A versatile toolbox for PCR-based tagging of yeast genes: new fluorescent proteins, more markers and promoter substitution cassettes

Authors


Abstract

Tagging of genes by chromosomal integration of PCR amplified cassettes is a widely used and fast method to label proteins in vivo in the yeast Saccharomyces cerevisiae. This strategy directs the amplified tags to the desired chromosomal loci due to flanking homologous sequences provided by the PCR-primers, thus enabling the selective introduction of any sequence at any place of a gene, e.g. for the generation of C-terminal tagged genes or for the exchange of the promoter and N-terminal tagging of a gene. To make this method most powerful we constructed a series of 76 novel cassettes, containing a broad variety of C-terminal epitope tags as well as nine different promoter substitutions in combination with N-terminal tags. Furthermore, new selection markers have been introduced. The tags include the so far brightest and most yeast-optimized version of the red fluorescent protein, called RedStar2, as well as all other commonly used fluorescent proteins and tags used for the detection and purification of proteins and protein complexes. Using the provided cassettes for N- and C-terminal gene tagging or for deletion of any given gene, a set of only four primers is required, which makes this method very cost-effective and reproducible. This new toolbox should help to speed up the analysis of gene function in yeast, on the level of single genes, as well as in systematic approaches. Copyright © 2004 John Wiley & Sons, Ltd.

Introduction

The targeted introduction of heterologous DNA to genomic locations by a simple polymerase chain reaction (PCR)-based strategy has been widely used for research, particularly with the fungi Saccharomyces cerevisiae and Schizosaccharomyces pombe (Bahler et al., 1998; Baudin et al., 1993; Knop et al., 1999; Krawchuk and Wahls, 1999; Longtine et al., 1998; Schneider et al., 1995; Tasto et al., 2001; Wach et al., 1994, 1997). These strategies have been shown to be powerful tools in systematic gene deletion, protein localization and protein complex purification (Gavin et al., 2002; Ho et al., 2002), as well as for single gene-function analysis. The strategy requires: (a) a pair of primers that contain within their 5′ region sequences of homology to the genomic target location; and (b) PCR-cassettes (also termed ‘modules’) that can be amplified using these primers. To make the technique most powerful and cost-efficient, we constructed a series of new cassettes and included in all of them identical primer-binding sites, which allow the amplification of all C-terminal tags with only one pair of primers per gene. An additional primer is needed for gene deletion (Knop et al., 1999) and a fourth primer for the introduction of sequences at the N-terminus (Figure 1).

Figure 1.

The principle of PCR-based epitope tagging. Schematic illustration of the principle of genomic manipulation of yeast strains using PCR-based strategies. The plasmid contains a cassette, which consists of a selection marker and additional sequences, which can be promoter sequences and/or sequences that encode for a tag (e.g. GFP). The S1-, S2-, S3- and S4-primers allow amplification of cassettes (A) and targeting of the respective PCR product to the desired genomic location (B), which becomes defined by the overhangs provided by the S1- S2-, S3- and S4-primers (see colour-encoded primers in the figure: the same colours indicate homologous sequences). Depending on whether a gene deletion, a C- or a N-terminal gene fusion should be performed, specific pairs of the S1- S2-, S3- or S4-primers are used to amplify the cassette. Upon transformation, an integration of the cassettes into the yeast genome occurs due to homologous recombination (C). For primer designs, see Figure 2

In addition to the previously published 12 cassettes for C-terminal epitope tags (Knop et al., 1999), we present here a wider range of C-terminal tags as well as two new selection markers, both carrying dominant antibiotic-resistance genes. We also describe new cassettes that allow the replacement of the promoter of a given gene, with the optional addition of an N-terminal epitope tag to the gene. Nine promoters, five of them inducible, were cloned into different cassette plasmids.

The construction of PCR-cassettes is straightforward and can be done via standard cloning strategies (details provided upon request). Therefore, it will be easy to create new cassettes, e.g. to introduce new combinations of tags, makers and promoters (in the case of N-terminal tagging) by simple cloning procedures.

Materials and methods

Cassette plasmid construction

Standard techniques were used for DNA manipulations (Sambrook et al., 1989). The construction of the PCR-cassette pYM1-12 is described in Knop et al. (1999). The construction of the new cassettes is summarized in Table 1; the primers used are listed in Table 2 (further details can be obtained upon request). A comprehensive overview of all available C-terminal tagging cassettes, with regard to selection marker and tag, is provided in Table 3.

Table 1. Properties and construction of the new cassette plasmids
NameUsed with primersSize of productPro-moter1TagMarkerPrimers2Template/ origin of tag or promoterTarget plasmidRestriction sites usedControl digest
  • The four rightmost columns list the primers, plasmids and restriction sites used for PCR construction of the cassettes.

  • 1

    For N-terminal tags.

  • 2

    See Table 2 for primer sequences.

  • 3

    Before subcloning of the ADH1-terminator, a XhoI site was introduced into plasmid pFA6–natMX4 using the indicated primers and the Quickchange Kit (Clonetech).

  • 4

    Gyuris et al., 1993.

  • 5

    Before subcloning of the CYC1-terminator, a XhoI site was introduced into plasmid pFA6-hphMX4 using the indicated primers and the Quickchange Kit (Clonetech).

  • 6

    Mumberg et al., 1995.

  • 7

    Goldstein and McCusker, 1999.

  • 8

    Cormack et al., 1996.

  • 9

    From Clonetech.

  • 10

    Knop et al., 2002.

  • 11

    RedStar* is identical to RedStar except that the T217A mutation is missing, which causes an increase in green fluorescence (Bevis and Glick, 2002).

  • 12

    Patterson and Lippincott-Schwartz, 2002.

  • 13

    Wiedenmann et al., 2002.

  • 14

    Mumberg et al., 1994.

