Tumor cell apoptosis measured by TUNEL staining. (a) Microscopic evaluation of tumor apoptosis by TUNEL staining. (b) Average apoptotic cell counts. Source: Cheng et al.[21]

Download figure to PowerPoint

Dhar et al. reported the aptamer-functionalized Pt(IV) (c,t,c-[Pt(NH3)2 (O2CCH2CH2CH2CH2CH3)2 Cl2]) prodrug-loaded PLGA-b-PEG NPs against human prostate PSMA-overexpressing LNCaP cancer cells. The inactive prodrug Pt(IV) releases the active cisplatin after reduction inside the cell (Figure 4). The aptamer-functionalized Pt(IV)-entrapped NPs showed considerably superior activity compared to that of free cisplatin or nontargeted NPs against LNCaP cancer cells.[22] The in vivo pharmacokinetics (PK), tolerability, biodistribution, and efficacy of Pt(IV) prodrug-entrapped PLGA-b-PEG aptamer NPs against xenograft of PCa in rats and mice showed significant improvement in the drug therapeutic index.[23] αvβ3 Integrin-targeted Pt(IV) PLGA-PEG NPs conjugated with cyclic Arg-Gly-Asp (cRGD) peptide inhibited the growth of breast and PCa cells in vitro at micromolar concentrations and improved anticancer activity in vivo compared to free drugs in nude mice.[24]

image

Figure 4. Structure and chemistry of the hydrophobic prodrug platinum(IV) compound and active drug, hydrophilic cisplatin, which is released after reduction in the cell. (Reprinted with permission from Ref [22]. Copyright 2008 National Academy of Sciences, U.S.A.)

Download figure to PowerPoint

Moreno et al. reported the cisplatin-entrapped PLGA NPs using the double emulsion method. These NPs showed a controlled release of cisplatin that induced more apoptosis than free cisplatin against colon adenocarcinoma cells in vitro, and also demonstrated good anticancer activity in vivo.[25, 26]

5-Fluorouracil (5-FU)-Loaded Polymer NPs

5-FU is a pyrimidine analog that is one of the widely used cytotoxic drugs. It is a thymidylate synthase inhibitor that ultimately stops tumor cell growth. 5-FU is used in the treatment of malignant tumors such as glioblastoma, liver, and breast cancers. Like other chemotherapeutic drugs, 5-FU also has several side effects when administered as a free drug.

5-FU-Loaded PLGA NPs

Nair et al. reported a preparation of 5-FU-encapsulated PLGA NPs using the double emulsion method with 66% encapsulation efficiency. The 5-FU-loaded PLGA NPs showed better cytotoxicity against glioma (U87MG) and breast adenocarcinoma (MCF7) cell lines than free drug.[27] Yadav et al. reported a preparation of 5-FU-loaded hyaluronic acid-PEG-PLGA (HA-PEG-PLGA) NPs and tested them against Ehrlich ascites tumor cell lines in vitro and in vivo in mice. These NPs were able to deliver a higher concentration of 5-FU in the tumor mass and found to be less hemolytic but more cytotoxic, and reduced the tumor volume significantly compared with free 5-FU.[30]

5-FU-Loaded Chitosan NPs

Cheng et al. reported a preparation of the 5-FU-encapsulated galactosylated chitosan (GC) NPs and tested their effects on hepatocellular carcinoma (HCC) in vitro and in vivo. These 5-FU-loaded GC NPs extensively inhibited tumor growth and were more effective at targeting HCC than 5-FU free drug by activating the p53 pathway in orthotropic liver cancer mouse model.[28, 29]

5-FU-Loaded PBLG-PEG NPs

5-FU-entrapped poly(γ-benzyl-l-glutamate-PEG) (PBLG-PEG) NPs displayed promising PK characteristics, including sustained drug release, prolonged drug half-life, and increased tissue appetency. These NPs showed superior inhibition of tumor growth on human colon cancer (LoVo) cell xenografts and human oral squamous carcinoma (Tca 8113) cell xenografts.[31]

Doxorubicin (DOX)-Loaded Polymer NPs

DOX is an anthracycline antibiotic that inhibits the DNA synthesis, and is a widely used drug for cancer chemotherapy. DOX has been used in the treatment of acute leukemia, lymphoma, breast, bladder, ovarian, lung, gastric, and testicular cancers.[7, 55] DOX has many adverse effects when administered as a free drug. Efficient drug delivery systems for the DOX are under development.[7, 55]

DOX-Loaded PLGA NPs

Betancourt et al. reported a preparation of DOX-encapsulated PLGA NPs using an oil–water nanoprecipitation technique with the resulting average size of 174 nm. These NPs showed therapeutic efficiency against the MDA-MB-231 breast cancer cells comparable with free drug in vitro.[32]

Poloxamer 188-coated lecithin-PLGA-human serum albumin (HSA) DOX-loaded (DOX-L-PLGA-HSA) NPs enabled delivery of DOX across the blood–brain barrier in the therapeutically effective concentrations in rat glioblastoma.[34]

DOX-loaded cyclo-(1,12)-PenITDGEATDSGC (cLABL) peptide-conjugated PLGA NPs (DOX-cLABL-PLGA NPs) showed more rapid cellular uptake by A549 lung epithelial cancer cells compared to nonpeptide-conjugated NPs by targeting encapsulated DOX to ICAM-1-expressing cells.[35]

DOX-entrapped PLGA-gold half-shell NPs (DOX-PLGA-Au-H-S NPs) can deliver both DOX and heat simultaneously to a selected tumorigenic region when irradiated with lights in the near infrared region with higher cytotoxicity and more controlled delivery in HeLa cells.[36]

DOX-loaded PLGA NPs showed sustained drug release rate in fibroblast cells in vitro without initial burst.[37] DOX-loaded peptide-conjugated PLGA-PEG-NH2 NPs containing an amino end group displayed threefold higher uptake than corresponding peptide-free PLGA-PEG-NH2 NPs in a human ovarian cancer SKOV3 cell line with high expression of epidermal growth factor receptor (EGFR).[38]

DOX-Loaded PCL Polymer NPs

DOX-entrapped biodegradable amphiphilic diblock copolymer mPEG-b-poly(ε-caprolactone-co-γ-hydroxyl-ε-caprolactone) [mPEG-b-P(CL-co-HCL)] bearing pendant hydroxyl groups NPs showed good cytotoxicity against HepG2 cells in vitro.[33]

Tamoxifen (TMX)- and 4-Hydroxytamoxyfen (4-OHT)-Loaded Polymer NPs

TMX is an estrogen receptor antagonist that acts via its metabolite hydroxytamoxifen; its more active form is 4-hydroxytamoxifen (4-OHT), a triphenylethylene derivative. TMX binds to the estrogen receptor in breast tumors, releasing a nuclear complex that reduces the DNA synthesis and inhibits estrogen's effects. TMX is a widely used drug in the antiestrogen treatment for advanced or metastatic breast cancers that are positive for estrogen receptor expression.[56] Because of TMX's relatively poor oral bioavailability and several side effects, polymer NPs have gained much interest for its drug delivery.

TMX-Loaded Poly(d,l-lactide-co-caprolactone) (PLC) Copolymer and PDLLA NPs

TMX-loaded mixture of PLC copolymer and PDLLA NPs showed good cytotoxicity against cervical cancer (HeLa) cells and effectiveness against breast cancer (MCF-7) cells.[39]

TMX-Loaded Poly(amidoamine)-Cholesterol NPs

TMX-entrapped poly(amidoamine)-cholesterol (PAA-cholesterol)-conjugated NPs showed slow release and enhanced cytotoxicity against MCF-7 cells in comparison with the free drug.[40]

TMX-Loaded PLGA NPs

TMX citrate-encapsulated PLGA NPs with mean size of 165 nm showed enhanced activity against breast cancer (C1271) tumor when administered orally in a murine model. Oral bioavailability of TMX from PLGA NPs was increased by 11.19 times when compared with the free drug in vivo. The tumor size was reduced up to 41.56% when compared with untreated animal, which showed an increased tumor size of up to 158.66% in a DMBA-induced breast tumor model. These TMX-loaded NPs exhibited important value for oral chronic breast cancer therapy.[41] 4-OHT-loaded PLA-PEG NPs arrested estradiol-induced tumor growth, inducing apoptosis and inhibiting angiogenesis in breast cancer (MCF-7) cells in vivo in mice.[42]

TMX- and PTX-Coloaded Polyethyleneoxide-Polycaprolactone (PEO-PCL) NPs

As TMX is more cytostatic than cytotoxic, PTX and TMX combination drugs loaded in PEO-PCL NPs have been used and found to have enhanced antitumor efficacy in ovarian adenocarcinoma (SKOV3 and MDR-1-positive SKOV3TR cell lines) in vivo in nude mice. The results demonstrate that biodegradable PEO-PCL NPs can serve as an effective approach to overcome multidrug resistance in ovarian adenocarcinoma.[43]

Gemcitabine-Loaded Polymer NPs

Gemcitabine is a nucleoside analog of deoxycytidine used as a chemotherapeutic agent to treat various types of cancers, including non-small cell lung carcinoma, pancreatic cancer, metastatic breast cancer, and ovarian cancer. Gemcitabine undergoes rapid enzymatic degradation following intravenous injection and exhibits various side effect, including fever, nausea, vomiting, fatigue, hair loss, and shortness of breath when administered as a free drug. To improve the delivery of gemcitabine and increase the antitumorogenic effect, various drug delivery systems were developed using polymer NPs.[44-48]

