SEARCH

SEARCH BY CITATION

Keywords:

  • Zygosaccharomyces;
  • 5.8S-ITS polymorphism;
  • D1/D2 26S rDNA;
  • vinegar;
  • yeast

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. References

The taxonomic status and species number of the genus Zygosaccharomyces have rapidly changed in the last years. In this study, two new osmotolerant Zygosaccharomyces strains isolated from traditional balsamic vinegar, viz. ABT301 and ABT601, were investigated to elucidate their taxonomic relationships with Zygosaccharomyces rouxii species. A multi-gene sequence approach was employed, including regions of the rDNA repeat [5.8S, two internal transcribed spacers (ITS) and the 26S D1/D2 domain], COX2 mitochondrial gene and two nuclear genes (SOD2 and HIS3). Cloning and sequence analysis of 5.8S-ITS rDNA revealed that these strains bear an unusual polymorphism for this region. Three highly divergent 5.8S-ITS sequences were detected, one identical to Z. rouxii, the other two showing some relatedness to Z. mellis. Sequence and gene number polymorphism was also observed for the protein-encoding nuclear genes SOD2 and HIS3, as two copies for each gene different from those found in Z. rouxii were detected. Analysis of the D1/D2 26S domain showed that ABT301 and ABT601 have only one type of D1/D2 sequence statistically different from that of Z. rouxii. The findings obtained in this work suggest that the genomic background of strains ABT301 and ABT601 is different from the other Zygosaccharomyces species. We speculated that they could belong to a new putative species related to Z. rouxii. Copyright © 2007 John Wiley & Sons, Ltd.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. References

The yeast species of the genus Zygosaccharomyces Barker (Barker, 1901) have a long history as spoilage yeasts within the food industry. This is mainly due to their tolerance to many common food preservatives. Their spoilage features include: high sugar tolerance (50–60%), high ethanol tolerance (up to 18%), high acetic acid tolerance (2.0–2.5%), very high sorbic and benzoic acid tolerance (up to 800–1000 mg/l) and high halotolerance (Pitt and Hocking, 1985; Thomas and Davenport, 1985; Fleet, 1992; James and Stratford, 2003). Food and beverages with low pH values and high fermentable sugar concentration, such as fruit juices, concentrated juices, jams, honey, soft drinks, sugar syrups and must, are at risk of deterioration due to Zygosaccharomyces. However, recent studies have underlined the positive role of different Zygosaccharomyces species in alcoholic fermentation of some foods and beverages, such as traditional balsamic vinegar, kombucha tea and soy sauces (Solieri et al., 2006; Steels et al., 2002; Aidoo et al., 2006).

Notwithstanding their industrial importance, the taxonomic status of the genus Zygosaccharomyces and consequently Zygosaccharomyces species identification can be controversial. Nine species are currently accepted in the genus (Kurtzman, 1998) and recently two new species, Z. lentus (Steels et al., 1999) and Z. kombuchaensis, have been proposed (Kurtzman et al., 2001; Steels et al., 2002).

Differentiating among Zygosaccharomyces species by conventional tests is frequently problematic, since the genus is relatively shallow in evolutionary terms (James et al., 1994). Phylogenetic comparative analysis using 18S rRNA gene sequences (James et al., 1994, 1996) and partial 26S rRNA sequences (Kurtzman and Robnett, 1998) have elucidated some taxonomic relationships within the genus Zygosaccharomyces. These studies suggested that the genus is polyphyletic and consists of two groups. The first is indicated as the Zygosaccharomyces sensu stricto group, and includes Z. bailii, Z. bisporus, Z. lentus, Z. mellis, Z. kombuchaensis and Z. rouxii, the latter being the type species (Kurtzman and Robnett, 2003; Steels et al., 2002). The second group includes other species currently assigned to Zygosaccharomyces that are not part of the Z. rouxii clade, on the basis of rDNA analysis, viz. Z. cidri, Z. fermentati, Z. florentinus, Z. microellipsoides and Z. mrakii (Kurtzman et al., 2001). Based on multi-gene sequence analysis, Kurtzman recently reviewed the genus, splitting the 11 Zygosaccharomyces species into three phylogenetically circumscribed genera, viz. Zygosaccharomyces (Z. rouxii, Z. mellis, Z. bailii, Z. bisporus, Z. kombuchaensis and Z. lentus), Zygotorulaspora (Z. mrakii and Z. florentinus) and Lachancea (Z. cidri and Z. fermentati), while the species Z. microellipsoides has been ascribed to the genus Torulaspora (Kurtzman, 2003).

Within the genus Zygosaccharomyces the species most strictly related to Z. rouxii is Z. mellis, so much so that it was considered as a synonym of Z. rouxii until Kurtzman (1990) established, on the basis of nDNA–nDNA hybridization, that this yeast is a genetically distinct species. James et al. (2005) found one strain, NCYC 3042, that could belong to a new Zygosaccharomyces species strictly related to Z. rouxii and Z. mellis. Its D1/D2 sequence was deposited in GenBank and the strain there was referred as Zygosaccharomyces pseudorouxii. Even though Z. pseudorouxii is currently not an acknowledged species, in this work we refer to NCYC3042 as the Z. pseudorouxii strain. In addition, James and co-workers found natural hybrids within the genus Zygosaccharomyces, related to Z. rouxii and the new putative species Z. pseudorouxii. More recently, two osmotolerant Zygosaccharomyces strains, ABT301 and ABT601, were isolated from high sugar concentration samples of traditional balsamic vinegar and were not ascribed to any Zygosaccharomyces species but were provisionally identified as Z. pseudorouxii (Solieri et al., 2006).