  • 15

    RedStar2 has been constructed by introduction of the T4 mutations (Bevis and Glick, 2002) into RedStar.

pFA6a–natNT2S1/S2-1460 natNT2natMX4-1/natMX4-23pEG2024pFA6–natMX47,3XhoI/SacINotI 2390+1394 bp
     ADH1-1/ADH1-2    
pFA6a–hphNT1S1/S2-1840 hphNT1hphMX4-1/hphMX4-25p425-Gal16pFA6–hphMX45,7XhoI/SacINotI 2390+1777 bp
     M13-hin/CYC1-Term    
pYM13S2/S3-2330 TAPkanMX4CBP-s/CBP-asOligos annealedpYM8SalI/BamHISalI/XbaI 4568+111 bp
pYM14S2/S3-1820 6HAkanMX4pYM3/6_F/pYM3/6_RpYM3pFA6a–kanMX4SalI/BglII c/o BamHINotI 2390+1782 bp HindIII/XhoI 2955+1217 bp
pYM15S2/S3-1670 6HAHIS3MX6pYM3/6_F/pYM3/6_RpYM3pFA6a–HisMX6SalI/BglII c/o BamHINotI 2390+1626 bp
pYM16S2/S3-2050 6HAhphNT1pYM3/6_F/pYM3/6_RpYM3pKS133SalI/BglII c/o BamHINotI 2390+2011 bp
pYM17S2/S3-1670 6HAnatNT2pYM3/6_F/pYM3/6_RpYM3pKS134SalI/BglII c/o BamHINotI 2390+1628 bp HindIII/XhoI 2767+1251 bp
pYM18S2/S3-1990 9MyckanMX4pYM3/6_F/pYM3/6_RpYM6pFA6a–kanMX4SalI/BglII c/o BamHIEcoRI/SalI 2459+1881 bp
pYM19S2/S3-1830 9MycHIS3MX6pYM3/6_F/pYM3/6_RpYM6pFA6a–HISMX6SalI/BglII c/o BamHIHindIII/PvuI 3278+906 bp
pYM20S2/S3-2220 9MychphNT1pYM3/6_F/pYM3/6_RpYM6pKS133SalI/BglII c/o BamHIHindIII/XhoI 2697+1872 bp
pYM21S2/S3-1840 9MycnatNT2pYM3/6_F/pYM3/6_RpYM6pKS134SalI/BglII c/o BamHIHindIII/XhoI 2767+1419 bp
pYM22S2/S3-1310 3HAklTRP1klTRP1-1/klTRP1-2pYM3pYM1BssHII/EcoRINotI 2390+1268 bp
pYM23S2/S3-1330 3MycklTRP1klTRP1-1/klTRP1-2pYM3pYM4BssHII/EcoRIBamHI/XhoI 2479+1200 bp
pYM24S2/S3-1910 3HAhphNT1No PCRpYM1pKS133SalI/BssHIINotI 2390+1875 bp BssHII/SalI 4141+124 bp
pYM25S2/S3-2550 yeGFP8hphNT1No PCRpYM12pKS133SalI/BssHIIBamHI/XhoI 2721+2184 bp BssHII/SalI 4141+764 bp
pYM26S2/S3-1950 yeGFP8klTRP1klTRP1-1/klTRP1-2pYM3pYM12BssHII/EcoRIXhoI/XbaI 3710+588 bp
pYM27S2/S3-2550 EGFPkanMX4GFP-4/GFP-6pEGFP9pYM1SalI/BamHISalI/BamHI 4187+753 bp
pYM28S2/S3-2400 EGFPHIS3MX6GFP-4/GFP-6pEGFP9pYM2SalI/BamHISalI/BamHI 4831+753 bp
pYM29S2/S3-1950 EGFPklTRP1GFP-4/GFP-6pEGFP9pYM3SalI/BamHISalI/BamHI 3570+753 bp
pYM30S2/S3-2550 ECFPkanMX4GFP-4/GFP-6pECFP9pYM1SalI/BamHISalI/BamHI 4187+753 bp
pYM31S2/S3-2400 ECFPHIS3MX6GFP-4/GFP-6pECFP9pYM2SalI/BamHISalI/BamHI 4031+753 bp
pYM32S2/S3-1950 ECFPklTRP1GFP-4/GFP-6pECFP9pYM3SalI/BamHISalI/BamHI 3570+753 bp
pYM33S2/S3-2550 EBFPkanMX4GFP-4/GFP-6pEBFP9pYM1SalI/BamHISalI/BamHI 4187+753 bp
pYM34S2/S3-1950 EBFPklTRP1GFP-4/GFP-6pEBFP9pYM1SalI/BamHIBglII/EcoRI 3500+1446 bp
pYM35S2/S3-2520 DsRed1kanMX4Red1-1/Red1-2pDsRed1-N1pYM4BssHII/BamHISalI/StuI 4391+475 bp
pYM36S2/S3-2000 DsRed1klTRP1No PCRpSM822pSM825BssHII/BamHIHindIII/XhoI 2455+1804 bp
pYM37S2/S3-2520 DsRedkanMX4dsRED-1/dsRED-2DsRed10pFA6a–kanMX4BssHII/BamHINotI 2390+2251 bp
pYM38S2/S3-2520 RedStarkanMX4dsRED-2/dsRED-7RedStar10pFA6a–kanMX4BssHII/BamHISalI/NcoI 3521+1120 bp BssHII/SalI 3915+1186 bp
pYM39S2/S3-2600 EYFPkanMX4GFP-4/GFP-6pEYFP9pYM1SalI/BamHISalI/BamHI 4187+753 bp
pYM40S2/S3-2820 EYFPhphNT1No PCRpYM-YKpKS133SalI/BssHIISalI/XhoI 2715+2231 bp
pYM41S2/S3-2400 EYFPHIS3MX6GFP-4/GFP-6pEYFP9pYM2SalI/BamHIXbaI/PvuI 2732+2058 bp
pYM42S2/S3-2150 RedStar*11natNT2RedStar2-BamHI/RedStar2-SalIRedStar10pKS134–1SalI/BamHIBamHI/SalI 3778+717 bp
pYM43S2/S3-2150 RedStar215natNT2Site-directed mutagenesis15RedStar2pKS134–1SalI/BamHIBamHI/SalI 3778+717 bp
pYM44S2/S3-2310 yeGFP8HIS3MX6No PCRpYM5pYM12BstEII/EcoRISalI/BssHII 4141+763 bp
pYM45S2/S3-1740 1HAkanMX4HA-F1/HA-F2Oligos annealedpYM1SalI/BssHIIBglII/EcoRI 2730+1446 bp
pYM46S2/S3-1760 1Myc–7HiskanMX4MYC-7xHis-F1/MYC-7xHis-F2Oligos annealedpYM1SalI/BssHIIBglII/EcoRI 2488+1446+266 bp