Gemcitabine-Loaded Chitosan NPs

Herceptin (HER2)-conjugated gemcitabine-loaded chitosan NPs (HER2-Gem-CS NPs) showed efficient targeted delivery of gemcitabine in pancreatic cancer, and displayed enhanced antiproliferative activity. These NPs also induced an improved S-phase arrest leading to apoptosis, in comparison with nontargeted gemcitabine-loaded NPs and the free gemcitabine.[44] Intravenous injection of gemcitabine-entrapped chitosan NPs demonstrated significantly enhanced antitumor activity compared with free gemcitabine against murine lymphocytic tumor (L1210wt cells) in mice[45] (Figure 5).

image

Figure 5. Histological observation of murine lymphocytic tumors isolated from mice treated with free and nanoparticle-encapsulated gemcitabine by hematoxylin–eosin–saffron (HES) staining. (Reprinted with permission from Ref [45]. Copyright 2011 American Chemical Society)

Download figure to PowerPoint

Gemcitabine-Loaded PLGA and PDLLA NPs

Anti-EGFR monoclonal antibody-conjugated gemcitabine-loaded PLGA NPs were used for the selective delivery in pancreatic cancer cells in vitro.[46] Gemcitabine-loaded PLGA NPs showed significantly increased cytotoxicity, apoptosis, and distinct intracellular trafficking mechanisms in drug-resistant pancreatic cancer cells (PANC1) in comparison to free gemcitabine in vitro.[47] Gemcitabine-loaded PEG-block-PDLLA (PEG-PDLLA) NPs displayed good performance for controlled drug release, and showed similar cytotoxic activity to free gemcitabine in human pancreatic cancer (SW1990) cell line in vitro.[48]

Mitomycin C (MMC)-Loaded Polymer NPs

MMC is an antineoplastic antibiotic, and is used as chemotherapeutic agent for the treatment of esophageal carcinoma, breast, anal, and bladder cancers. It has shown several side effects, including nausea, vomiting, hair loss, skin rash, lung damage, and shortness of breath when it is administered as a free drug.

MMC-Loaded Chitosan NPs

MMC-entrapped cationic NPs based on chitosan, poly-l-lysine (PLL), or PCL showed effective intravesical delivery of MMC in bladder tumors in a rat model.[57, 58] MMC loaded with folic acid (FA) and mPEG-conjugated chitosan NPs showed initial burst release and subsequent slower release in human adenocarcinoma HeLa cells. Laser confocal scanning imaging showed that these MMC-FA-mPEG-chitosan NPs could significantly increase drug uptake by HeLa cells. In vivo animal experiments demonstrated that an increased amount of MMC-FA-mPEG NPs was accumulated in the tumor tissue relative to the mPEG NPs in a nude mouse xenograft model.[49]

Epirubicin (EPI)-Loaded Polymer NPs

EPI is an anthracycline chemotherapeutic drug, and is the 4′-epimer of DOX. It intercalates within the DNA strands that lead to the complex that inhibits DNA replication and RNA transcription. It is mainly used for the treatment of breast, lung, ovarian, and gastric cancers, and lymphomas.

EPI-Loaded Poly(butyl cyanoacrylate) NPs

EPI-loaded poly(butyl cyanoacrylate) nanospheres prepared by nanoprecipitation are found to be more cytotoxic than free drug to human carcinoma (HeLa and A549) cell lines in vitro owing to enhanced cellular internalization of EPI.[50]

EPI-Loaded Pullulan Acetate (PA) NPs

EPI-loaded FA-conjugated PA (Epi-FA-PA) NPs showed higher cytotoxicity and greater extent of cellular uptake against human nasopharyngeal epidermal carcinoma (KB) cell lines overexpressing folate receptor. Epi-FA-PA NPs might be a possible targeted carrier for delivering drugs to folate receptor overexpressing cancer cells.[51]

Curcumin-Loaded Polymer NPs

Curcumin is a natural phenolic compound, a major component found in spice turmeric (curcuma longa). It is known to exhibit a variety of activities, including antioxidant, anti-inflammatory, antiamyloid, antiarthritic, and, most importantly, antitumor activities. Nevertheless, these benefits are limited by its poor oral bioavailability and aqueous solubility. To improve its bioavailability, several delivery approaches have been developed.

Curcumin-Loaded PLGA NPs

Curcumin-loaded PLGA NPs and PLGA-PEG NPs showed 15.6- and 55.4-fold increases in curcumin oral bioavailability, respectively, when compared with free curcumin in aqueous suspension in rats.[59] Curcumin-loaded PLGA NPs were shown to be more effective in arresting cell growth when compared with free curcumin in PCa (LnCAP, PC3, and DU145) cell lines.[53]

Curcumin-Loaded Cellulose NPs

Curcumin-encapsulated cellulose NPs displayed the highest cellular uptake and caused maximum ultrastructural changes related to apoptosis and enhanced anticancer efficacy compared with free curcumin against PCa (C4-2, LnCAP, PC3, and DU145) cell lines in vitro.[52]

POLYMER NPs FOR SMALL SILENCING RNA DELIVERY IN CANCER THERAPY

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. PREPARATION AND CHARACTERIZATION OF POLYMER NPs
  5. POLYMER NPs FOR DRUG DELIVERY
  6. POLYMER NPs FOR DRUG LOADING AND DELIVERY
  7. POLYMER NPs FOR SMALL SILENCING RNA DELIVERY IN CANCER THERAPY
  8. POLYMER NPs FOR miRNA DELIVERY
  9. POLYMER NPs FOR ANTISENSE miRNA (ANTAGOMIR) DELIVERY
  10. POLYMER NPs FOR siRNA DELIVERY
  11. POLYMER NPs FOR shRNA DELIVERY
  12. ADVANTAGES OF NPs PREPARED FROM PLGA AND PLGA-PEG POLYMERS COMPARED WITH OTHER POLYMERS
  13. ADVANTAGES AND DISADVANTAGES ASSOCIATED WITH THE USE OF POLYMER NPs FOR DRUG DELIVERY
  14. CONCLUSION
  15. ACKNOWLEDGMENTS
  16. REFERENCES

In 1993, the first small silencing RNA was discovered. Since then, numerous small RNAs, including small interfering RNA (siRNA), small hairpin RNA (shRNA), and microRNA (miRNA), have been identified and used for various biological applications.[60] siRNAs are 20–25 nucleotide double-stranded RNA (dsRNA) molecules that after binding to RNA-induced silencing complex enable the cleavage and degradation of recognized messenger RNA (mRNA). miRNAs are small single-stranded RNAs of 18–23 nucleotides that are partially or fully complimentary to the 3″ noncoding region of mRNA sequence. They achieve gene silencing through blocking mRNAs translation or by degrading mRNAs. The ability to achieve sequence-specific gene silencing using RNA interference (RNAi) has been used in wide range of applications, including the treatment of numerous diseases, particularly for the cancer therapy.[61] Nevertheless, in vivo systemic administration and delivery of these small silencing RNA-based therapeutics to cells and tumors remains a challenge owing to the limitations such as poor cellular uptake, degradation by serum nucleases, and rapid renal clearance after administration.[62] To overcome these limitations, the development of effective and safe nanocarriers for systemic delivery of small silencing RNAs is required for efficient cancer therapy. Biodegradable polymer NPs have been found to be safe and effective nanocarriers for the delivery of small silencing RNAs (Tables 2-4).

Table 2. Polymer Nanoparticles for MicroRNA Delivery in Cancer Therapy
Polymer NanoparticlesNanoparticles Preparation MethodConjugationTarget LigandMicroRNA/DrugCancer/Cell LinesIn Vitro/In VivoReferences
  1. PLGA, poly(lactide-co-glycolide); PEI, polyethyleneimine; PEG, polyethylene glycol; LPH, liposome-polycation-hyaluronic acid; pDNA, plasmid DNA.

PLGADouble emulsion-solvent evaporationCell-penetrating peptide (CPP)Anti-miR-155Pre-B-cell tumorsIn vivo in mice[72]
Poly-l-lysine (PLL)Nanocomplex formulationAnti-miR-10bMDA-MB-231 breast cancer cellsIn vitro[73]
Poly(amidoamine)Anti-miR-21 and 5-FUU251 glioma brain tumor cellsIn vitro[74]
PLGA-PEIW/O/W double emulsionmiRNA-26a expression vector (pDNA)HepG2 cellsIn vitro[75]
PLGAW/O/W double emulsionCPPAnti-miR-155KB cellsIn vitro[76]
PEG-LPHThin film hydration followed by membrane extrusionCyclic Arg-Gly-Asp (cRGD) peptideαvβ3 IntegrinAnti-miR-296Human umbilical vein endothelial cellsIn vitro and in vivo in nude mice[77]
Table 3. Polymer Nanoparticles for the Delivery of siRNAs for Cancer Therapy
Polymer NanoparticlesNanoparticles Preparation MethodConjugationTarget LigandsiRNACancer/Cell LinesIn Vitro/In VivoReferences
  1. PLGA, poly(lactide-co-glycolide); mPEG, methoxy polyethylene glycol; PLL, poly-l-lysine; PEI, polyethyleneimine; PEG, polyethylene glycol.