In this study we used a multi-gene sequence approach to evaluate the genetic diversity of ABT301 and ABT601 and to investigate their taxonomic status. In particular, we analysed the sequences of the following genes: the rDNA regions 5.8S, two flanking internal transcribed spacers (ITSs) and the 26S D1/D2 domain; two nuclear encoded genes, imidazole-glycerol-phos- phate dehydrates (HIS3), involved in histidine biosynthesis, and an Na+/H+-antiporter (SOD2) responsible for halotolerance, the mitochondrial COX2 gene, which encodes subunit II of the cytochrome c oxidase complex.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. References

Yeast strains

The DNA sequences of the 5.8S-ITS rDNA region, the 26S D1/D2 domain, the nuclear encoded HIS3 and SOD2 genes and the mitochondrial COX2 gene were obtained from 15 Zygosaccharomyces strains. The Accession Nos of these sequences, the strains and their origins are shown in Table 1. Two strains (ABT301 and ABT601) identified in a previous study as very similar to Z. pseudorouxii NCYC 3042, as well as a Z. rouxii strain (ABT808) and a Z. mellis strain (ABT401), were isolated in 2004 from different traditional balsamic vinegar samples produced in the Italian provinces of Modena and Reggio Emilia, as described by Solieri et al. (2006). All strains were cultivated on YPD plates (1% yeast extract, 1% peptone, 2% glucose, 2% agar) at 26 °C.

Table 1. Strains, isolation sources and EMBL Accession Nos of the 5.8S-ITS rRNA, 26S RNA, COX2, SOD2 and HIS3 sequences used in this work
SpeciesStrain designationOther collectionsIsolation sourceGenbank Accession Nos
5.8S-ITS rRNA26S rRNACOX2SOD2HIS3
  1. Culture collection abbreviations: CBS, Centraalbureau voor Schimmelcultures, Delft, The Netherlands; NCYC, National Collection of Yeast Culture, UK; NRRL, Northern Regional Research Laboratory, USA. −, Sequences not available. Accession numbers in bold were obtained in this work; the other sequences were retrieved from the EMBL sequence database.

Zygosaccharomyces bailiiCBS 680TNRRL Y-2227Inst. Brewing TokyoAY046191U72161AF442250
 ATCC 36947Salad dressingAY050224
ZygosaccharomycesCBS 702TNCYC 12626Tea-beerAY046192U72162AF442251
bisporus NRRL Y-7558 
ZygosaccharomycesCBS 736TNRRL Y-12628HoneyAY046190U72164AF442249AJ634593
mellisABT401Balsamic vinegarAJ966344
ZygosaccharomycesCBS 732TNRRL Y-229Grape mustAY046189AY046112AF442248AJ252273Y18561
rouxii NCYC 568 AJ634592
 NCYC 581HoneyAJ620361
 NCYC 561Wine grapeAJ872202AJ871822
 ATCC 42981MisoD43629
 AB010106 
 M2MisoAY225978
 AY225979 
 ABT808Balsamic vinegarAJ966519AM279697AM279700
ZygosaccharomycesNCYC 3042SugarAJ555406AJ620473AJ872203AJ634594
pseudorouxiiABT301Balsamic vinegarAM279465AJ966342AM279698AM279701AM279705
 AM279464 AM279703AM279707
 AM279696 
 ABT601Balsamic vinegarAJ966517AM279699AM279702AM279706
 AM279704AM279708
HybridNCYC 1682MisoAJ620472AJ872204AJ634590
 AJ872205AJ871916

Genomic DNA extraction and PCR amplification

The genomic DNA was extracted according to the procedure described by Querol et al. (1992). All PCR reactions were carried out in a thermal cycler (Applied Biosystem Gene Amp System 2004, USA), using high-fidelity conditions (Eckert et al., 1991). The amplification was performed in a 50 µl mix containing 2 µl DNA template (0.5 µg/µl), 0.2 mM premixed deoxynucleoside triphosphates, 2 mM MgCl2, 15 pM each primer, and 1 U DNA polymerase Takara Ex Taq (Takara Bio Inc., Shiga, Japan).

The oligonucleotides ITS1 (nucleotides 1771–1889 for Saccharomyces cerevisiae 18S rDNA) and ITS4 (nucleotides 51–70 for S. cerevisiae 26S rDNA) were used to amplify the internal transcribed spacer regions (GenBank Accession No. NC 001 144), including the 5.8S gene of the rDNA repeats (5.8S-ITS), as described by White et al. (1990).

Domains 1 and 2 at the 5′ end of the large subunit rDNA (26S D1/D2) (nucleotides 63–642 for S. cerevisiae; GenBank Accession No. NC 001144) were amplified with the primer pair NL1 and NL4 (O'Donnell, 1993), in the reaction mixture indicated above.