pYM47S2/S3-1852 FlAsHhphNT1FlAsH-1/FlAsH-2Oligos annealedpYM–hphNT1SalI/BamHIBamHI/XhoI 2751+1446 bp
pYM48S2/S3-2569 PA–GFP12hphNT1GFP-4/GFP-6PA-GFPpYM–hphNT1SalI/BamHIBamHI/XhoI 3468+1446 bp
pYM51S2/S3-2500 eqFP61113KanMX4eqFP611-1/-2pBS-KS+eqFP61113pYM12SalI/BssHIIBamHI/XhoI 4184+704
pYM–N1S1/S4-1990CUP1-1kanMX4CUP1-A/CUP1-BYeast genomic DNAPFA6a–kanMX4SacI/EcoRINotI 2390+2031 bp
pYM–N2S1/S4-1830CUP1-1natNT2CUP1-A/CUP1-BYeast genomic DNApYM–natNT2SacI/EcoRINotI 2390+1874 bp HindIII/XhoI 3247+1017 bp
pYM–N3S1/S4-1980CUP1-13HAnatNT2HA-1%CUP/HA-2%CUPpYM1pMM40BspEI/EcoRISalI/XbaI 2848+1564 bp
pYM–N4S1/S4-2590CUP1-1yeGFP8natNT2eGFP%CUP-1/eGFP%CUP-2pYM12pMM40BspEI/EcoRISalI/XbaI 3454+1564 bp
pYM–N5S1/S4-2260CUP1-1ProAnatNT2ProA-1n/ProA-2npCW804pMM40BspEI/EcoRISalI/XbaI 3127+1564 bp
pYM–N6S1/S4-2987ADHkanMX4No PCRp413-ADH14pYM–N1SacI/SmaI c/o BspEI+KlenowSacI/EcoRI 1480 bp
pYM–N7S1/S4-2827ADHnatNT2No PCRp413-ADH14pYM–N2SacI/SmaI c/o BspEI+KlenowSacI/EcoRI 1480 bp
pYM–N8S1/S4-2977ADH3HAnatNT2No PCRp413-ADH14pYM–N3SacI/SmaI c/o BspEI+KlenowSacI/EcoRI 1628 bp
pYM–N9S1/S4-3587ADHyeGFP8natNT2No PCRp413-ADH14pYM–N4SacI/SmaI c/o BspEI+KlenowSacI/EcoRI 2234 bp
pYM–N10S1/S4-1816CYC1kanMX4No PCRp413-CYC114pYM–N1SacI/SmaI c/o BspEI+KlenowSacI/EcoRI 309 bp
pYM–N11S1/S4-1656CYC1natNT2No PCRp413-CYC114pYM–N2SacI/SmaI c/o BspEI+KlenowSacI/EcoRI 309 bp
pYM–N12S1/S4-1806CYC13HAnatNT2No PCRp413-CYC114pYM–N3SacI/SmaI c/o BspEI+KlenowSacI/EcoRI 457 bp
pYM–N13S1/S4-2416CYC1yeGFP8natNT2No PCRp413-CYC114pYM–N4SacI/SmaI c/o BspEI+KlenowSacI/EcoRI 1063 bp
pYM–N14S1/S4-2143GPDkanMX4No PCRp413-GPD14pYM–N1SacI/SmaI c/o BspEI+KlenowSacI/EcoRI 639 bp
pYM–N15S1/S4-1983GPDnatNT2No PCRp413-GPD14pYM–N2SacI/SmaI c/o BspEI+KlenowSacI/EcoRI 639 bp
pYM–N16S1/S4-2133GPD3HAnatNT2No PCRp413-GPD14pYM–N3SacI/SmaI c/o BspEI+KlenowSacI/EcoRI 784 bp
pYM–N17S1/S4-2743GPDyeGFP8natNT2No PCRp413-GPD14pYM–N4SacI/SmaI c/o BspEI+KlenowSacI/EcoRI 1390 bp
pYM–N18S1/S4-1932TEFkanMX4No PCRp413-TEF14pYM–N1SacI/SmaI c/o BspEI+KlenowSacI/EcoRI 425 bp
pYM–N19S1/S4-1772TEFnatNT2No PCRp413-TEF14pYM–N2SacI/SmaI c/o BspEI+KlenowSacI/EcoRI 425 bp
pYM–N20S1/S4-1922TEF3HAnatNT2No PCRp413-TEF14pYM–N3SacI/SmaI c/o BspEI+KlenowSacI/EcoRI 573 bp
pYM–N21S1/S4-2532TEFyeGFP8natNT2No PCRp413-TEF14pYM–N4SacI/SmaI c/o BspIE+KlenowSacI/EcoRI 1179 bp
pYM–N22S1/S4-1978GAL1kanMX4No PCRp413-GAL16pYM–N1SacI/SmaI c/o BspEI+KlenowSacI/EcoRI 471 bp
pYM–N23S1/S4-1818GAL1natNT2No PCRp413-GAL16pYM–N2SacI/SmaI c/o BspEI+KlenowSacI/EcoRI 471 bp
pYM–N24S1/S4-1968GAL13HAnatNT2No PCRp413-GAL16pYM–N3SacI/SmaI c/o BspEI+KlenowSacI/EcoRI 619 bp
pYM–N25S1/S4-2578GAL1yeGFP8natNT2No PCRp413-GAL16pYM–N4SacI/SmaI c/o BspEI+KlenowSacI/EcoRI 1225 bp
pYM–N26S1/S4-1951GALLkanMX4No PCRp413-GALL6pYM–N1SacI/SmaI c/o BspEI+KlenowSacI/EcoRI 444 bp
pYM–N27S1/S4-1791GALLnatNT2No PCRp413-GALL6pYM–N2SacI/SmaI c/o BspEI+KlenowSacI/EcoRI 444 bp
pYM–N28S1/S4-1941GALL3HAnatNT2No PCRp413-GALL6pYM–N3SacI/SmaI c/o BspEI+KlenowSacI/EcoRI 592 bp
pYM–N29S1/S4-2551GALLyeGFP8natNT2No PCRp413-GALL6pYM–N4SacI/SmaI c/o BspEI+KlenowSacI/EcoRI 1198 bp
pYM–N30S1/S4-1935GALSkanMX4No PCRp413-GALS6pYM–N1SacI/SmaI c/o BspEI+KlenowSacI/EcoRI 428 bp
pYM–N31S1/S4-1775GALSnatNT2No PCRp413-GALS6pYM–N2SacI/SmaI c/o BspEI+KlenowSacI/EcoRI 428 bp
pYM–N32S1/S4-1925GALS3HAnatNT2No PCRp413-GALS6pYM–N3SacI/SmaI c/o BspEI+KlenowSacI/EcoRI 576 bp
pYM–N33S1/S4-2535GALSyeGFP8natNT2No PCRp413-GALS6pYM–N4SacI/SmaI c/o BspEI+KlenowSacI/EcoRI 1182 bp