PLGADouble emulsionsiERK2 and siMAPK1HepG2, NIH/3T3 fibroblasts, and HeLa cellsIn vitro and in vivo in transgenic EGFP mice[81]
PLGA-chitosanSpontaneous emulsion diffusionHBV− geneSense: 5′-ACCGTCTGTGCCTTCTCATCTTTT-3′; antisense: 3′-TTTTGGCAGACACGGAAGAGTA-5′HepG2.2.15 cell linesIn vitro[82]
mPEG-PLGA-PLLW/O/W double emulsionsiRNARetinal pigment epithelium (RPE-J) cellsIn vitro[83]
mPEG-PLGA-PLLW/O/W double emulsionsiRNAHuman lung cancer (SPC-A1-GFP) cellsIn vitro[84]
mPEG-PLGA-PLLcRGDhVEGF-siRNAPC3 cellsIn vitro[85]
PEI-PEGElectrostatic interactionsAla-Pro-Arg-Pro-Gly (APRPG)Human VEGFsiRNA: sense: 5′-GGAG UACCCUGAUGAGAUCdTdT-3′; antisense: 5′-GAU CUCAUCAGGGUACUCCdTdT-3′Breast cancer/MCF-7 cellsIn vitro and in vivo in mice[86]
Table 4. Polymer Nanoparticles for the Delivery of the shRNAs for Cancer Therapy
Polymer NanoparticlesNanoparticles Preparation MethodConjugationTarget LigandshRNACancer/Cell LinesIn Vitro/In VivoReferences
  1. PLGA, poly(lactide-co-glycolide); HIF-1α, hypoxia-inducible factor 1α; shRNA, small hairpin RNA; pDNA, plasmid DNA; VEGF, vascular endothelial growth factor; HCC, hepatocellular carcinoma; PAE, poly-β-amine ester.

PLGAW/O/W double emulsionHIF-1α-shRNA-pDNAChoroidal neovascularization (CNV)In vitro and in vivo in rats[92]
PLGADouble emulsion-solvent evaporationVEGF-A-shRNA (AATGCAGACCAAAGAAAGACA)Murine corneal neovascularization (KNV)In vivo in mice[93]
PLGASolvent diffusionA10 aptamerPSMAAR-shRNAProstate cancer (22RV1, LAPC-4, and LNCaP) cell linesIn vitro and in vivo in mice[94]
ChitosanNanocomplex formulationVEGFVEGF-shRNAHCC cellsIn vitro and in vivo in mice[95]
PAENanocomplex formulationshRNAU-87 MG cells and HEK-293 cellsIn vivo in mice[96]

POLYMER NPs FOR miRNA DELIVERY

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. PREPARATION AND CHARACTERIZATION OF POLYMER NPs
  5. POLYMER NPs FOR DRUG DELIVERY
  6. POLYMER NPs FOR DRUG LOADING AND DELIVERY
  7. POLYMER NPs FOR SMALL SILENCING RNA DELIVERY IN CANCER THERAPY
  8. POLYMER NPs FOR miRNA DELIVERY
  9. POLYMER NPs FOR ANTISENSE miRNA (ANTAGOMIR) DELIVERY
  10. POLYMER NPs FOR siRNA DELIVERY
  11. POLYMER NPs FOR shRNA DELIVERY
  12. ADVANTAGES OF NPs PREPARED FROM PLGA AND PLGA-PEG POLYMERS COMPARED WITH OTHER POLYMERS
  13. ADVANTAGES AND DISADVANTAGES ASSOCIATED WITH THE USE OF POLYMER NPs FOR DRUG DELIVERY
  14. CONCLUSION
  15. ACKNOWLEDGMENTS
  16. REFERENCES

miRNAs are endogenous small, highly conserved, noncoding RNAs of 18–24 nucleotides in length that are engaged in the post-transcriptional regulation of gene expression through the RNAi pathway in cells.[60-71] Dysregulated expression of various miRNAs has been associated with various cellular diseases including cancer. MiRNAs are closely associated with cancer development owing to their ability to promote growth of cancer cells.[60-71] Based on their functions, they are categorized as oncogenic miRNAs, or oncomirs, and tumor suppressors miRNAs, or anti-oncomirs. Oncomirs promote tumor growth by inhibiting tumor suppressor genes or apoptotic genes, whereas anti-oncomirs are a group of miRNAs that block the function of cell cycle proteins and induce apoptosis by downregulating the expression of the antiapoptotic genes.[66, 67] There are numerous miRNAs that are considered to be tumor suppressors, including miR-17-5p, miR-21, miR-29, miR-34, miR-127, miR-155, and let-7.[65] Targeting miRNAs is considered to be a new approach in the development of a new class of molecularly targeted anticancer therapeutics (Table 2).

POLYMER NPs FOR ANTISENSE miRNA (ANTAGOMIR) DELIVERY

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. PREPARATION AND CHARACTERIZATION OF POLYMER NPs
  5. POLYMER NPs FOR DRUG DELIVERY
  6. POLYMER NPs FOR DRUG LOADING AND DELIVERY
  7. POLYMER NPs FOR SMALL SILENCING RNA DELIVERY IN CANCER THERAPY
  8. POLYMER NPs FOR miRNA DELIVERY
  9. POLYMER NPs FOR ANTISENSE miRNA (ANTAGOMIR) DELIVERY
  10. POLYMER NPs FOR siRNA DELIVERY
  11. POLYMER NPs FOR shRNA DELIVERY
  12. ADVANTAGES OF NPs PREPARED FROM PLGA AND PLGA-PEG POLYMERS COMPARED WITH OTHER POLYMERS
  13. ADVANTAGES AND DISADVANTAGES ASSOCIATED WITH THE USE OF POLYMER NPs FOR DRUG DELIVERY
  14. CONCLUSION
  15. ACKNOWLEDGMENTS
  16. REFERENCES

Effective overexpression strategies in vivo are needed to examine the effects of miRNA-directed regulation of gene expression. Antagomirs or anti-miRs are small chemically modified antisense oligonucleotides that are used to block the function of endogenous miRNAs. They inhibit miRNA activity by irreversibly binding to the target miRNA.[78] Specific miRNAs can be silenced by anti-miRNAs complementary to the mature miRNA sequences.[79] Each miRNA controls the expression of numerous target genes by blocking translation of the target protein, and about 200 target genes may be regulated by a single miRNA.[80] Antagomirs are effective silencers of miRNA function expression in mice. Antagomir-122 has been used to specifically silence the function of miR-122 in the lung, liver, skin, intestine, heart, and bone marrow of normal mice. The effect of targeted gene silencing was found to last for more than a week after a single intravenous injection.[78, 80]

Anti-miR-155-Loaded PLGA NPs

miRNA-155 (miR-155) is an oncogenic miRNA. It is overexpressed in several cancers and regulates numerous pathways involved in cell division and immunoregulation. It is a key target for future therapies.[72] Babar et al. reported the synthesis of anti-miR-155-encapsulated PLGA NPs by a double emulsion-solvent evaporation method. NP surfaces were modified with cell-penetrating peptides (CPPs). Systematic delivery of these anti-miR-155-loaded PLGA polymer NPs inhibited miR-155 and reduced the growth of pre-B-cell tumors in vivo in mice, indicating an encouraging therapeutic option for lymphoma and leukemia.[72]

Anti-miR-10b-Loaded PLL NPs

The wound-healing assay is generally used to present valuable information on cell migration, invasion, and proliferations. MicroRNA-10b positively controls breast cancer cell migration and invasion through inhibition of HOXD10 target synthesis, and directly inhibits breast cancer metastasis. Anti-miRNA-10b-loaded PLL (PLL-anti-miR-10b) NPs, when administered to MDA-MB-231 breast cancer cells, strongly inhibit the invasive property of cells as measured by the wound-healing assay for up to 4 weeks. Anti-miR-10b molecules delivered into the cytoplasm of the breast cancer cells in a concentration-dependent manner showed sustained efficiency. These PLL-anti-miR-10b NPs may offer progressive applications for inhibiting breast cancer metastasis.[73]

Codelivery of Anti-miR-21 and 5-FU by Poly(amidoamine) Dendrimer NPs

MiR-21 is an important player in a majority of cancers. Anti-miR-21- and 5-FU-loaded poly(amidoamine) dendrimer NPs significantly enhanced the cytotoxicity of 5-FU and strongly increased the apoptosis of U251 glioma brain tumor cell line, and the migration ability of tumor cell was significantly decreased. The codelivery of anti-miR-21 might have significant applications in the treatment of miRNA-21-overexpressing glioblastoma tumors.[74]

MiRNA-26a Expression Vector (Plasmid DNA, pDNA)-Loaded PLGA-PEI NPs

Liang et al. reported a preparation of cationic PLGA-based NPs of about 60 nm sizes by coating PLGA core with a cationic polyethyleneimine (PEI) shell for gene delivery by the emulsion evaporation method. These NPs have overcome the limitations of cationic liposome and PEI-based NPs. These cationic PLGA-PEI NPs were loaded with miRNA-26a expression vector (pDNA) and studied in HepG2 HCC cells. The results showed efficient delivery and expression of miRNA in HCC (HepG2) cells, and improved the effect of functional miRNA-26a delivery. The results showed that these PLGA-PEI NPs are promising nonviral vectors for gene delivery.[75]

CPP-coated PLGA NPs have been used to efficiently deliver chemically modified oligonucleotide analogs to compete gene regulation in blocking the activity of the oncogenic miR-155, and to modulate splicing to decrease the expression of the proto-oncogene, Mcl-1. Regulation of these genes in cancer cells decreased cell viability and produced proapoptotic effects.[76]

Anti-miR-296-Loaded PEGylated Liposome-Polycation-Hyaluronic Acid (PEG-LPH) NPs

cRGD peptide-conjugated PEG-LPH-targeted NPs efficiently delivered the anti-miR-296 oligonucleotides (AMOs) to the cytoplasm and downregulated the target mRNA in human umbilical vein endothelial cells by blocking the function of endogenous miT-296. However, without cRGD peptide conjugation, these NPs showed only little AMO uptake and miRNA silencing activity, whereas cRGD peptide-conjugated NPs efficiently inhibited endothelial cell migration and blood tube formulation, owing to substantial upregulation of hepatocyte growth factor-regulated tyrosine kinase substrate. These targeted cRGD peptide-conjugated PEG-LPH NPs also showed potential antiangiogenesis activity with the delivery of AMOs to the targeted site in vivo, as assessed by the Matrigel plug assay.[77]