Two different primer pairs were used to selectively amplify Z. rouxii CBS 732T copy and Z. rouxii ATCC 42 981 copy of both SOD2 and HIS3 nuclear genes, as described by James et al. (2005). The primer combinations were: HIS3F/HIS1R for CBS 732THIS3 gene (Sychrová et al., 2000); HIS2F/HIS2R for NCYC 3042 HIS3 gene (James et al., 2005); SOD1F/SOD1R for CBS 732TZrSOD2-22 gene (Kinclová et al., 2001); and SOD2F/SOD2R for ATCC 42981 ZSOD22 gene (Iwaki et al., 1998) (Table 2). The mitochondrial gene COX2 was amplified using primers COII-5 and COII-3 (Belloch et al., 2000). All primer sequences and cycling conditions are reported in Table 2.

Table 2. Primer sequences and PCR cycling conditions used in the present work
TargetChromosomal coordinatesPrimer sequence 5′–3′PCR cycling conditions
Initial temperature ( °C)/timeNo. cyclesDenaturing temperature ( °C)/timeAnnealing temperature ( °C)/timeExtension temperature ( °C)/timeFinal extention temperature ( °C)/time
  • a

    Referred to S. cerevisiae genome.

  • b

    Referred to Z. rouxii CBS 732T genome.

D1/D2ChrXIIaNL1 GCATATCAATAAGCGGAGGAAAAG94/5 min3592/30 s54/45 s72/1.5 min72/5 min
 NL4 GGTCCGTGTTTCAAGACGG 
5.8S-ITSChrXIIaITS1 TCCGTAGGTGAACCTGCGG95/15 min4094/2 min55/2 min72/2 min72/10 min
 ITS4 TCCTCCGCTTATTGTATGC 
COX2Mitochondrial geneCOII5 GGTATTTTAGAATTACATGA95/5 min4094/1 min55.5/2 min72/2 min72/10 min
 COII3 ATTTATTGTTCRTTTAATCA 
HIS3ChrVIbHIS3F GATYGAYATTCATACYGGTGTYGG94/5 min3592/30 s54/45 s72/1.5 min72/5 min
 HIS1R GAAGTTGCTTCTCTAAGGGCT 
 HIS2F GTAACGGTGTAGCCACACAG94/5 min3592/30 s54/45 s72/1.5 min72/5 min
 HIS2R AGGTTGCCTCTCTGAGAGCC 
ADE2ChrVIIbADE1F AACTAGTGAAGGTTTAGCTCT94/5 min3592/30 s55/45 s72/1.5 min72/5 min
 ADE1R AGTAACCACATTAATGTGACC 
 ADE2F CTCTGAAGGCTTGGCCTC94/5 min3592/30 s55/45 s72/1.5 min72/5 min
 ADE2R TAACCACGTTGATGGGCT 
SOD2ChrIVbSOD1F ACGTATGAATTCGATGCAGAT94/5 min3592/30 s55/45 s72/1.5 min72/5 min
 SOD1R TCCTTAACAAACAATGCTAAGT 
 SOD2F TACATATCAATCAGATTCTAGTT94/5 min3592/30 s55/45 s72/1.5 min72/5 min
 SOD2R TTGAAACGCGATGCTGGTC 

5.8S-ITS restriction analysis

The PCR products of the 5.8S-ITS rDNA region were digested with the restriction enzymes HaeIII, HinfI and CfoI (MBI Fermentas Inc., Burlington, Ontario), as described by Esteve-Zarzoso et al. (1999). The restriction fragments were separated on 2% agarose gels and the fragment lengths estimated by comparison with a 100 bp ladder marker (MBI Fermentas Inc., Burlington, Ontario) or a 123 bp ladder marker (Invitrogen, Cergy-Pontoise, France). Restriction patterns were compared with those obtained from reference strains.

Cloning of 5.8S-ITS rDNA PCR products

PCR-amplified 5.8S-ITS fragments of strains ABT301 and ABT601 were purified using a Montage PCR kit (Millipore, Concord, MA), then cloned in pGEM-T Easy Vector, following the manufacturer's instructions (Promega, Madison, WI). Plasmid DNA was isolated from positive colonies using the Qiaprep Spin Miniprep kit (Qiagen, Westburg BV, Leusden, The Netherlands), screened by PCR reaction with the ITS1 and ITS4 primers and digested with HaeIII endonuclease to verify the insert restriction profiles. Plasmid DNAs having different HaeIII restriction patterns of the 5.8S-ITS insert were directly sequenced, as described below.

Cloning of extra bands of 5.8S-ITS rDNA fragment

Extra bands of 5.8S-ITS rDNA in the HaeIII restriction profile were excised from the agarose gel with QIA quick gel extraction kit (Qiagen Gmbh, Hilden, Germany). Since HaeIII produces blunted ends, a poly-A-tail was added to the 3′ end via a reaction at 72 °C for 10 min, using 1 U DNA polymerase Takara Ex Taq (Takara Bio Inc., Shiga, Japan), before TA cloning in the plasmid pGEM Easy vector (Promega, Madison, WI). The cloned band was sequenced using the vector primers T7 and SP6.

Sequencing reactions

PCR products were cleaned with a Montage PCR kit (Millipore, Concord, MA), according to the manufacturer's instructions. The purified amplicons were directly sequenced in both strands by the MWG Biotech sequence service (Ebersberg, Germany).