pYM–N34S1/S4-1902MET25kanMX4No PCRp413-MET256pYM–N1SacI/SmaI c/o BspEI+KlenowSacI/EcoRI 395 bp
pYM–N35S1/S4-1742MET25natNT2No PCRp413-MET256pYM–N2SacI/SmaI c/o BspEI+KlenowSacI/EcoRI 395 bp
pYM–N36S1/S4-1892MET253HAnatNT2No PCRp413-MET256pYM–N3SacI/SmaI c/o BspEI+KlenowSacI/EcoRI 543 bp
pYM–N37S1/S4-2505MET25yeGFP8natNT2No PCRp413-MET256pYM–N4SacI/SmaI c/o BspEI+KlenowSacI/EcoRI 1149 bp
Table 2. Primer sequences
Primer nameSequence (5′→3′)
ADH1-1GACAGAGAGCTCGATTACAACAGGTGTTGTCCTC
ADH1-2CTGGCCTCGAGGCGAATTTCTTATGATTTATGATTT
CBP-asTCGACGCTAGCAGTAGTTGGAATATCATAATCAAGTGCCCCGGAGGATGAGATTTTCTTAAAGCGGTTGGCTGCTGAGACGGCTATGAAATTCTTTTTCCATCTTCTCTTG
CBP-sTCGACAAGAGAAGATGGAAAAAGAATTTCATAGCCGTCTCAGCAGCCAACCGCTTTAAGAAAATCTCATCCTCCGGGGCACTTGATTATGATATTCCAACTACTGCTAGCG
CUP1-AGCGACGGAGCTCTAGTAAGCCGATCCCATTACC
CUP1-BCGACGAATTCTCTGTCGTCCGGATTTATGTGATGATTGATTGATTGATTG
CYC1-termGACAGAGAGCTCGTTAAAGCCTTCGAGCGTCCC
dsRED-1CGGGATCCGGAGCAGGTGCTGGTGCTGGTGCTGGAGCAATTCTGGGTAGATCTTCTAAGAACGTC
dsRED-2AAGTGGCGCGCTTACAAGAACAAGTGGTGTCTAC
dsRED-7CGGGATCCGGAGCAGGTGCTGGTGCTGGTGCTGGAGCAATTCTGAGTAGATCTTCTAAGAACGTC
eGFP%CUP1-1GCACGACTCCGGAATGTCTAAAGGTGAAGAATTATTCAC
eGFP%CUP1-2CATCCGAGAATTCTCTGTCGGACCAGCACCGGCACCGGCACCAGCACCGGCACCAGCACCTTTGTACAATTCATCCATACCATG
GFP-4CCTGGGATCCTTACTTGTACAGCTCGTCCATGC
GFP-6GCACTGGTCGACGGAGCAGGTGCTGGTGCTGGTGCTGGAGCAATGAGCAAGGGCGAGGAGC
HA-1%CUPGCACGACTCCGGAATGGGTTACCCATACGATGTTCCTGACTATGCG
HA-2%CUPCATCCGAGAATTCTCTGTCGGACCAGCACCGGCACCGGCACCAGCACCGGCACCAGCACCAGAGCACTGAGCAGCGTAATCT
HA-F1TCGACTACCCATACGACGTCCCAGACTACGCTTAG
HA-F2CGCGCTAAGCGTAGTCTGGGACGTCGTATGGGTAG
hphMX4-1GGCAAAGGAATAATCTCGAGTACTGACAATAAAAAG
hphMX4-2CTTTTTATTGTCAGTACTCGAGATTATTCCTTTGCC
klTRP1-1AGTCTAGGCGCGCAAAGTGGAACGATCATTCAC
klTRP1-2AGGCCGAATTCGAGCTCGCCTCGAGGC
M13hinAGCGGATAACAATTTCACACAGGA
MYC-7xHis-F1TCGACGAGCAGAAGCTGATTAGCGAGGAAGATCTGCACCACCATCACCATCACCATTAG
MYC-7xHis-F2CGCGCTAATGGTGATGGTGATGGTGGTGCAGATCTTCCTCGCTAATCAGCTTCTGCTCG
natMX4-1GCCCTGCCCCTAATCTCGAGTACTGACAATAAAAAG
natMX4-2CTTTTTATTGTCAGTACTCGAGATTAGGGGCAGGGC
pYM3/6_FAGCTTCGTACGCTGCAGGTCG
pYM3/6_RGGTAAGATCTCTTGAATGATCGTTCCACTTTTTAGC
ProA-1nGCACGACTCCGGAATGGCGCAACACGATGAAGCCGTAG
ProA-2nCATCCGAGAATTCTCTGTCGGACCAGCACCGGCACCAGGAGCACCAGCGCCTGGAGCACCAGCACCATTCGCGTCTACTTTCGGCG
Red1-1GGATCCGGAGCAGGTGCTGGTGCTGGTGCTGGAGCAATGGTGCGCTCCTCCAAGAACGTC
Red1-2AGAAGTGGCGCGCAGCTACAGGAACAGGTGGTGGCGGCC
RedStar2-BamHIGCGAGGATCCTTACAAGAACAAGTGGTGTCTAC
RedStar2-SalIGGACACAGTCGACGGAGCTGGAGCTGGTGCAGGTGCTGGTGCAATGAGTGCTTCTTCTGAAGATGTCATCACTGAATTCATGAGATTCAAG
FlAsH-1TCGACTGTTGTCCAGGTTGTTGTGCTAGAGCCTGAG
FlAsH-2GATCCTCAGGCTCTAGCACAACAACCTGGACAACAG
S2-SPC42TACACAGAACGCTTTAAGAATGCGCCATACTCCTTAACTGCTTTTTAAATCATCAATCGATGAATTCGAGCTCG
S3-SPC42CAAGCCTGAAAATAATATGTCAGAAACATTCGCAACTCCCACTCCCAATAATCGACGTACGCTGCAGGTCGAC
S2-SPC72AGAGAGTGACTGAGTGTTACATTAAATATATTTATATATAAACGTATGATATTTAATCGATGAATTCGAGCTCG
S3-SPC72ACAGGAAAATGAGTCATTGAGATCGAAACTTTTCAACCTATCAATCAACAATCCCCGTACGCTGCAGGTCGAC
S1-SSP1TCACAATAGTGCCTATTATCATGATAGAAGTAGAGTAGAAAAGCTAGCAACAATGCGTACGCTGCAGGTCGAC
S4-SSP1GGGAAGTTGAGGTTATTTCCCCAGAAGGATCATTCTCATATGTGCCAGAGCTTCTCATCGATGAATTCTCTGTCG
S1-DON1TATCTACTTGACTTTGGCTGGTATTTAAACACAAGTAAGAGAAGCATCAAACATGCGTACGCTGCAGGTCGAC
S4-DON1TTAGAAAAGAGGTTTTAGCAGCATTATTTTCTTTTCCCTTTCTATTTTTCTTTCCCATCGATGAATTCTCTGTCG
eqFP611-1GCAGCAGCAGCGCGCCTCGAGTCAAAGACGTCCCAGTTTG
eqFP611-2GCGCAGCGCGGTCGACGGAGCAGGTGCTGGTGCTGGTGCTGGAGCAGGGATCCGTATGAATTCACTGATCAAGGAA
Table 3. Systematic table of all available pYM plasmids for C-terminal tagging and deletion
TagkanMX4hphNT1natNT2HIS3MX6kITRP1
  • #