POLYMER NPs FOR siRNA DELIVERY

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. PREPARATION AND CHARACTERIZATION OF POLYMER NPs
  5. POLYMER NPs FOR DRUG DELIVERY
  6. POLYMER NPs FOR DRUG LOADING AND DELIVERY
  7. POLYMER NPs FOR SMALL SILENCING RNA DELIVERY IN CANCER THERAPY
  8. POLYMER NPs FOR miRNA DELIVERY
  9. POLYMER NPs FOR ANTISENSE miRNA (ANTAGOMIR) DELIVERY
  10. POLYMER NPs FOR siRNA DELIVERY
  11. POLYMER NPs FOR shRNA DELIVERY
  12. ADVANTAGES OF NPs PREPARED FROM PLGA AND PLGA-PEG POLYMERS COMPARED WITH OTHER POLYMERS
  13. ADVANTAGES AND DISADVANTAGES ASSOCIATED WITH THE USE OF POLYMER NPs FOR DRUG DELIVERY
  14. CONCLUSION
  15. ACKNOWLEDGMENTS
  16. REFERENCES

siRNA is dsRNA of 20–25 base pairs long. Sequence-specific post-transcriptional gene silencing was found to be induced by synthetic small silencing RNA via the RNAi pathway in mammalian cells.[67] After finding the way to regulate the gene expression, siRNA has quickly been developed as a powerful tool in selectively silencing gene expression.[67, 68]

siRNA-Loaded PLGA NPs

Woodrow et al. reported the development of PLGA NP formulations with a higher siRNA loading capacity using the double emulsion-solvent evaporation technique. Topical administration of a single dose of siRNA-loaded PLGA NPs causes efficient and sustained gene silencing throughout the female mouse reproductive tract when applied externally. The knockdown of gene expression was also observed to be proximal and distal to the site of topical delivery. These siRNA-loaded PLGA NPs penetrated deep into the vaginal tissue after topical administration and demonstrated effective delivery capability for siRNA to the vaginal mucosa (Table 3).[81]

A codon-optimized pDNA containing the eGFP and siRNA targeted against HBV-X gene-loaded PLGA-chitosan NPs showed a higher HBV gene-silencing efficiency than those of plain-PLGA NPs and naked pDNA in HepG2.2.15 cells in vitro.[82] Platelet-derived growth factor BB (PDGF-BB) siRNA-loaded monomethoxypoly(ethylene glycol)-PLGA-PLL (mPEG-PLGA-PLL) NPs in combination with microbubble (MB) and ultrasound (US) administration safely increased the delivery of siRNA to rat retinal pigment epithelium (RPE-J) cells and enhanced the PDGF-BB gene silencing with a substantial decrease in mRNA and protein expression.[83]

siRNA-loaded monomethoxypoly(ethylene glycol)-PLGA-PLL (mPEG-PLGA-PLL) triblock copolymer NPs were efficiently used to transfer siRNA into human lung cancer (SPC-A1-GFP) cells steadily expressing green fluorescent protein (GFP), and produced much higher intracellular siRNA delivery efficiencies than cells transfected with siRNA alone or with the Lipofectamine-siRNA complex. These siRNA-loaded mPEG-PLGA-PLL NPs could be possibly applied as nonviral vectors for improving siRNA delivery and gene silencing.[84] Targeted delivery of cRGD peptide-conjugated human vascular endothelial growth factor (hVEGF)-siRNA-loaded mPEG-PLGA-PLL NPs in combination with MB and US treatment inhibited the VEGF expression in PC3 cells with low cytotoxicity and high gene transfection efficiency. The results demonstrated that the targeted delivery of biodegradable mPEG-PLGA-PLL NPs might prove useful as a new vector system for gene delivery.[85]

siRNA-Loaded PEI PEG NPs

siRNA-loaded and angiogenic vessel-homing Ala-Pro-Arg-Pro-Gly (APRPG) peptide-conjugated PEI PEG (siRNA-PEI-PEG-APRPG) NPs successfully enhanced the stability of siRNA to RNase A and transfection efficiency of siRNA, and enhanced the proliferation-inhibiting ability in vitro in MCF-7 cells and tumor xenograft of MCF7 cells in vivo in tumor-bearing mice.[86] This nanoformulation inhibited the formation of microvessels, suppressed the increasing volume of the tumors, and reduced the expression of VEGF protein and mRNA. The siRNA/PEI-PEG-APRPG NPs improved siRNA delivery and provided a more efficient antiangiogenic therapy than free siRNA and siRNA/PEI.[86]

POLYMER NPs FOR shRNA DELIVERY

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. PREPARATION AND CHARACTERIZATION OF POLYMER NPs
  5. POLYMER NPs FOR DRUG DELIVERY
  6. POLYMER NPs FOR DRUG LOADING AND DELIVERY
  7. POLYMER NPs FOR SMALL SILENCING RNA DELIVERY IN CANCER THERAPY
  8. POLYMER NPs FOR miRNA DELIVERY
  9. POLYMER NPs FOR ANTISENSE miRNA (ANTAGOMIR) DELIVERY
  10. POLYMER NPs FOR siRNA DELIVERY
  11. POLYMER NPs FOR shRNA DELIVERY
  12. ADVANTAGES OF NPs PREPARED FROM PLGA AND PLGA-PEG POLYMERS COMPARED WITH OTHER POLYMERS
  13. ADVANTAGES AND DISADVANTAGES ASSOCIATED WITH THE USE OF POLYMER NPs FOR DRUG DELIVERY
  14. CONCLUSION
  15. ACKNOWLEDGMENTS
  16. REFERENCES

shRNAs are a class of small RNAs with a stem of 19–29 base pairs and a loop of 4–10 nucleotides that are expressed from vectors to induce RNAi. RNAi is a natural process of inhibition of gene expression in organisms. shRNAs are sequences of genetically engineered RNAs that make a tight hairpin turn, which could be used to silence target gene expression through RNAi.[77] The expression of shRNA in cells can be achieved by delivery of plasmids or via bacterial or viral vectors; shRNA uses these vectors and utilizes the U6 promoter to ensure that the shRNA is always expressed.[87-89]

Various therapies using RNAi through intravitreal injection are currently undergoing clinical trials. Intravitreal injection must be administered repetitively for a long period of time to maintain sufficient drug concentrations to ensure the therapeutic range and efficient long-term gene expression or pharmacodynamic action in the eye, which sometimes causes certain ocular complications such as retinal detachment and vitreous hemorrhage.[90] Thus, drug delivery systems must be developed to facilitate therapeutic efficacy and to minimize side effects (Table 4).[91]

shRNA-Loaded PLGA NPs

Zhang et al. reported the intravitreal administration of hypoxia-inducible factor 1α (HIF-1α) shRNA and GFP coexpressing pDNA-loaded (pshHIF-1α NPs) PLGA NPs as a gene vector for functional pDNA in order to investigate its inhibitory efficiency on experimental choroidal neovascularization (CNV). pDNA-loaded PLGA NPs were prepared using water in the oil-in-water method with a mean size of 303.7 nm and −8.9 zeta potential, providing 60.2% encapsulation efficiency and 1.06% drug loading capacity. The in vitro release behavior of pDNA-loaded (pshHIF-1α) NPs showed that about 77% of total encapsulated pDNA was released within 10 days followed by a continuous and sustained release for 4 weeks. CNV was induced by laser photocoagulation in 112 rats. The rats were separated into groups and intravitreally injected with phosphate-buffered saline (PBS), blank NPs, control pDNA NPs, naked pDNA, and pshHIF-1α NPs. The results indicated that the expression of GFP preferentially occurred in the retinal pigment epithelium cell layer and lasted for 4 weeks. The fluorescein leakage areas of CNV were considerably larger in the noninjected PBS, blank NPs, naked pDNA, and control pDNA NPs groups compared with the pshHIF-1α NPs group. Mean thickness of the CNV lesions in the intravitreally pshHIF-1α NPs-treated group was significantly smaller than that in other groups. No signs of functional or ultrastructural destruction in retina were detected. Thus, pshHIF-1α PLGA NPs possibly will act as a novel therapeutic route of transferring specific pDNA and inhibiting the formation of experimental CNV.[92]

pSEC-shRNA-VEGF-A plasmid-loaded PLGA NPs prepared using the double emulsion-solvent evaporation method were able to regress corneal neovascularization in a more sustained and vigorous manner than naked plasmids alone, making them a good in vivo nonviral gene therapy tool for sustainable, nonimmunogenic, and efficient regression of murine corneal neovascularization.[93] Androgen receptor (AR) has been shown to play a critical role in the progression of PCa. AR-shRNA construct-loaded and PSMA A10 aptamer-conjugated PLGA NPs mostly improved cellular uptake of NPs in both cell culture and xenograft-based models, and considerably enhanced xenograft tumor regression compared with nonconjugated NPs in various PCa (22RV1, LAPC-4, and LNCaP) cell lines. The tissue-specific delivery of AR shRNA using a PLGA NPs approach indicated an effective therapy for PCas.[94]

shRNA-Loaded Chitosan NPs

The VEGF was found to be a key driving force and regulator in tumor-associated angiogenesis and tumor development in HCC and many other cancers.[97] RNAi-based therapeutics have been shown to block this angiogenesis stimulator.[98] Because of low cellular uptake and poor stability of small RNAs, clinically suitable, safe, and effective delivery systems are required for RNAi-based therapeutics.[99] Low-molecular-weight chitosan-shRNA (LMWC-shRNA) nanocomplexes directed against VEGF considerably inhibited VEGF expression of HCC cells and liver tumor tissues. Intravenous injection of LMWC-shRNA nanocomplexes displayed greater and prolonged deposition of shRNA at the tumor site in orthotopic allograft liver tumor-bearing mice. These LMWC-shRNA nanocomplexes demonstrated more effective suppression of tumor angiogenesis and tumor growth in various HCC models in comparison with naked shRNA, and showed the possibility of using LMWC as a promising carrier for RNAi drugs in liver cancer therapy.[95]

shRNA-Loaded Poly-β-Amine Ester NPs

EGFP-shRNA-loaded poly-β-amine ester NPs (shRNA-PAE NPs) showed efficient cellular uptake and EGFP silencing in U-87 MG and HEK-293 cells. Intravenously injected shRNA-PAE NPs in U-87 MG-GFP tumor-bearing mice demonstrated high accumulation of NPs in tumor, with a high silencing efficacy of intratumoral EGFP expression. The relationship between RNAi efficiency, cytotoxicity, and PAE polymer structure indicated that presence of disulfide bonds and nitrogen atoms in the PAE NPs' backbone demonstrated the remarkable influence on in vitro and in vivo cytotoxicity and gene silencing efficiency.[96]