Sequence analysis

All DNA sequences were assembled and edited using the DNAstar 4.05 software package (DNASTAR Inc, Madison, WI) and aligned using the CLUSTAL W algorithm (Thompson et al., 1994). For phylogenetic inferences, we used the neighbour-joining (NJ) method (Saitou et al., 1987) with 1000 bootstrap interactions. Z. bailii sequences were used as the outgroup for all NJ trees except for the SOD2-derived tree, because the Z. bailii SOD2 sequence was not available in GenBank.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. References

PCR products and restriction fragments of the 5.8S-ITS rDNA

The ITS1 and ITS4 primers were used to amplify the region of the rDNA repeat unit that includes the 5.8S rRNA gene and the ITS 1 and ITS 2 regions (White et al., 1990). Amplification from genomic DNA generated two PCR products of approximately 700 bp in both strains, ABT301 and ABT601. These amplicons were digested with the endonucleases CfoI, HaeIII and HinfI. The obtained restriction profiles obtained are listed in Table 3. The patterns for these strains differed from the profiles of the type strains used in this study and from those reported for other Zygosaccharomyces species (Esteve-Zarzoso et al., 2003). The two 700 bp amplicons restricted by each endonuclease resulted in several bands, of total size approximately 1400 bp. An exception was observed for the enzyme HaeIII, which produced a very complex profile with an additional weak intensity band of 510 bp (see Table 3, Figure 1A). These data suggested that at least two heterologous copies of 5.8S-ITS rDNA region were present.

thumbnail image

Figure 1. Restriction patterns of 5.8S-ITS rDNA PCR products from ABT301 genomic DNA and the cloned 5.8S-ITS inserts, using HaeIII (A), HinfI (B) and CfoI (C) endonucleases. Lane M corresponds to 100 bp ladder marker (MBI Fermentas). Lane 1, 5.8S-ITS ABT301 amplicon; lane 2, 5.8S-ITS copy 3; lane 3, 5.8S-ITS copy 1 and lane 4, 5.8S-ITS copy 2. The 250 bp fragment of the ABT301 HaeIII restriction pattern is indicated by an asterisk

Download figure to PowerPoint

Table 3. PCR products and restriction fragments of 5.8S-ITS regions obtained for reference strains and strains ABT301 and ABT601. The three different 5.85-ITS copies of strain ABT301 (in bold)
StrainAmp*Restriction profile**
HaeIIIHinfICfoI
  • *

    Amplicon length (bp).

  • **

    Fragments smaller than 50 bp are not included in this table.

  • ***

    Extra PCR fragments. The PCR products of strain in bold were submitted to cloning and sequencing.

ABT301 ABT601710(700)***(510)–480–390–250–210–170500–350–250–220–150360–350–280–200–180
Z. bailii DBVPG 6920800700–100360–230–180310–280–110
Z. rouxii CBS 732T, ABT808750390–210–90360–250–150290–200–170–90
Z. mellis CBS 736T, ABT408800560–200–90400–270–180350–250–210

Cloning of 5.8S-ITS rDNA PCR products and sequencing

To explore the 5.8S-ITS rDNA region in the strain ABT301, 19 plasmids containing the ITS1-4 PCR product as an insert were reamplified with the same primers and then HaeIII-digested. The insert reamplification, using a high fidelity DNA polymerase, was necessary before the restriction step to avoid the interference of overlapping fragments coming from digestion of the vector backbone. We obtained three different inserts, copies 1, 2 and 3, respectively, that showed distinctive restriction patterns, as reported in Figure 1. Copy 1 had a HaeIII restriction profile identical to Z. rouxii CBS 732T 5.8S-ITS rDNA, with three bands of 390, 210 and 90 bp, respectively. Copy 2 showed two bands of 480 and 170 bp. Copy 3 showed a HaeIII restriction profile very similar to that of copy 2, but with a larger fragment of 510 bp (Figure 1, line 2). The combination of restriction profiles of the copies 1, 2 and 3 justified the complex 5.8S-ITS rDNA region restriction pattern of strain ABT301 (Figure 1, line 1), except for an extra band of 250 bp (Figure 1, line 1, marked with an asterisk), which was not present in the restriction profile of any 5.8S-ITS copy.

Sequencing of 5.8S-ITS copies

The complex 5.8S-ITS rDNA restriction map of ABT301 was confirmed through in silico sequence analyses of the three cloned 5.8S-ITS copies (GenBank Accession Nos in Table 1). The sequence of 5.8S-ITS copy 1 was closely related to the Z. rouxii type strain (sequence identity 98.3%), confirming the restriction data. In contrast, the sequences of 5.8S-ITS copies 2 and 3 were more similar to each other (sequence identity 83.6%) and both differed significantly from the copy 1 sequence (divergence 14.7% and 23.5%, respectively) and from the Z. rouxii CBS 732T strain 5.8S-ITS sequence (divergence 17.2% and 26.7%, respectively). Copies 2 and 3 shared a common core sequence of 157 bp, corresponding to the highly conserved 5.8S rRNA gene. Copies 2 and 3 differed in their ITS1 regions only in the presence of one nucleotide deletion at position 47 in copy 2, whereas the highest divergence was found in the ITS2 region. Similarly, copy 1 showed a well-conserved central portion of 157 nucleotides, already described in copies 2 and 3, with the exception of a single nucleotide substitution. At the same time, the highest degree of variability between copy 1 and copies 2 and 3 was placed inside the ITS1 and ITS2 regions.