    BFP is a very weak fluorescent protein. So far, we have not yet successfully used the BFP-modules. However, we provide the cassette since some strongly expressed proteins might be well detected when tagged with BFP.

Deletion module (no tag)pFA6a–kanMX4pYM–hphNT1pYM–natNT2pFA6a–HIS3MX6 
1HApYM45    
3HApYM1pYM24 pYM2pYM22
6HApYM14pYM16pYM17pYM15pYM3
1MYC–7HispYM46    
3MYCpYM4  pYM5pYM23
9MYCpYM18pYM20pYM21pYM19pYM6
ProApYM7    
TEV–ProApYM8    
TEV–ProA–7HispYM9  pYM10 
TEV–GST–6HISpYM11    
TAPpYM13    
yeGFP (em507, ex488 nm)pYM12pYM25 pYM44pYM26
EGFP (em507, ex488 nm)pYM27  pYM28pYM29
ECFP (em475 (501), ex433 (453) nm)pYM30  pYM31pYM32
EBFP (em447, ex383 nm)#pYM33   pYM34
DsRed1 (em583, ex558 nm)pYM35   pYM36
DsRed (yRFP) (em583, ex558 nm)pYM37    
RedStar (em583, ex558 nm)pYM38    
RedStar* (em583, ex558 nm)pYM42    
RedStar2 (em583, ex558 nm)pYM43    
EYFP (em527, ex513 nm)pYM39pYM40 pYM41 
PA–GFP (photo activated GFP) pYM48   
FlAsH pYM47   
eqFP611 (em611, ex559 nm)pYM51    

Amplification of the PCR-modules

A set of four primers allows to amplify all N- and C-terminal tags and to generate gene deletions. The principle of the primer design is explained in Figure 2. The amplification of the modules can cause problems, because the annealing sites for S1, S2 and S3 primers (Figure 2), which were chosen initially for the EUROFAN project, lead to self-annealing of the primers. Another problem is the high GC content of the natNT2 marker. To circumvent these problems, different PCR conditions have been used (Goldstein and McCusker, 1999). We present here one particular condition, which works well in several laboratories. One other reason for the failure of the PCR is often linked to the quality of the primers (see Discussion).

Figure 2.

Primer design. The figure illustrates the design of the primers S1- S2-, S3- and S4 that are used for the amplification of the cassettes described in this paper. The correct primer design is fundamental for the success of the PCR amplification and the correct targeting into the yeast genome. The following rules should help to design the primers using specific software such as DNA Strider: S1-primer, 45–55 bases upstream of the ATG (including ATG = start codon) of the gene, followed by 5′-CGTACGCTGCAGGTCGAC-3′; S2-primer, the reverse complement of 45–55 bases downstream of the STOP-codon including STOP) of the gene, followed by 5′-ATCGATGAATTCGAGCTCG-3′; S3-primer, 45–55 bases before the STOP-codon (excluding STOP) of the gene, followed by 5′-CGTACGCTGCAGGTCGAC-3′; S4-primer, the reverse complement of 45–55 bases downstream of the ATG (start-codon) of the gene (excluding ATG), followed by 5′-CATCGATGAATTCTCTGTCG-3′

The pipetting scheme for a 50 µl reaction and the PCR cycle scheme are visualized in Figure 3A/B. A successful PCR gives a very strong band at the estimated size (Table 1, Figure 3C), when 3–5 µl of the PCR were analysed on a standard agarose gel. Some natNT2 cassettes might cause problems. The use of another PCR-buffer (Figure 3C) circumvents this problem.

Figure 3.

Amplification of PCR-cassettes. (A) 50 µl of a PCR-sample are mixed on ice. For the amplification of hphNT1- and natNT2-containing cassettes, it is recommended to use buffer 2. (B) The amplification programme is the same for all cassettes except the modification in the melting step for natNT2-based cassettes (grey-shaded). (C) pYM14-17 (6HA-tag) were amplified with the S2/S3 primers of CDC6. 5 µl of the PCR reaction were analysed on a 0.9% agarose-TAE gel. The gel was stained with ethidium bromide. As reference, 10 µl 1 kbp marker, diluted according to the manufacturers' instructions (Invitrogen, Gibco, BRL) was run (1, 6). Under standard conditions, amplification of pYM14 (2) and pYM15 (3) gave a very strong band at the expected size (Table 1). The amplification of pYM16 (4) was less efficient, but sufficient for transformation of the PCR-product; pYM17 could not be amplified under standard conditions (5). With the special protocol (B), pYM17 was weakly amplified in buffer 1 (7); a very strong PCR-product of the correct size (Table 1) was amplified when special conditions (B) and buffer 2 were used (8)

For transformation of S288c- or W303-derived strains, usually 5 µl of a PCR were used. For some other strain backgrounds (such as SK-1), a 10-fold higher amount of DNA was used. For this purpose, the PCR product was ethanol-precipitated and dissolved in water (1/10 of the original volume).