ADVANTAGES OF NPs PREPARED FROM PLGA AND PLGA-PEG POLYMERS COMPARED WITH OTHER POLYMERS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. PREPARATION AND CHARACTERIZATION OF POLYMER NPs
  5. POLYMER NPs FOR DRUG DELIVERY
  6. POLYMER NPs FOR DRUG LOADING AND DELIVERY
  7. POLYMER NPs FOR SMALL SILENCING RNA DELIVERY IN CANCER THERAPY
  8. POLYMER NPs FOR miRNA DELIVERY
  9. POLYMER NPs FOR ANTISENSE miRNA (ANTAGOMIR) DELIVERY
  10. POLYMER NPs FOR siRNA DELIVERY
  11. POLYMER NPs FOR shRNA DELIVERY
  12. ADVANTAGES OF NPs PREPARED FROM PLGA AND PLGA-PEG POLYMERS COMPARED WITH OTHER POLYMERS
  13. ADVANTAGES AND DISADVANTAGES ASSOCIATED WITH THE USE OF POLYMER NPs FOR DRUG DELIVERY
  14. CONCLUSION
  15. ACKNOWLEDGMENTS
  16. REFERENCES

PLGA NPs

PLGA is a FDA-approved biodegradable and biocompatible polymer. Because of its low systemic toxicity, PLGA has been found to be one of the best polymers for drug delivery systems. It undergoes rapid hydrolysis in the body and forms biodegradable monomers, the lactic acid and glycolic acid, which are easily metabolized by the body without showing any toxic or immunomodulatory effects[7, 55] (Figure 6). In general, most chemotherapeutic drugs are cytotoxic and cytolytic, which not only kill cancer cells but also damage the healthy tissues in the body. The toxicity and adverse effects of chemotherapeutic drugs to healthy tissues restrict the amount of drug that can be used in order to achieve maximum therapeutic efficiency.[7] To avoid toxicity to healthy tissues and adverse effects to various organs, and to ensure specific delivery to cancer cells, numerous PLGA-based NPs that encapsulate chemotherapeutic drugs have been developed for the targeted delivery for the treatment of different cancers.[100, 101]

image

Figure 6. Poly(lactide-co-glycolide) (PLGA) hydrolysis in the body into biodegradable lactic and glycolic acid.

Download figure to PowerPoint

PEGylated PLGA NPs

PLGA polymers are hydrophobic in nature and this has caused some limitations for their formulation and drug delivery. To improve their hydrophilicity, PEG has been bonded into the PLGA polymers. PEGylation has been shown to increase the encapsulation of drugs and improve their circulation time in animals, as well as increase their bioavailability. PEG is a well-established water-soluble, nontoxic, and biocompatible polymer. Hydrophilic PEG protects NPs from the immune surveillance. Block copolymers consisting of hydrophobic PLGA and hydrophilic PEG units have attracted much attention as NP preparations for various drug delivery, as they offer a site for several additional new modifications that can create the NPs targeted with specific ligands.[16-24, 54]

ADVANTAGES AND DISADVANTAGES ASSOCIATED WITH THE USE OF POLYMER NPs FOR DRUG DELIVERY

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. PREPARATION AND CHARACTERIZATION OF POLYMER NPs
  5. POLYMER NPs FOR DRUG DELIVERY
  6. POLYMER NPs FOR DRUG LOADING AND DELIVERY
  7. POLYMER NPs FOR SMALL SILENCING RNA DELIVERY IN CANCER THERAPY
  8. POLYMER NPs FOR miRNA DELIVERY
  9. POLYMER NPs FOR ANTISENSE miRNA (ANTAGOMIR) DELIVERY
  10. POLYMER NPs FOR siRNA DELIVERY
  11. POLYMER NPs FOR shRNA DELIVERY
  12. ADVANTAGES OF NPs PREPARED FROM PLGA AND PLGA-PEG POLYMERS COMPARED WITH OTHER POLYMERS
  13. ADVANTAGES AND DISADVANTAGES ASSOCIATED WITH THE USE OF POLYMER NPs FOR DRUG DELIVERY
  14. CONCLUSION
  15. ACKNOWLEDGMENTS
  16. REFERENCES

Nanobiotechnology allows the delivery of drugs through nanoformulations and provides desired release kinetics for prolonged periods of time. Polymer NPs are biodegradable and surface modifiable. These biodegradable polymer NPs protect and deliver the drugs and RNAs, with a subsequent degradation of polymer matrix over a period of time, and have the capability to deliver multiple drugs in one carrier. Polymer NPs can both passively and actively target the tumor cells. Drugs and RNAs delivered through polymer NPs can increase the effectiveness of drug when compared with direct delivery. It can also decrease the side effects by using the tumor-specific targeting, producing the enhanced permeability and retention (EPR) effect.[102, 103] Major limitation of delivery of free chemotherapeutic drugs into tumor is their lack of tumor selectivity owing to the leaky blood vessels and poor lymphatic drainage of most tumors, which allow the free drug to clear much faster from the tumor site without impacting any antitumor effect. Thus, free drugs may diffuse nonspecifically, whereas polymer NPs tend to gather in tumor tissue much more than they do in normal tissues through passive targeting owing to the EPR effect[4, 104] (Figure 7). In addition, PEGylation of polymer NPs also increases the circulation time of NPs in blood and passively enhances its concentration in the tumor site by EPR effect.[105, 106] Polymer NPs containing targeted ligands can actively target the tumors through specific ligand–receptor interactions. The efficiency by which targeted NPs selectively accumulate in the tumor site mainly depends on a variety of factors, which include (1) selective overexpression of the receptor in the tumor cells in comparison to normal nontarget cells and (2) receptors accessibility for the ligands.[105, 106] PLGA-PEG NPs conjugated to A10 aptamer ligand have been shown to efficiently identify PSMA specifically expressed in the cancer cell surface.[107] Although important progresses have been made to target the tumors, still considerable and effective developments are required to reach the targeted drug delivery selectively to solid tumors.

image

Figure 7. Polymer nanoparticles can deliver drugs to tumors through passive tissue targeting [enhanced permeability and retention (EPR) effect], which is achieved by extravasation of nanoparticles via enhanced penetrability of the tumor vasculature and ineffective lymphatic drainage. (Reprinted with permission from Ref [4]. Copyright 2007 Nature Publishing Group and from Ref [104]. Copyright 2011 Elsevier Ltd)

Download figure to PowerPoint

NPs display unique properties because of their small size and large relative surface area and can be seen using electron microscope. Engineered polymer NPs are considered to be safe, nontoxic, nonmutagenic, noncarcinogenic, nonimmunogenic, relatively easier to synthesize, and surface modifiable. However, safety and toxic effects of these polymer NPs are not completely resolved and which raises some concerns. Nanotoxicology is gaining increased attention to study the safety evaluation of nanomaterials that are planned for use in various biomedical applications.[108, 109] Semete et al. reported that PLGA polymer NPs have not shown any toxic effects compared with industrial zinc oxide NPs in vitro and in vivo in balb/C mice. Surface modification of NPs is needed to avoid particle accumulation in the liver.[110] PTX-loaded PEO-modified poly(β-amino ester) (PEO–PbAE) NPs showed enhanced efficacy and significantly low toxicity profile when compared with the free PTX in human ovarian adenocarcinoma (SKOV-3) xenograft.[111] PLGA NPs coated with chitosan, poloxamer, and polyvinyl alcohol displayed complete internalization of NPs in Calu-3 cells and induced low toxicity even at high concentrations, independently of their surface chemistry and charge. These NPs also do not stimulate the release of interleukin (IL)-6, tumor necrosis factor α, and IL-8, endorsing the absence of inflammatory immune activation potential. These results also indicate the safety of biodegradable PLGA NPs on the bronchial epithelium (Calu-3) cells.[112]

The significant advantage of the biodegradable polymer NP as drug delivery systems is that there is no post-treatment clearance required to remove the polymer NP waste after the drug administration period, owing to the degradation of the polymer. Biodegradable polymer NPs are encouraging alternatives to conventional cancer treatments by capping the drug material inside the NPs and hiding the drug from the immune system. However, probability of enzymatic degradation owing to biophysical resemblance and evaluation of its cytotoxicity requires further investigation.[113]

CONCLUSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. PREPARATION AND CHARACTERIZATION OF POLYMER NPs
  5. POLYMER NPs FOR DRUG DELIVERY
  6. POLYMER NPs FOR DRUG LOADING AND DELIVERY
  7. POLYMER NPs FOR SMALL SILENCING RNA DELIVERY IN CANCER THERAPY
  8. POLYMER NPs FOR miRNA DELIVERY
  9. POLYMER NPs FOR ANTISENSE miRNA (ANTAGOMIR) DELIVERY
  10. POLYMER NPs FOR siRNA DELIVERY
  11. POLYMER NPs FOR shRNA DELIVERY
  12. ADVANTAGES OF NPs PREPARED FROM PLGA AND PLGA-PEG POLYMERS COMPARED WITH OTHER POLYMERS
  13. ADVANTAGES AND DISADVANTAGES ASSOCIATED WITH THE USE OF POLYMER NPs FOR DRUG DELIVERY
  14. CONCLUSION
  15. ACKNOWLEDGMENTS
  16. REFERENCES

Cancer is a major disease worldwide; however, most of the current cancer drugs are toxic to the healthy tissues of human body. Polymer NPs have been found to be promising carriers for numerous drugs and small silencing RNAs. Drug delivery using biodegradable polymer NPs possesses numerous advantages over other delivery systems. Polymer NP formulation encapsulates hydrophobic or hydrophilic drugs, proteins, and nucleic acids. Polymeric NPs protect drugs and genes from degradation and increase their stability and controlled manner release for sustained period of time. The flexible design strategy of these polymer NPs allowed the development of targeted, site-specific, and multifunctional NPs for drug delivery and molecular imaging for cancer therapy. However, safe, target-specific, and controlled drug delivery nanocarriers will require further development for more effective cancer therapy.

REFERENCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. PREPARATION AND CHARACTERIZATION OF POLYMER NPs
  5. POLYMER NPs FOR DRUG DELIVERY
  6. POLYMER NPs FOR DRUG LOADING AND DELIVERY
  7. POLYMER NPs FOR SMALL SILENCING RNA DELIVERY IN CANCER THERAPY
  8. POLYMER NPs FOR miRNA DELIVERY
  9. POLYMER NPs FOR ANTISENSE miRNA (ANTAGOMIR) DELIVERY
  10. POLYMER NPs FOR siRNA DELIVERY
  11. POLYMER NPs FOR shRNA DELIVERY
  12. ADVANTAGES OF NPs PREPARED FROM PLGA AND PLGA-PEG POLYMERS COMPARED WITH OTHER POLYMERS
  13. ADVANTAGES AND DISADVANTAGES ASSOCIATED WITH THE USE OF POLYMER NPs FOR DRUG DELIVERY
  14. CONCLUSION
  15. ACKNOWLEDGMENTS
  16. REFERENCES
  • 1
    Stewart BW, Kleihues P. World Cancer Report 2003. Geneva: World Health Organization Press.
  • 2
    Boyle P, Levin B. World Cancer Report 2008. Geneva: World Health Organization Press.
  • 3
    Cancer Facts & Figures 2013. Atlanta, GA: American Cancer Society; 2013.
  • 4
    Peer D, Karp JM, Hong S, Farokhzad OC, Margalit R, Langer R. Nanocarriers as an emerging platform for cancer therapy. Nat Nanotechnol 2007, 2:751760.
  • 5
    Haley B, Frenkel E. Nanoparticles for drug delivery in cancer treatment. Urol Oncol 2008, 26:5764.
  • 6
    Hans ML, Lowman AM. Biodegradable nanoparticles for drug delivery and targeting. Curr Opin Solid State Mater Sci 2002, 6:319327.
  • 7
    Kumari A, Yadav SK, Yadav SC. Biodegradable polymeric nanoparticles based drug delivery systems. Colloids Surf B Biointerfaces 2010, 75:118.
  • 8
    Mahapatro A, Singh DK. Biodegradable nanoparticles are excellent vehicle for site directed in-vivo delivery of drugs and vaccines. J Nanobiotechnol 2011, 9:55.
  • 9
    Soppimath KS, Aminabhavi TM, Kulkarni AR, Rudzinski WE. Biodegradable polymeric nanoparticles as drug delivery devices. J Control Release 2001, 70:120.
  • 10
    Rao JP, Geckeler KE. Polymer nanoparticles: preparation techniques and size-control parameters. Prog Polym Sci 2011, 36:887913.
  • 11
    McNeil SE. Characterization of nanoparticles intended for drug delivery. Methods Mol Biol 2011, 697:269.
  • 12
    Averineni RK, Shavi GV, Gurram AK, Deshpande PB, Arumugam K, Maliyakkal N, Meka SR, Nayanabhirama U. PLGA 50:50 nanoparticles of paclitaxel: development, in vitro anti-tumor activity in BT-549 cells and in vivo evaluation. Bull Mater Sci 2012, 35:319326.
  • 13
    Chan JM, Valencia PM, Zhang L, Langer R, Farokhzad OC. Polymeric nanoparticles for drug delivery. Methods Mol Biol 2010, 624:163175.
  • 14
    Chen KJ, Tang L, Garcia MA, Wang H, Lu H, Lin WY, Hou S, Yin Q, Shen CK, Cheng J, et al. The therapeutic efficacy of camptothecin-encapsulated supramolecular nanoparticles. Biomaterials 2012, 33:11621169.
  • 15
    Liu Y, Zhang N. Gadolinium loaded nanoparticles in theranostic magnetic resonance imaging. Biomaterials 2012, 33:53635375.
  • 16
    Danhier F, Lecouturier N, Vroman B, Jerome C, Marchand-Brynaert J, Feron O, Preat V. Paclitaxel-loaded PEGylated PLGA-based nanoparticles: in vitro and in vivo evaluation. J Control Release 2009, 133:1117.
  • 17
    Cheng J, Teply BA, Sherifi I, Sung J, Luther G, Gu FX, Levy-Nissenbaum E, Radovic-Moreno AF, Langer R, Farokhzad OC. Formulation of functionalized PLGA-PEG nanoparticles for in vivo targeted drug delivery. Biomaterials 2007, 28:869876.
  • 18
    Farokhzad OC, Cheng J, Teply BA, Sherifi I, Jon S, Kantoff PW, Richie JP, Langer R. Targeted nanoparticle-aptamer bioconjugates for cancer chemotherapy in vivo. Proc Natl Acad Sci U S A 2006, 103:63156320.
  • 19
    Hrkach J, Von Hoff D, Mukkaram Ali M, Andrianova E, Auer J, Campbell T, De Witt D, Figa M, Figueiredo M, Horhota A, et al. Preclinical development and clinical translation of a PSMA-targeted docetaxel nanoparticle with a differentiated pharmacological profile. Sci Transl Med 2012, 4:128ra139.
  • 20
    Gryparis EC, Hatziapostolou M, Papadimitriou E, Avgoustakis K. Anticancer activity of cisplatin-loaded PLGA-mPEG nanoparticles on LNCaP prostate cancer cells. Eur J Pharm Biopharm 2007, 67:18.
  • 21
    Cheng L, Jin C, Lv W, Ding Q, Han X. Developing a highly stable PLGA-mPEG nanoparticle loaded with cisplatin for chemotherapy of ovarian cancer. PLoS One 2011, 6:e25433.
  • 22
    Dhar S, Gu FX, Langer R, Farokhzad OC, Lippard SJ. Targeted delivery of cisplatin to prostate cancer cells by aptamer functionalized Pt(IV) prodrug-PLGA-PEG nanoparticles. Proc Natl Acad Sci U S A 2008, 105:1735617361.
  • 23
    Dhar S, Kolishetti N, Lippard SJ, Farokhzad OC. Targeted delivery of a cisplatin prodrug for safer and more effective prostate cancer therapy in vivo. Proc Natl Acad Sci U S A 2011, 108:18501855.
  • 24
    Graf N, Bielenberg DR, Kolishetti N, Muus C, Banyard J, Farokhzad OC, Lippard SJ. α(V)β(3) integrin-targeted PLGA-PEG nanoparticles for enhanced anti-tumor efficacy of a Pt(IV) prodrug. ACS Nano 2012, 6:45304539.
  • 25
    Moreno D, Zalba S, Navarro I, Tros de Ilarduya C, Garrido MJ. Pharmacodynamics of cisplatin-loaded PLGA nanoparticles administered to tumor-bearing mice. Eur J Pharm Biopharm 2010, 74:265274.
  • 26
    Moreno D, de Ilarduya CT, Bandres E, Bunuales M, Azcona M, Garcia-Foncillas J, Garrido MJ. Characterization of cisplatin cytotoxicity delivered from PLGA-systems. Eur J Pharm Biopharm 2008, 68:503512.
  • 27
    Nair KL, Jagadeeshan S, Nair SA, Kumar GS. Biological evaluation of 5-fluorouracil nanoparticles for cancer chemotherapy and its dependence on the carrier, PLGA. Int J Nanomed 2011, 6:16851697.
  • 28
    Cheng MR, Li Q, Wan T, He B, Han J, Chen HX, Yang FX, Wang W, Xu HZ, Ye T, et al. Galactosylated chitosan/5-fluorouracil nanoparticles inhibit mouse hepatic cancer growth and its side effects. World J Gastroenterol 2012, 18:60766087.
  • 29
    Cheng M, He B, Wan T, Zhu W, Han J, Zha B, Chen H, Yang F, Li Q, Wang W, et al. 5-Fluorouracil nanoparticles inhibit hepatocellular carcinoma via activation of the p53 pathway in the orthotopic transplant mouse model. PLoS One 2012, 7:e47115.
  • 30
    Yadav AK, Agarwal A, Rai G, Mishra P, Jain S, Mishra AK, Agrawal H, Agrawal GP. Development and characterization of hyaluronic acid decorated PLGA nanoparticles for delivery of 5-fluorouracil. Drug Deliv 2010, 17:561572.
  • 31
    Li S, Wang A, Jiang W, Guan Z. Pharmacokinetic characteristics and anticancer effects of 5-fluorouracil loaded nanoparticles. BMC Cancer 2008, 8:103.
  • 32
    Betancourt T, Brown B, Brannon-Peppas L. Doxorubicin-loaded PLGA nanoparticles by nanoprecipitation: preparation, characterization and in vitro evaluation. Nanomedicine 2007, 2:219232.
  • 33
    Chang L, Deng L, Wang W, Lv Z, Hu F, Dong A, Zhang J. Poly(ethyleneglycol)-b-poly(ε-caprolactone-co-γ-hydroxyl-ε-caprolactone) bearing pendant hydroxyl groups as nanocarriers for doxorubicin delivery. Biomacromolecules 2012, 13:33013310.
  • 34
    Wohlfart S, Khalansky AS, Gelperina S, Maksimenko O, Bernreuther C, Glatzel M, Kreuter J. Efficient chemotherapy of rat glioblastoma using doxorubicin-loaded PLGA nanoparticles with different stabilizers. PLoS One 2011, 6:e19121.
  • 35
    Chittasupho C, Xie SX, Baoum A, Yakovleva T, Siahaan TJ, Berkland CJ. ICAM-1 targeting of doxorubicin-loaded PLGA nanoparticles to lung epithelial cells. Eur J Pharm Sci 2009, 37:141150.
  • 36