The 5.8S-ITS-derived NJ tree displayed how the 5.8S-ITS copies 2 and 3 were phylogenetically quite separate from both the 5.8S-ITS copy 1 and the 5.8S-ITS sequence of Z. rouxii CBS 732T strain and were more closely related to the Z. mellis CBS 736T 5.8S-ITS sequence (Figure 2).

thumbnail image

Figure 2. Phylogenetic tree showing the relationship among the three different 5.8S-ITS copies of strain ABT301 and 5.8S-ITS sequences of Zygosaccharomyces species retrieved from the EMBL database. Z. bailii CBS 680T 5.8S-ITS sequence was used as the outgroup. The dendogram was constructed using the neighbour-joining method; bootstrap values (expressed in percentages) were calculated from 1000 replications and were given at branch nodes (only values > 50% are shown). Scale bar represents 0.05 substitutions per nucleotide position

Download figure to PowerPoint

Cloning of extra bands

In the ABT301 strain, the sequencing data from copies 1, 2 and 3 accounted for the complex HaeIII restriction map of the amplified 5.8S-ITS region, except for the occurrence of a 250 bp extra band (Figure 1A). We supposed that there was another variant of the 5.8S-ITS sequence with a different set of HaeIII sites that possibly slipped out of the cloning. To test this hypothesis, the fragment was excised from the agarose gel, cloned and sequenced. The resulting sequence aligned with the 3′ end of the copy 1 sequence and contained an HaeIII restriction site not recognized by the specific endonuclease. This finding suggested that the extra band probably arose from a partial digestion of copy 1 and not from an uncloned 5.8S-ITS region.

D1/D2 26S rDNA sequencing

Since the 26S rDNA gene has been shown to have a high taxonomic value (Kurtzman and Robnett, 1998), we performed the D1/D2 26S rDNA sequencing in the strains ABT301 and ABT601, as well as in the Z. rouxii strain ABT808 and the Z. mellis strain ABT408 (Solieri et al., 2006). The partial sequences of D1/D2 26S rDNA showed that strains ABT301 and ABT601 had only one type of 26S D1/D2 sequence, significantly different from those retrieved for the Z. mellis strain CBS 736T (identities 93.1% and 92.7%, respectively) and the Z. rouxii strain CBS 732T (94.7% and 96.1%, respectively). Indeed, these 26S D1/D2 sequences were very similar (ABT301) or identical (ABT601) to that of the Z. pseudorouxii strain NCYC 3042 (sequence similarity 98.5% and 100%, respectively).

A phylogenetic NJ tree was constructed on the D1/D2 26S partial sequences to depict the relationship among these strains, the strains NCYC 3042 and NCYC 1682 described by James and co-workers (2005) and the main species belonging to Zygosaccharomyces sensu stricto group. The strains ABT808 and ABT401 clustered with Z. rouxii strain CBST 732 and Z. mellis strain CBS 736T, respectively. The strains ABT301 and ABT601 grouped into a well-supported monophyletic clade together with Z. pseudorouxii NCYC 3042. This phylogenetic reconstruction is congruent with that previously reported by James et al. (2005) for the same rDNA region and with that obtained from the 5.8S-ITS region sequence analysis.

COX2, SOD2 and HIS3 gene sequencing

The taxonomic status of our strains was further explored by additional sequence analyses of the mitochondrial-encoded gene COX2 and the nuclear-encoded SOD2 and HIS3 genes. In agreement with the results obtained by D1/D2 and 5.8S-ITS sequence analysis, strain ABT808 was found to possess a COX2 sequence identical to that of Z. rouxii strain CBS 732T. In contrast, strains ABT601 and ABT301 showed COX2 sequences similar but not identical to the COX2 sequences of Z. mellis CBS 736T (sequence identities 97.7% and 97.5%, respectively) and Z. rouxii CBS 732T (sequence identities 98.1% and 97.9%, respectively). On the basis of the COX2-derived NJ tree, strains ABT301 and ABT601 were phylogenetically related to both Z. rouxii and Z. mellis (Figure 3).

thumbnail image

Figure 3. Phylogenetic neighbour-joining tree, based on COX2 sequences, depicting the relationships among strains ABT301 and ABT601, hybrid strain NCYC 1682 and some Z. rouxii and Z. mellis strains. The COX2 sequences were retrieved from the EMBL database, except for those printed in bold, which were determined during this study. Z. bailii CBS 680T partial COX2 sequence was used as the outgroup. Bootstrap values (expressed in percentages) were calculated from 1000 replications and were given at branch nodes (only values > 50% are shown). Scale bar represents 0.01 substitutions per nucleotide position

Download figure to PowerPoint

Regarding the nuclear-encoded SOD2 gene, we tried to clone two different SOD2 genes, previously characterized in Z. rouxii ATCC 42981 (Iwaki et al., 1998; Watanabe et al., 1991, 1995) and in the hybrid strain NCYC 1682 (James et al., 2005). The SOD1F/SOD1R primer pair was selected to amplify the Z. rouxii CBS 732TZrSOD2-22 gene and the SOD2F/SOD2R primer set was specifically designed to amplify the Z. rouxii ATCC 42981/NCYC3042 ZSOD22 variant. The SOD2F/SOD2R primer set failed to amplify genomic DNA sequences from Z. rouxii ABT808. However, when the SOD1F/SOD1R primer pair was employed, we obtained a 600 bp fragment. The sequence of this PCR product was identical to that of the gene ZrSOD2-22.