Yeast strains and growth conditions

YPD and synthetic drop-out media were prepared as described (Sherman, 1991). For antibiotic selection markers, the following concentrations of antibiotics were added to standard YPD-plates (www.duke.edu/web/microlabs/mccusker/; Goldstein and McCusker, 1999): kanMX4, geneticin (G418, GibcoBRL), 200 mg/l; hphNT1, hygromycin B (Cayla, Toulouse, France; www.cayla.com), 300 mg/l; and natNT2, nourseothricin (ClonNAT, Werner BioAgents, Jena-Cospeda, Germany; www.webioage.com), 100 mg/l.

The antibiotics were added after autoclaving and cooling of the medium to approximately 60 °C. In the case of ClonNAT, a sterile filtered stock-solution was prepared prior to addition to the medium, while for geneticin and hygromycin B, the powder and the solution provided by the manufacturer were used directly.

Yeast transformation and testing

Yeast transformation using frozen competent cells was based on the LiOAc method (Schiestl and Gietz, 1989), however with several modifications. A detailed description of the method is given in Knop et al. (1999).

For klTRP1 or HIS3MX6 selection, after transformation cells were resuspended in 200 µl sterile PBS and plated directly onto plates containing synthetic medium lacking the respective amino acid (SC-HIS, SC-TRP; Sherman, 1991).

For kanMX4, hphNT1, natNT2-selection: after transformation, cells were resuspended in 3 ml of YPAD medium and incubated on a shaker for at least 5–6 h at 30 °C, than sedimented and plated onto the selection plates.

Selection for positive transformants on plates containing antibiotics often requires replica plating of the plate after 2 days at 30 °C, because of the high background of transiently transformed cells, which makes it difficult to recognize the correct integrants (Knop et al., 1999; Wach et al., 1997). The success of the integration was tested by colony PCR using a quick chromosomal DNA isolation procedure (Finley and Brent, 1995), immunoblotting or by immunofluorescence, as described previously (Knop et al., 1999). For immunoblotting, protein extraction was done using the NaOH/βME/TCA-protocol (Knop et al., 1999).

For the detection of epitope-tagged proteins, tag-specific antibodies were used: HA-tag, mouse monoclonal 12CA5 (Roche Boehringer-Mannheim), 16B12 (Babco); Myc-tag, mouse monoclonal 9E10 (Boehringer-Ingelheim); Protein A/TAP-tag, rabbit PAP (DAKO); Don1p, affinity purified rabbit anti-Don1p (Rabitsch et al., 2001); GFP, affinity-purified sheep anti-GFP. For ECL detection (Amersham), goat anti-mouse, -rabbit or -sheep secondary antibodies coupled to horseradish peroxidase (Jackson Immuno Research Laboratories) were used.

Plasmid requests

The full collection of plasmids and the sequence files will be made available for non-commercial recipients through EUROSCARF (http://www.uni-frankfurt.de/fb15/mikro/euroscarf/index.html). The plasmids have been prepared and tested carefully; however, we cannot guarantee that no error has been made. In case of problems, please do not contact any of the authors unless you are absolutely sure that the problem is associated with the plasmid (use positive controls!).

Results

Two new selection markers: hphNT1 and natNT2

Recently, Goldstein and McCusker (1999) introduced three new dominant drug resistance cassettes that can be used in the yeast S. cerevisiae. The cassettes were constructed in analogy to the pFA6–kanMX4 marker (Goldstein and McCusker, 1999; Wach et al., 1994), thus allowing the use of the established S1/S2-primer annealing sites (Wach et al., 1994; Knop et al., 1999) for amplification. The hphMX4 and natMX4 (Goldstein and McCusker, 1999) markers confer resistance to hygromycin B or clonNat (nourseothricin), respectively, and were cloned in-between the promoter and terminator of the kanMX4 cassette (Wach et al., 1994). The homologous sequences flanking the different marker genes, however, lead to recombination between the markers, if the two markers are used simultaneously in the same yeast strain. To circumvent this problem, we exchanged the terminator of the hphMX4 cassette and replaced it with the terminator of the CYC1 gene. Similarly, we replaced the natMX4 terminator with the ADH1 terminator. The new cassettes were termed hphNT1 and natNT2, respectively (NT = new terminator; Table 1). As demonstrated in a control experiment (not shown), kanMX4, natNT2 and hphNT1 completely failed to recombine with each other.

C-terminal tagging: fluorescent proteins

The availability of a variety of fluorescent proteins, such as yeGFP (Cormack et al., 1997), EGFP, EBFP, ECFP, EYFP (http://www.clontech.com/gfp/excitation.shtml), DsRed (Matz et al., 1999), hcRED (Gurskaya et al., 2001) and RedStar, a much brighter version of DsRed (Knop et al., 2002), consequently led to the construction of new cassettes. The coding regions of the six fluorophores were cloned into tagging cassettes preceded by a spacer sequence that codes for the peptide ‘SGAGAGAGAGAIL’. This spacer peptide can facilitate the correct folding of the fluorescent proteins when coupled to the protein of interest (Miller and Lindow, 1997). Additionally, we provide a cassette containing the red fluorescent protein eqFP611 (Wiedenmann et al., 2002).

The properties of some of the GFP derivatives are summarized in a review article (Tsien, 1998; for spectral properties, see also Table 3). All of them have been successfully used for applications in baker's yeast, such as in vivo double labelling and live cell imaging. The suitability of each of the individual fluorescent proteins for a specific experiment, however, has to be tested each time.

The red fluorescent protein DsRed has been limited to special application in yeast (Pereira et al., 2001), since the formation of the red chromophore (Baird et al., 2000) is not fast enough (T1/2 ∼ 24 h) to allow the detection of de novo synthesized proteins in logarithmically growing cells. This has been partially solved by the construction of a much brighter variant, called RedStar (Knop et al., 2002), or by a faster-maturing but less bright variant named T4-DsRed (Bevis and Glick, 2002). We constructed a combination of the T4-DsRed and the RedStar mutant, which leads to a bright, fast-maturing red fluorescent protein, RedStar2. We provide for several of these DsRed variants cassettes (Table 1), most of which contain yeast codon optimized constructs. The last drawback of DsRed-variants, their strong tetramerization (Baird et al., 2000), has only recently been solved (Campbell et al., 2002), but this monomeric DsRed variant seems to be not yet bright enough for general applications in yeast (unpublished observation). However, the red fluorescent protein eqFP611 (Wiedenmann et al., 2002) largely circumvents this problem.