    Park H, Yang J, Lee J, Haam S, Choi IH, Yoo KH. Multifunctional nanoparticles for combined doxorubicin and photothermal treatments. ACS Nano 2009, 3:29192926.
  • 37
    Amjadi I, Rabiee M, Hosseini MS, Mozafari M. Synthesis and characterization of doxorubicin-loaded poly(lactide-co-glycolide) nanoparticles as a sustained-release anticancer drug delivery system. Appl Biochem Biotechnol 2012, 168:14341447.
  • 38
    Liu CW, Lin WJ. Polymeric nanoparticles conjugate a novel heptapeptide as an epidermal growth factor receptor-active targeting ligand for doxorubicin. Int J Nanomed 2012, 7:47494767.
  • 39
    Perez E, Benito M, Teijon C, Olmo R, Teijon JM, Blanco MD. Tamoxifen-loaded nanoparticles based on a novel mixture of biodegradable polyesters: characterization and in vitro evaluation as sustained release systems. J Microencapsul 2012, 29:309322.
  • 40
    Cavalli R, Bisazza A, Bussano R, Trotta M, Civra A, Lembo D, Ranucci E, Ferruti P. Poly(amidoamine)-cholesterol conjugate nanoparticles obtained by electrospraying as novel tamoxifen delivery system. J Drug Deliv 2011, 2011:587604.
  • 41
    Jain AK, Swarnakar NK, Godugu C, Singh RP, Jain S. The effect of the oral administration of polymeric nanoparticles on the efficacy and toxicity of tamoxifen. Biomaterials 2011, 32:503515.
  • 42
    Renoir JM, Stella B, Ameller T, Connault E, Opolon P, Marsaud V. Improved anti-tumoral capacity of mixed and pure anti-oestrogens in breast cancer cell xenografts after their administration by entrapment in colloidal nanosystems. J Steroid Biochem Mol Biol 2006, 102:114127.
  • 43
    Devalapally H, Duan Z, Seiden MV, Amiji MM. Modulation of drug resistance in ovarian adenocarcinoma by enhancing intracellular ceramide using tamoxifen-loaded biodegradable polymeric nanoparticles. Clin Cancer Res 2008, 14:31933203.
  • 44
    Arya G, Vandana M, Acharya S, Sahoo SK. Enhanced antiproliferative activity of Herceptin (HER2)-conjugated gemcitabine-loaded chitosan nanoparticle in pancreatic cancer therapy. Nanomed Nanotechnol Biol Med 2011, 7:859870.
  • 45
    Arias JL, Reddy LH, Couvreur P. Superior preclinical efficacy of gemcitabine developed as chitosan nanoparticulate system. Biomacromolecules 2011, 12:97104.
  • 46
    Aggarwal S, Yadav S, Gupta S. EGFR targeted PLGA nanoparticles using gemcitabine for treatment of pancreatic cancer. J Biomed Nanotechnol 2011, 7:137138.
  • 47
    Papa AL, Basu S, Sengupta P, Banerjee D, Sengupta S, Harfouche R. Mechanistic studies of Gemcitabine-loaded nanoplatforms in resistant pancreatic cancer cells. BMC Cancer 2012, 12:419.
  • 48
    Jia L, Zheng JJ, Jiang SM, Huang KH. Preparation, physicochemical characterization and cytotoxicity in vitro of gemcitabine-loaded PEG-PDLLA nanovesicles. World J Gastroenterol 2010, 16:10081013.
  • 49
    Hou Z, Zhan C, Jiang Q, Hu Q, Li L, Chang D, Yang X, Wang Y, Li Y, Ye S, et al. Both FA- and mPEG-conjugated chitosan nanoparticles for targeted cellular uptake and enhanced tumor tissue distribution. Nanoscale Res Lett 2011, 6:563.
  • 50
    Yordanov G, Skrobanska R, Evangelatov A. Entrapment of epirubicin in poly(butyl cyanoacrylate) colloidal nanospheres by nanoprecipitation: formulation development and in vitro studies on cancer cell lines. Colloids Surf B Biointerfaces 2012, 92:98105.
  • 51
    Zhang HZ, Li XM, Gao FP, Liu LR, Zhou ZM, Zhang QQ. Preparation of folate-modified pullulan acetate nanoparticles for tumor-targeted drug delivery. Drug Deliv 2010, 17:4857.
  • 52
    Yallapu MM, Dobberpuhl MR, Maher DM, Jaggi M, Chauhan SC. Design of curcumin loaded cellulose nanoparticles for prostate cancer. Curr Drug Metab 2012, 13:120128.
  • 53
    Mukerjee A, Vishwanatha JK. Formulation, characterization and evaluation of curcumin-loaded PLGA nanospheres for cancer therapy. Anticancer Res 2009, 29:38673875.
  • 54
    Gryparis EC, Mattheolabakis G, Bikiaris D, Avgoustakis K. Effect of conditions of preparation on the size and encapsulation properties of PLGA-mPEG nanoparticles of cisplatin. Drug Deliv 2007, 14:371380.
  • 55
    Danhier F, Ansorena E, Silva JM, Coco R, Le Breton A, Preat V. PLGA-based nanoparticles: an overview of biomedical applications. J Control Release 2012, 161:505522.
  • 56
    Wolf DM, Langan-Fahey SM, Parker CJ, McCague R, Jordan VC. Investigation of the mechanism of tamoxifen-stimulated breast tumor growth with nonisomerizable analogues of tamoxifen and metabolites. J Natl Cancer Inst 1993, 85:806812.
  • 57
    Erdogar N, Iskit AB, Mungan NA, Bilensoy E. Prolonged retention and in vivo evaluation of cationic nanoparticles loaded with Mitomycin C designed for intravesical chemotherapy of bladder tumours. J Microencapsul 2012, 29:576582.
  • 58
    Erdogar N, Mungan A, Bilensoy E. Preparation and characterization of cationic nanoparticles loaded with Mitomycin C by double emulsion and ionotropic gelation techniques. J Control Release 2010, 148:e78e79.
  • 59
    Khalil NM, do Nascimento TC, Casa DM, Dalmolin LF, de Mattos AC, Hoss I, Romano MA, Mainardes RM. Pharmacokinetics of curcumin-loaded PLGA and PLGA-PEG blend nanoparticles after oral administration in rats. Colloids Surf B Biointerfaces 2013, 101:353360.
  • 60
    Ghildiyal M, Zamore PD. Small silencing RNAs: an expanding universe. Nat Rev Genet 2009, 10:94108.
  • 61
    Tokatlian T, Segura T. siRNA applications in nanomedicine. Wiley Interdiscip Rev Nanomed Nanobiotechnol 2010, 2:305315.
  • 62
    Ozpolat B, Sood AK, Lopez-Berestein G. Nanomedicine based approaches for the delivery of siRNA in cancer. J Intern Med 2010, 267:4453.
  • 63
    Bartel DP. MicroRNAs: target recognition and regulatory functions. Cell 2009, 136:215233.
  • 64
    Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 2004, 116:281297.
  • 65
    Bhardwaj A, Singh S, Singh AP. MicroRNA-based cancer therapeutics: big hope from small RNAs. Mol Cell Pharmacol 2010, 2:213219.
  • 66
    Cimmino A, Calin GA, Fabbri M, Iorio MV, Ferracin M, Shimizu M, Wojcik SE, Aqeilan RI, Zupo S, Dono M, et al. miR-15 and miR-16 induce apoptosis by targeting BCL2. Proc Natl Acad Sci U S A 2005, 102:1394413949.
  • 67
    Hammond SM. MicroRNAs as oncogenes. Curr Opin Genet Dev 2006, 16:49.
  • 68
    Hamilton AJ, Baulcombe DC. A species of small antisense RNA in posttranscriptional gene silencing in plants. Science 1999, 286:950952.
  • 69
    Elbashir SM, Harborth J, Lendeckel W, Yalcin A, Weber K, Tuschl T. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 2001, 411:494498.
  • 70
    Hammond SM, Bernstein E, Beach D, Hannon GJ. An RNA-directed nuclease mediates post-transcriptional gene silencing in Drosophila cells. Nature 2000, 404:293296.
  • 71
    Fire A, Xu S, Montgomery MK, Kostas SA, Driver SE, Mello CC. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 1998, 391:806811.
  • 72
    Babar IA, Cheng CJ, Booth CJ, Liang X, Weidhaas JB, Saltzman WM, Slack FJ. Nanoparticle-based therapy in an in vivo microRNA-155 (miR-155)-dependent mouse model of lymphoma. Proc Natl Acad Sci U S A 2012, 109:E1695E1704.
  • 73
    Jin H, Yu Y, Chrisler WB, Xiong Y, Hu D, Lei C. Delivery of microRNA-10b with polylysine nanoparticles for inhibition of breast cancer cell wound healing. Breast Cancer 2012, 6:919.
  • 74
    Ren Y, Kang CS, Yuan XB, Zhou X, Xu P, Han L, Wang GX, Jia Z, Zhong Y, Yu S, et al. Co-delivery of as-miR-21 and 5-FU by poly(amidoamine) dendrimer attenuates human glioma cell growth in vitro. J Biomater Sci Polym Ed 2010, 21:303314.