The genomic DNA amplification of strains ABT301 and ABT601 succeeded with both primer pairs, SOD1F/SOD1R and SOD2F/SOD2R. The nucleotide sequences of the two DNA amplified fragments revealed that in strains ABT301 and ABT601 two slightly different SOD2 genes are present. As shown in Figure 4, the two SOD2 copies were phylogenetically quite separated from each other. One, which we refer to as SOD2 copy 1, was more closely related to the CBS 732TZrSOD2-22 gene (sequence identity 99.4%) than to ATCC 42981 ZSOD2 (sequence identity 96.9%). The putative C-terminal portion of the Sod2 Na+/H+ antiporter in ABT301 and ABT601 had N123K and S45F amino acid substitutions compared to CBS 732T ZrSod2-22p (Kinclová et al., 2001). The latter amino acid substitution also distinguished the Sod2p copy 1 of strains ABT301 and ABT601 from Z. rouxii ATCC 42981 ZSod2p, in addition to a 15 amino acid insertion between residues P127 and V143 (Figure 5). The nucleotide sequence of the second copy amplified from strains ABT301 and ABT601, which we named SOD2 copy 2, differed only by either a single base substitution (ABT301) or by one single base substitution plus a single base deletion (ABT601) from the ZSOD22 copy present in both ATCC 42981 and NCYC 1682 strains (Iwaki et al., 1998; James et al., 2005). The ABT301 and ABT601 SOD2 copy 2 sequences encoded a C-terminal portion of the Sod2 Na+/H+ antiporter identical to NCYC 1682 Sod2p copy 2 and very similar to the NCYC 3042 ZSod22p (single amino acid substitution, V142I; Figure 5).

thumbnail image

Figure 4. Phylogenetic neighbour-joining tree of different Zygosaacharomyces strains derived from CLUSTAL W analysis of partial ZrSOD2-22, ZSOD2 and ZSOD22 gene sequences. The ZrSOD2-22, ZSOD2 and ZSOD22 gene sequences were retrieved from the EMBL database, except for those printed in bold, which were determined during this study. Bootstrap values (expressed in percentages) were calculated from 1000 replications and were given at branch nodes (only values > 50% are shown). Scale bar represents 0.01 substitutions per nucleotide position

Download figure to PowerPoint

thumbnail image

Figure 5. Amino acid alignment of C-terminal portion of SOD2 proteins from ABT301, ABT601, Z. rouxii and other Z. rouxii-related strains: Z. rouxii CBS 732 ZrSod2-22p; Z. rouxii ABT808 ZrSod2-22p; Z. pseudorouxii NCYC 3042 ZSod22p; hybrid NCYC 1682 copy 2 ZSod22p; ABT301 and ABT601 copy1 ZrSod2-22p; Z. rouxii NCYC 1682 copy 1 ZSod2p and ATCC 42981 ZSod2p; ABT301 and ABT601 copy2 ZrSod22p. The difference between ABT301 and ABT601 ZrSod2-22p copy1 and ZrSod2-22p of strains CBS 732T and ABT808 are shown underlined and in bold. The differences between ZrSod2-22p and ZSod22p are printed in grey

Download figure to PowerPoint

Similarly, partial HIS3 gene amplification was performed in strains ABT301, ABT601 and Z. rouxii ABT808. Two different primer pairs were employed: HIS3F/HIS1R for the CBS 732THIS3 gene, and HIS2F/HIS2R for the ATCC 42981 HIS3 gene. One single amplicon was obtained for strain ABT808, using the primer pair HIS3F/HIS1R. In contrast, a successful amplification resulted from both primer pairs in strains ABT301 and ABT601. This result revealed the presence of two different HIS3 variants in the genomes of strains ABT301 and ABT601, which were indicated as HIS3 copy 1 (obtained with HIS3F/HIS1R) and HIS3 copy 2 (obtained with HIS2F/HIS2R). The nucleotide sequences of HIS3 copy 1 differed for two single base substitutions from CBS 732THIS3 (Kinclová et al., 2001). Copy 2 was identical to HIS3 copy 2 found in NCYC 1682 hybrid strains and to Z. pseudorouxii strain NCYC 3042 (James et al., 2005). The HIS3-derived NJ tree confirmed that two HIS3 copies belonged to two different phylogenetic lineages, as shown in Figure 6. However, nucleotide sequences of HIS3 copies 1 and 2 encoded two very similar C-terminal portions, different for only one residue (Y79C) of a imidazole glicerol-phosphate dehydratase.

thumbnail image

Figure 6. Phylogenetic neighbour-joining tree of different Z. rouxii and Z. rouxii-related strains derived from CLUSTAL W analysis of partial HIS3 gene sequences. The HIS3 gene sequences were retrieved from the EMBL database, except for those printed in bold, which were determined during this study. The Z. bailii ATCC 36947 HIS3 gene sequence was used as the outgroup. Bootstrap values (expressed in percentages) were calculated from 1000 replications and are given at branch nodes (only values > 50% are shown). Scale bar represents 0.02 substitutions per nucleotide position