Double labelling using different fluorescent proteins

For double-fluorescent labelling, different fluorescent proteins can be combined: GFP together with DsRed, GFP and BFP, GFP and CFP, and YFP in conjunction with CFP. The combination of YFP and CFP is frequently used. The tagged proteins can be distinguished with appropriate filters. However, both, CFP and YFP bleach faster then GFP. The CFP signals often appeared weakly fluorescent when observed by eye; however, imaging with a CCD-camera gave nice and strong signals (Figure 4).

Figure 4.

Double labelling of two C-terminal tagged proteins: CFP and YFP. SPC42 was tagged with CFP amplified from the cassette plasmid pYM30; SPC72 was tagged with YFP amplified from pYM41, using the corresponding S2 and S3 primers (Table 2). The cells were collected in logarithmic growth and fixed for 5 min with 4% (w/v) paraformaldehyde. The cells were analysed by fluorescence microscopy

C-terminal tagging: HA, MYC and TAP tag

HA and MYC-tags are used for the detection of the tagged proteins by immunoblotting and immunofluorescence microscopy. A combination of two tagged proteins (HA and MYC, respectively) in one strain is widely used to detect protein–protein interaction by co-immunoprecipitation. Furthermore, it became obvious that proteins with low expression levels can be detected when several repeats of the HA or Myc tag (6HA or 9Myc) were fused to the protein. On the other hand, too many tags may interfere with the functionality of the fusion protein. For native protein purification, it has been shown that single HA-tagged proteins can be eluted from anti-HA beads using the HA peptide (YPYDVPDYA), while this was not possible when multiple tags were used. Because of these considerations, we constructed a variety of PCR modules using single, triple and hexa- or nona-tags in combination with a variety of selection markers (Table 3), thus enabling the flexible construction of strains carrying different tags at the same time.

The use of Protein A as an affinity tag has shown to be a powerful tool for the purification of proteins from yeast lysates, especially in combination with a calmodulin-binding peptide (CBP) and a TEV site-specific protease cleavage site. This combination of features, called the TAP tag (Rigaut et al., 1999), has been shown to be very useful for native protein complex purification (Gavin et al., 2002).

An example for the application of the TAP tag PCR module (pYM13) is shown in Figure 5.

Figure 5.

Purification of Don1p using the TAP-tag. The protein Don1p was tagged with the TAP tag using pYM13 and DON1 specific S2- and S3-primers. The protein was purified from the soluble fraction of meiotic cells using a modified version of the protocol of Rigaut et al. (1999)

Other tags

Recently, other tags with specific properties became fashionable. The FlAsH tag consists of a small peptide, containing four cystein residues (DCCPGC-CA), that is recognized by specific di-arsenic compounds, which, upon binding, become fluorescent (Adams et al., 2001). We have tested the FlAsH tag and found that it worked also in yeast; however the maximally obtainable level of fluorescence, when compared with the analogous GFP fusion, was less than 5%, thus limiting the usefulness of this tag. Similarly, we also constructed a cassette containing the photo-activatable GFP (PA-GFP; Patterson and Lippincott-Schwartz, 2002). Proteins carrying this tag emitted, when maximally activated, less than 10% of the fluorescence compared to GFP-tagged versions. This limits the usefulness of this tag in yeast.

Promoter replacement and N-terminal tagging

The introduction of a heterologous promoter upstream of the START codon of a gene is a way to control and to modulate gene expression. At the same time, it allows the introduction of a N-terminal epitope tag to the gene.

We constructed a set of cassettes with nine different replacement promoters. Eight of these promoters were well characterized from previous applications in centromeric or 2 µ plasmids (Mumberg et al., 1994, 1995). The replacement of an internal promoter with the constitutive ADH, CYC1, GPD or TEF promoters can be used to modulate the expression of a gene in a permanent manner. For inducible expression, the GAL1 promoter and two truncated (and weaker) derivatives of this promoter, termed GALL and GALS (Mumberg et al., 1994), as well as the MET25 promoter, are provided. All the promoters were cloned into cassettes with kanMX4 and natNT2 selection markers. Additionally, all natNT2 promoter-substitution cassettes were combined with a N-terminal 3HA and yeGFP (Cormack et al., 1997) tag (Table 1). We observed different expression rates of the gene DON1 when controlled by the eight different promoters. The inducible promoters are not always completely repressed in the non-induced state. In the case of the relatively strong MET25 and the GAL1 promoters, a weak expression was observed in the repressed state of the promoter (glucose complete medium; Figure 6). In contrast, the two weaker versions of the GAL-promoter, GALL and GALS, were completely repressed (Figure 6).

Figure 6.

Control of expression of DON1 using a range of different promoter substitutions. The promoter of the gene DON1 was exchanged for all available promoters (except CUP1-1; cf. Figure 7) associated with the N-terminal 3HA-tag. Cultures were grown into the exponential growth phase. Western blot detection was done with the monoclonal antibody 16B12. Equal protein load was verified by staining the blots with Ponceau S. Two different expositions are shown to underline the differences in promoter strength. (A) Constitutive promoters: GPD (lane 4) and TEF (lane 5) induce very strong protein expression; the ADH-promoter (lane 1) is weaker; whereas the CYC1-promotor (lane 2) is very weak, therefore it was detected with a 5× protein load (lane 3); 12 µg (60 µg in lane 3) total protein were analysed. (B) Inducible promoters: induction was performed by adding 1% glucose (–) or 1% galactose (+) to YEP-raffinose medium (all GAL-promoters) or by washing and transferring the culture to SC-met medium (MET25-promoter). Induction time was 90 min. 12 µg total protein were analysed. The inducible promoters are different in strength; the very strong MET25 and the strong GAL1 are slightly leaky (lanes 6 and 12)

Furthermore, we constructed five cassettes containing the CUP1-1 promoter (Table 1). This strong promoter can be induced with CuSO4. We used this system successfully for the regulated induction of gene expression during various phases of the meiotic cell cycle (unpublished data). An example of the expression of Ssp1p under control of CUP1-1 is given in Figure 7.

Figure 7.