  • 75
    Liang GF, Zhu YL, Sun B, Hu FH, Tian T, Li SC, Xiao ZD. PLGA-based gene delivering nanoparticle enhance suppression effect of miRNA in HePG2 cells. Nanoscale Res Lett 2011, 6:447.
  • 76
    Cheng CJ, Saltzman WM. Polymer nanoparticle-mediated delivery of microRNA inhibition and alternative splicing. Mol Pharm 2012, 9:14811488.
  • 77
    Liu XQ, Song WJ, Sun TM, Zhang PZ, Wang J. Targeted delivery of antisense inhibitor of miRNA for antiangiogenesis therapy using cRGD-functionalized nanoparticles. Mol Pharm 2011, 8:250259.
  • 78
    Krutzfeldt J, Rajewsky N, Braich R, Rajeev KG, Tuschl T, Manoharan M, Stoffel M. Silencing of microRNAs in vivo with 'antagomirs'. Nature 2005, 438:685689.
  • 79
    Baigude H, Rana TM. Interfering nanoparticles for silencing microRNAs. Methods Enzymol 2012, 509:339353.
  • 80
    Mattes J, Yang M, Foster PS. Regulation of microRNA by antagomirs: a new class of pharmacological antagonists for the specific regulation of gene function? Am J Respir Cell Mol Biol 2007, 36:812.
  • 81
    Woodrow KA, Cu Y, Booth CJ, Saucier-Sawyer JK, Wood MJ, Saltzman WM. Intravaginal gene silencing using biodegradable polymer nanoparticles densely loaded with small-interfering RNA. Nat Mater 2009, 8:526533.
  • 82
    Zeng P, Xu Y, Zeng C, Ren H, Peng M. Chitosan-modified poly(D,L-lactide-co-glycolide) nanospheres for plasmid DNA delivery and HBV gene-silencing. Int J Pharm 2011, 415:259266.
  • 83
    Du J, Shi QS, Sun Y, Liu PF, Zhu MJ, Du LF, Duan YR. Enhanced delivery of monomethoxypoly(ethylene glycol)-poly(lactic-co-glycolic acid)-poly l-lysine nanoparticles loading platelet-derived growth factor BB small interfering RNA by ultrasound and/or microbubbles to rat retinal pigment epithelium cells. J Gene Med 2011, 13:312323.
  • 84
    Du J, Sun Y, Shi QS, Liu PF, Zhu MJ, Wang CH, Du LF, Duan YR. Biodegradable nanoparticles of mPEG-PLGA-PLL triblock copolymers as novel non-viral vectors for improving siRNA delivery and gene silencing. Int J Mol Sci 2012, 13:516533.
  • 85
    Li YH, Shi QS, Du J, Jin LF, Du LF, Liu PF, Duan YR. Targeted delivery of biodegradable nanoparticles with ultrasound-targeted microbubble destruction-mediated hVEGF-siRNA transfection in human PC-3 cells in vitro. Int J Mol Med 2013, 31:163171.
  • 86
    Lu ZX, Liu LT, Qi XR. Development of small interfering RNA delivery system using PEI-PEG-APRPG polymer for antiangiogenic vascular endothelial growth factor tumor-targeted therapy. Int J Nanomed 2011, 6:16611673.
  • 87
    Dragomira Nikolova DT. RNA interference—regulations and application in oncology. J Cancer Mol 2008, 4:6777.
  • 88
    Rao DD, Vorhies JS, Senzer N, Nemunaitis J. siRNA vs. shRNA: similarities and differences. Adv Drug Deliv Rev 2009, 61:746759.
  • 89
    Paddison PJ, Caudy AA, Bernstein E, Hannon GJ, Conklin DS. Short hairpin RNAs (shRNAs) induce sequence-specific silencing in mammalian cells. Genes Dev 2002, 16:948958.
  • 90
    Check E. A crucial test. Nat Med 2005, 11:243244.
  • 91
    Wang SL, Yao HH, Qin ZH. Strategies for short hairpin RNA delivery in cancer gene therapy. Exp Opin Biol Ther 2009, 9:13571368.
  • 92
    Zhang C, Wang YS, Wu H, Zhang ZX, Cai Y, Hou HY, Zhao W, Yang XM, Ma JX. Inhibitory efficacy of hypoxia-inducible factor 1α short hairpin RNA plasmid DNA-loaded poly (D, L-lactide-co-glycolide) nanoparticles on choroidal neovascularization in a laser-induced rat model. Gene Ther 2010, 17:338351.
  • 93
    Qazi Y, Stagg B, Singh N, Singh S, Zhang X, Luo L, Simonis J, Kompella UB, Ambati BK. Nanoparticle-mediated delivery of shRNA.VEGF-a plasmids regresses corneal neovascularization. Invest Ophthalmol Vis Sci 2012, 53:28372844.
  • 94
    Yang J, Xie SX, Huang Y, Ling M, Liu J, Ran Y, Wang Y, Thrasher JB, Berkland C, Li B. Prostate-targeted biodegradable nanoparticles loaded with androgen receptor silencing constructs eradicate xenograft tumors in mice. Nanomedicine 2012, 7:12971309.
  • 95
    Huang Z, Dong L, Chen J, Gao F, Zhang Z, Zhang J. Low-molecular weight chitosan/vascular endothelial growth factor short hairpin RNA for the treatment of hepatocellular carcinoma. Life Sci 2012, 91:12071215.
  • 96
    Yin Q, Gao Y, Zhang Z, Zhang P, Li Y. Bioreducible poly (β-amino esters)/shRNA complex nanoparticles for efficient RNA delivery. J Control Release 2011, 151:3544.
  • 97
    Ferrara N. VEGF and the quest for tumour angiogenesis factors. Nat Rev Cancer 2002, 2:795803.
  • 98
    Kim DH, Rossi JJ. Strategies for silencing human disease using RNA interference. Nat Rev Genet 2007, 8:173184.
  • 99
    Whitehead KA, Langer R, Anderson DG. Knocking down barriers: advances in siRNA delivery. Nat Rev Drug Discov 2009, 8:129138.
  • 100
    Soman P, Kelber JA, Lee JW, Wright TN, Vecchio KS, Klemke RL, Chen S. Cancer cell migration within 3D layer-by-layer microfabricated photocrosslinked PEG scaffolds with tunable stiffness. Biomaterials 2012, 33:70647070.
  • 101
    Su WP, Cheng FY, Shieh DB, Yeh CS, Su WC. PLGA nanoparticles codeliver paclitaxel and Stat3 siRNA to overcome cellular resistance in lung cancer cells. Int J Nanomed 2012, 7:42694283.
  • 102
    Zhang J, Lan CQ, Post M, Simard B, Deslandes Y, Hsieh TH. Design of nanoparticles as drug carriers for cancer therapy. Cancer Genom Proteom 2006, 3:147157.
  • 103
    Brewer E, Coleman J, Lowman A. Emerging technologies of polymeric nanoparticles in cancer drug delivery. J Nanomater 2011, 2011:110.
  • 104
    Acharya S, Sahoo SK. PLGA nanoparticles containing various anticancer agents and tumour delivery by EPR effect. Adv Drug Deliv Rev 2011, 63:170183.
  • 105
    Hochwald SN. Molecular-targeted therapy for cancer and nanotechnology. Methods Mol Biol 2010, 624:1123.
  • 106
    Bae YH, Park K. Targeted drug delivery to tumors: myths, reality and possibility. J Control Release 2011, 153:198205.
  • 107
    Farokhzad OC, Jon S, Khademhosseini A, Tran TN, Lavan DA, Langer R. Nanoparticle-aptamer bioconjugates: a new approach for targeting prostate cancer cells. Cancer Res 2004, 64:76687672.
  • 108
    Dusinska M, Magdolenova Z, Fjellsbo LM. Toxicological aspects for nanomaterial in humans. Methods Mol Biol 2013, 948:112.
  • 109
    Oberdorster G, Oberdorster E, Oberdorster J. Nanotoxicology: an emerging discipline evolving from studies of ultrafine particles. Environ Health Perspect 2005, 113:823839.
  • 110
    Semete B, Booysen L, Lemmer Y, Kalombo L, Katata L, Verschoor J, Swai HS. In vivo evaluation of the biodistribution and safety of PLGA nanoparticles as drug delivery systems. Nanomed Nanotechnol Biol Med 2010, 6:662671.
  • 111
    Devalapally H, Shenoy D, Little S, Langer R, Amiji M. Poly(ethylene oxide)-modified poly(β-amino ester) nanoparticles as a pH-sensitive system for tumor-targeted delivery of hydrophobic drugs: part 3. Therapeutic efficacy and safety studies in ovarian cancer xenograft model. Cancer Chemother Pharmacol 2006, 59:477484.
  • 112
    Mura S, Hillaireau H, Nicolas J, Le Droumaguet B, Gueutin C, Zanna S, Tsapis N, Fattal E. Influence of surface charge on the potential toxicity of PLGA nanoparticles towards Calu-3 cells. Int J Nanomed 2011, 6:25912605.
  • 113
    Yildirimer L, Thanh NT, Loizidou M, Seifalian AM. Toxicology and clinical potential of nanoparticles. Nano Today 2011, 6:585607.