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. References

Molecular phylogenetic analysis of closely related yeast species relies upon the identification of rapidly evolving DNA molecules that contain sufficient interspecific variability to be informative, but intraspecific variation too minimal to be conclusive. For 15 years, the assignment of unknown strains to yeast species, genera and families has been commonly based on sequencing and molecular comparison of several regions (5.8S-ITS, D1/D2 26S and 18S) of rDNA unit repeats. In addition, nuclear and mitochondrial gene sequences have been exploited to elucidate phylogenetic relationships among yeast species and to obtain a correct yeast identification. The current study investigated the taxonomic status of two osmotolerant Zygosaccharomyces yeast strains, using a multi-gene approach that considers groups of genes that are believed to be functional and genetically unlinked. This group includes genes of the rDNA repeat (5.8S, ITS and 26S rDNA D1/D2 domain), the COX2 mitochondrial gene and two nuclear genes (SOD2 and HIS3).

5.8S-ITS polymorphism

The rDNA ITS regions have been widely used as molecular markers in phylogenetic studies of closely related Zygosaccharomyces species, due to their high evolutionary rates (James et al., 1996). PCR and restriction analysis of the 5.8S-ITS region of Zygosaccharomyces type strains was also considered a rapid and effective method for differentiating yeast species involved in food and beverage fermentation and spoilage. This method has been able to assign different restriction fragment length polymorphism (RFLP) fingerprinting to every species, except for Z. cidri and Z. fermentati (Esteve-Zarzoso et al., 2003). However, intraspecific variation in the ITS region had already been reported by some authors within the species Z. rouxii and Z. bailii (Kurtzman and Robnett, 2003; James et al., 1996). Strains ABT301 and ABT601 seem to be unusually polymorphic with respect to ITS regions, showing three highly divergent 5.8S-ITS sequences, one Z. rouxii-like (copy 1), the other two showing a Z. mellis 5.8S sequence and two flanking ITS regions divergent from both Z. mellis and Z. rouxii (copies 2 and 3). In a previous work, heterologous ITS copies were observed in one Z. rouxii wild strain isolated from miso (Sujaya et al., 2003) and several examples of ITS and more in general rDNA polymorphisms have been also reported in other yeasts (Lachance et al., 2003), as well as in other taxa of fungi (Ko and Jung, 2002).

Although rDNA repeats are best known for the high degree of intraspecific homogeneity resulting from concerted evolution, another evolutionary mechanism involving ribosomal units has been described in eukaryotic genomics, where an ‘non-concerted’ evolution can be a stable genetic condition in which some copies of a tandem repetitive gene are pseudogenes in addition to functional copies (Buckler et al., 1997). Van der Sande et al. (1992) and Musters et al. (1990) have demonstrated that both ITS regions play a primary role in rRNA processing. Deletions or mutations within ITS2, complete omission of ITS2 or replacement of ITS2 in Saccharomyces cerevisiae and in other yeasts result in failure to produce mature 5.8S and 26S rRNAs (Musters et al.,1990; van der Sande et al., 1992; van Nues et al., 1995; Cote and Peculis, 2001). The occurrence of mutations impairing the functional role of some ITS regions could act as a source of pseudogenes in addition to functional rDNA copies. Therefore, intraspecific mutations may be easily accumulated in pseudogenes, whereas the functional rDNA repeats are homogenized within the genome by fixing polymorphisms at the interspecific level.

The presence of multiple intra-individual ITS copies adds new complexity to the use of rDNA sequences for taxonomic analysis and Zygosaccharomyces species designations based on molecular methods. Nevertheless, ITS sequence analysis does not exclude that the strains ABT301 and ABT601 belong to a young hybridogenous taxon. Furthermore, characterization of the complete rDNA gene loci from our strains could reveal whether the observed sequence polymorphisms represent distinct rRNA gene units or variability within a single unit.

Mitochondrial COX2 sequences

The COX2 sequence has been exploited by many authors to elucidate the phylogenetic relationships within the genus Kluyveromyces (Belloch et al., 2000) and more generally among ascomycetous yeast species (Kurtzman and Robnett, 2003). With regard to Zygosaccharomyces, the low nucleotide divergence of the COX2 gene between the Z. rouxii and Z. mellis type strains is in agreement with their phylogenetic relatedness, as shown by ITS rDNA sequence (James et al., 1998). Z. pseudorouxii NCYC 3042 shows a COX2 sequence identical to that of the Z. mellis type strain, whereas the hybrid strain NCYC 1682 shows a COX2 sequence identical to that of Z. rouxii (James et al., 2005). Strains ABT301 and ABT601 showed COX2 partial sequences similar but not identical to that of both Z. rouxii and Z. mellis. The phylogenetic COX2 tree is congruent with the 5.8S-ITS rDNA tree; however, the high sequence similarity level indicates that this gene sequence could be poorly informative for very closely related species, such as Z. rouxii, Z. pseudorouxii and Z. mellis.