Control of expression of SSP1 by the CUP1-1 promoter. The gene SSP1, expressed only during meiosis (Moreno-Borchart et al., 2001), was chromosomally tagged using pYM-N1 and S1 and S4 primers for SSP1. Expression of the gene was detected in mitotically growing cultures. Ssp1p expression was followed in the CUP1-1-SSP1 strain and in a control strain with the unaltered SSP1 gene in the absence or presence of CuSO4 (100 µM, 2 h), as indicated in the figure. Upon cell lysis, Ssp1p was detected using a specific antibody

Discussion

In the present paper, we describe 37 new cassettes for the C-terminal epitope tagging of yeast proteins, developed by combining existing tags with new marker genes and cloning new tags, namely a variety of different fluorescent proteins of all available colours, and the TAP-tag. Furthermore, a series of 37 N-terminal cassettes has been developed that allow, besides the replacement of the promoter of the target gene, the introduction of N-terminal tags. For one single gene, all these cassettes can be amplified with four unique primers (Figures 1 and 2). The versatility of the primers is a strong advantage not only regarding to the cost of the method. Also, once all four primers have been successfully tested, any concerns about the quality of the primers can be omitted, which can turn out in some cases to be quite important (see below). The cloning strategies for most of the cassettes were based on common restriction sites, which facilitate the construction of further cassettes, if necessary (Table 1; further details available upon request).

PCR amplification and primers

Since the PCR amplification of the cassettes has caused problems in different laboratories, we describe a PCR-protocol suitable for the amplification of almost all of the cassettes. This protocol works well (in several laboratories), and fulfils three major criteria: reliability, fidelity and high yield. It requires, however, a reliable PCR machine that allows time increment programming. For the amplification of natNT2-based cassettes, this protocol needs to be slightly modified due to the high GC content of the coding sequence of this marker gene (see Materials and methods; Figure 3). Another reason why sometimes the PCR does not work is the poor primer quality. We found, that for some suppliers, up to 20% of the primers do not work (e.g. 40% of the PCRs performed), while for other suppliers, less then 5% are non-functional (less than 10% of PCRs performed) with respect to amplification of modules. Testing the primers in combination with established primers can help to nail down the faulty primer (companies normally will provide a free replacement primer).

New selection markers

The use of the hphNT1 and natNT2 cassettes is as robust as the kanMX4 cassettes. Cells selected on antibiotic media tend to form a lawn, due to the growth of transiently transformed cells, which might hinder the identification of positive clones. In such a case the cells were replica-plated after 2 days of growth onto a fresh plate of the same medium. On the new plate, only positive clones grow. Using kanMX4 and HIS3MX6 together in one strain led to recombination events within the marker genes. After the transformation of the second cassette, positive clones must be selected on both, G418 and SC-His plates. The klTRP1 cassette seems to promote a somewhat less-than-wild-type growth rate when used to complement the trp1 mutation; therefore, it is recommended to wait 2 more days in case no colonies appear 2–3 days after transformation. Usually, transformants were confirmed using colony PCR in combination with either immunoblotting using anti-HA, anti-Myc, anti-GFP or PAP (for detection of protein A tags) antibodies or fluorescence microscopy (to visualize fusions with fluorescent proteins) or indirect immunofluorescence microscopy (HA or Myc fusions).

New fluorescent markers

We observed that yeGFP (Cormack et al., 1997) and EGFP (Clontech) do not show observable differences in brightness, although they do contain different mutations compared to the wild-type GFP.

We have also provided a number of different cassettes containing DsRed and mutagenized versions of DsRed. Due to the properties of the DsRed protein, its application is somewhat limited compared to GFP. This is mainly due to its strong tetramerization (Baird et al., 2000), which can interfere with protein function (Knop et al., 2002). Table 4 summarizes some of the properties of the different red fluorescent proteins that are contained in our cassettes.

Table 4. Properties of the red fluorescent protein
NameMutationsTm1/2 (h)AggregationBrightness relative to DsRedCodon usage
  • 1

    The yeast codon optimized sequence of DsRed, RedStar and RedStar2, contain an additional codon at position 2.

  • 2

    Knop et al., 2002.

  • 3

    Please note that T4-DsRed is not included in the list of cassettes available.

  • 4

    Bevis and Glick, 2002.

  • 5

    Value not determined precisely.

DsRed 24+++1Yeast
RedStar1G2S, R18K, V97I, S113T, F125L, M183K, P187Q, T203IApprox. 12+10–202Yeast
T4-DsRed3R2A, K5E, N6D, T21S, H41D, N42Q, V44A, A145P, T217A0.70.34Original
RedStar21Combination of RedStar+ T4–DsRed mutationsApprox. 0.5–152–45Yeast

Promoter exchange and N-terminal tagging

A new feature of the presented set of cassettes are the 37 new promoter substitution and N-terminal tagging modules. Apart from the CUP1-1 promoter, which was specifically cloned for N-terminal tagging of proteins that are involved in meiosis, all other promoters were taken from existing yeast plasmids, therefore, their expression levels have already been studied in detail and the promoters can be used according to these data (Mumberg et al., 1994, 1995). The promoter substitution can be applied for the determination of expression level-related phenomena, or simply to deplete a gene product. It was noted that, while the GAL1 and the MET25 promoters were slightly leaky under repressive conditions, the less active GALL and GALS were tightly repressed in glucose medium (unpublished data and Figure 6). The use of the GALS promoter might thus be a better tool than the until now frequently used GAL1 promoter, first because of the reduced leakiness, but also for the lower expression rate in the induced state.

Conclusion

Taken together, the new range of PCR-cassettes allows the use of more selection markers, the combination of more tags in one single strain and the application of fluorescence double labelling with CFP and YFP, but also with GFP and RedStar2, while dsRed and RedStar can be used as fluorescent timers (see above and Table 4). N-terminal tags and promoter substitutions allow to interfere with transcriptional regulation and to conditionally deplete gene products, while the availability of N-terminal tags provides the possibility to label proteins that cannot be tagged at the C-terminus. The need of only four different primers for the use of all cassettes described here and in Knop et al. (1999) makes the tagging cheap, reliable and flexible. However, the ease by which new strains can be constructed by this method should, of course, never prevent us from keeping one key question in mind: how does this manipulation affect the function of the gene?

Acknowledgements

The work of E. Schiebel was supported by the Cancer Research Campaign UK and of M. Knop by the Max-Planck-Institute of Biochemistry, Department of Molecular Cell Biology, Munich, Germany, and the EMBL, Heidelberg, Germany. C. Janke was supported by an EMBO long-term fellowship (ALTF 387-2001). E. Schwob was funded by CNRS and the Association pour la Recherche sur le Cancer (ARC), France. M. M. Magiera is supported by a PhD fellowship from the French Ministry of Research.

Ancillary