Protein-encoding nuclear genes SOD2 and HIS3

The SOD2 nuclear gene is located on chromosome IV of the Z. rouxii CBS 732T type strain and it has been studied in depth because it encodes an Na+/H+ antiporter involved in halotolerance. As reported by Watanabe et al. (1995), Z. rouxii wild strain ATCC 42981 shows two different SOD2 copies (SOD2 and SOD22), although it has been reported as a haploid strain (Iwaki et al., 1998). Similar condition was described for the hybrid strain NCYC 1682 (James et al., 2005). On the other hand, in Z. pseudorouxii strain NCYC 3042, only one SOD2 gene copy, ZSOD22, has been detected (James et al., 2005). In the Z. rouxii CBS 732T strain genome a single SOD2 copy is present, indicated as ZrSOD2-22, a kind of chimeric gene between the ZSOD2 and ZSOD22 genes (Kinclová et al., 2001). Our strains showed two types of SOD2 gene with rather divergent nucleotide sequences. According to James and co-workers (2005), the occurence of two divergent SOD2 copies could support the hypothesis that our strains are hybrids. Nevertheless, unlike hybrid strain NCYC 1682 and Z. rouxii wild strain ATCC 42981, the strains ABT301 and ABT601 have one Z. rouxii-like copy, identical to ZrSOD2-22, and a second copy identical to the ZSOD22 gene. By examining the phylogenetic SOD2-based tree, the couple ZrSOD2-22/ZSOD22 in ABT301 and ABT601 strains appears to be more evolutionarily related than the ZSOD2/ZSOD22 pair present in hybrid strain NCYC 1682 (Figure 4). In addition, when we compared the Sod2 amino acid sequences in ABT301 and ABT601 strains, the divergence between ZrSod2-22p and ZSod22p was drastically reduced to one mutation (F45S) and to one in frame deletion of two amino acids (Figure 5). In contrast, the genetic variability in the NCYC 1682 hybrid strain leads to a larger amino acid divergence between ZSod2p and ZSod22p, due to a deletion of 25 residues in the former. Watanabe and co-workers (1995) have demonstrated in Z. rouxii ATCC 42981 that only ZSOD2 (and not ZSOD22) is actively transcribed. Actually, we did not perform any transcriptional assay, therefore it can not be ruled out that the same occurs in strains ABT 301 and ABT601. These strains probably have at least one functional copy, since ZrSOD2-22 is functional in strain CBS 732T, where it is the only SOD2 gene (Kinclová et al., 2001).

The cloning study on the nuclear gene HIS3 has demonstrated that the type strain Z. rouxii CBS 732T possesses only one ZrHIS3 copy located on chromosome VI (Sychrova et al., 2000). Similarly, Z. pseudorouxii strain NCYC 3042 shows one single copy of ZHIS3, but is quite distant from that of the Z. rouxii type strain (James et al., 2005). In strains ABT301 and ABT601 there are at least two copies of ZrHIS3; one is identical to Z. pseudorouxii strain NCYC 3042, the other similar to Z. rouxii, as in the hybrid NCYC 1682. According to James and co-workers (2005), our strains could be hybrids originated from two Zygosaccharomyces species, Z. rouxii and Z. pseudorouxii. However, if we consider the amino acid sequence of two copies, we can observe that only one substitution is present. Indeed, the high amino acid homology between the Z. pseudorouxii-like copy and the Z. rouxii-like copy could mean that there are intraspecific variants within the ABT301 and ABT601 genomes, rather than interspecific alleles provided by two distinct parental genomes.

26S D1/D2 phylogenetic inference

Sequence divergence > 1% in the D1/D2 region of 26S rDNA is frequently used as a guideline to predict the species boundaries, as well as to delineate ascomycetous yeast phylogenetic relationships (Kurtzman and Robnett, 1998). Analysis of the variable ca. 600 nucleotides of the D1/D2 domain showed that ABT301 and ABT601 are very similar to the putative novel Z. pseudorouxii species (James et al., 2005), which differs from all currently acknowledged Zygosaccharomyces species. Remarkably, our strains possess only one type of D1/D2 sequence, but their ITS rDNA regions are highly heterogeneous, since the homogenization of rDNA repeats is usually greater in encoding regions, e.g. 26S, than in the transcribed but not encoded spacers, e.g. ITS. This finding could further suggest that ABT301 and ABT601 have rDNA units, consisting of a constant D1/D2 domain associated with polymorphic 5.8S-ITS regions. The presence of a unique type of D1/D2 region in the ABT301 and ABT601 genomes may exclude that they are hybrids between Z. rouxii and the novel putative Z. pseudorouxii species.

Whether the gene polymorphisms described in this paper represent intra- or inter-allelic variants is still an open question, even considering that the ploidy status in the Z. rouxii clade may be variable, e.g. the Z. rouxii ATCC 42981 strain is considered haploid (Iwaki et al., 1998), even though it has two different SOD2 copies, but other Z. rouxii strains, such as CBS 732T, are diploid (de Montigny et al., 2000; Sujaya et al., 2003). Such heterogeneity in the gene copy numbers and sequences (e.g. SOD2 and HIS3) could be also explained by a gene amplification/reduction event that occurred during evolution. These random events could have reduced the HIS3 and SOD2 copy numbers to one within the Z. rouxii genome but not within the genome of other Zygosaccharomyces species.

Independently from any attempt to speculate on the origins of sequence polymorphisms of ITS, SOD2 and HIS3, the findings obtained using a multi-gene sequence approach suggest that ABT301 and ABT601 are distinctly different strains from other Zygosaccharomyces strains considered in this work, and could belong to a new putative species highly related to Z. rouxii, although further genomic fingerprinting investigations are necessary to evaluate their genomic assessment.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. References