Gain-of-function mutation in the KlPDR1 gene encoding multidrug resistance regulator in Kluyveromyces lactis

Authors


Correspondence to: Y. Gbelska, Department of Microbiology and Virology, Comenius University in Bratislava, 842 15 Bratislava 4, Slovak Republic.

E-mail: gbelska@fns.uniba.sk

Abstract

KlPdr1p is a single Kluyveromyces lactis homologue of Saccharomyces cerevisiae ScPdr1p/ScPdr3p, the main transcriptional regulators of genes involved in S. cerevisiae multidrug resistance. KlPDR1 deletion leads to a sharp increase in K. lactis drug susceptibility. The presence of putative PDRE and YRE regulatory elements in the KlPDR1 gene promoter suggests an autoregulation of its transcription as well as its control by KlYap1p, the transcription factor involved in oxidative stress response. In this study, one plasmid-borne Klpdr1-1 allele that led to amino acid substitution (L273P) in the KlPdr1p was isolated. Overexpression of the Klpdr1-1 allele from a multicopy plasmid in the K. lactis wild-type and Klpdr1Δ mutant strain increased the tolerance of transformants to oligomycin. The plasmid-borne Klpdr1-1 allele increased the activation of the ScPDR5 promoter and complemented the drug hypersensitivity of the S. cerevisiae pdr1Δ pdr3Δ mutant strain. The results indicate that L273P amino acid substitution is the result of a gain-of-function mutation in the KlPDR1 gene that confers KlPdr1p hyperactivity, as revealed by a high expression of the ABC transporter gene KlPDR5, leading to multidrug resistance and rhodamine 6G efflux out of the cells. Copyright © 2013 John Wiley & Sons, Ltd.

Introduction

Multidrug resistance in cancer cells, parasites, bacterial and fungal pathogens is often acquired through the activation of multidrug efflux pumps belonging to the ATP-binding cassette (ABC) or major facilitator superfamilies (MFS). This activation occurs mainly at the transcriptional level. Therefore, regulation of these transporters is of pivotal importance to understanding drug resistance. The years of research using the model yeast Saccharomyces cerevisiae, aimed at definition of the transcription regulatory networks that control the expression of multidrug transporters, led to the finding that the pleiotropic drug resistance (PDR) network includes nearly 500 target genes with a broad scope of biological functions (Balzi and Goffeau, 1991; Kolaczkowska and Goffeau, 1999; deRisi et al., 2000). It appears that major mechanisms of resistance are essential, due to the deregulation of antifungal resistance effector genes. The deregulation is a consequence of point mutations occurring in transcriptional regulators of these effector genes (Carvajal et al., 1997; Nourani et al., 1997; Simonics et al., 2000; Le Crom et al., 2002; Mamnun et al., 2002; Coste et al., 2004; Tsai et al., 2006; Fardeau et al., 2007; Ferrari et al., 2009; Morschhäuser, 2010).

In S. cerevisiae, two homologous transcription factors, ScPdr1p and ScPdr3p, are the main regulators controlling the expression of multidrug efflux pumps (Balzi et al., 1987; Delaveau et al., 1994). ScPdr1p and ScPdr3p exert transcriptional control through a motif called the pleiotropic drug resistance element (PDRE), which is present in variant forms and varying numbers in the promoters of PDR-responsive genes (Katzmann et al., 1994). Spontaneous dominant or semi-dominant point mutations at the ScPDR1 or ScPDR3 loci lead to the development of multidrug resistance. This results from active extrusion of drugs from the cell, and modification of their passive diffusion into the cell as a consequence of alterations in the lipid composition of the membrane bilayer. ScPdr1p and ScPdr3p belong to the large Gal4p family of fungal transcriptional regulators which share a conserved Zn(II)2Cys6 motif in their DNA-binding domains. Significant advances in our understanding of the molecular basis of multidrug resistance and its regulation in human-pathogenic fungi have been made in recent years. For Candida albicans and Candida glabrata, the key transcription factors which control the expression of efflux pumps mediating drug resistance and the mutations that result in constitutive overexpression of their target genes have been elucidated (Vermitsky and Edlind, 2004; Coste et al., 2004; Tsai et al., 2006; Morschhäuser, 2010; Ferrari et al., 2009). Insight into how these regulators may be activated in response to drugs and toxic compounds have come from studies in the model yeast S. cerevisiae and its pathogenic relative C. glabrata, where it was shown that drugs directly bind to a discrete xenobiotic binding domain (XBD) in the Pdr1p/Pdr3p transcription factors. The transcription factors then bind via their C-terminal activation domain to the Gal11 subunit of the mediator complex, which results in the recruitment of RNA polymerase II to the promoters of Pdr1p/Pdr3p target genes. The XBD and the C-terminal transcription activation domain together form a large xenobiotic-responsive transactivation domain (amino acids 352–1063 of ScPdr1p) that retains its function when fused to a heterologous DNA-binding domain (Thakur et al., 2008).

Similar to the autoregulation of ScPdr3p in S. cerevisiae (Delahodde et al., 1995), the zinc cluster transcription factors controlling the expression of drug efflux pumps in C. albicans and C. glabrata, Tac1p, Mrr1p and CgPdr1p, respectively, also induce their own expression, which may allow a stronger response to inducing conditions and increased upregulation of the efflux pumps in drug-resistant strains containing hyperactive alleles of the transcription factors (Vermitsky and Edlind, 2004; Tsai et al., 2006; Vermitsky et al., 2006; Morschhäuser, 2010; Znaidi et al., 2007). However, increased CgPDR1 expression was not observed in all azole-resistant C. glabrata isolates with CgPDR1 gain-of-function mutations, and the importance of CgPdr1p autoregulation for drug resistance in clinical isolates was thus questioned. Recently, it has been found that the gain-of-function mutations in CgPDR1 are important not only for azole resistance in C. glabrata but also for fungal–host interactions (Ferrari et al., 2011).

The ability to tolerate chemical stress is also an important asset in industrial microbial strains. Kluyveromyces lactis is a biotechnologically important yeast species able to use a wide spectrum of carbon sources. The biotechnological significance of K. lactis builds on its history of safe use in the food industry and its well-known ability to produce enzymes like lactase and bovine chymosine on an industrial scale (van Ooyen et al., 2006). As many herbicides and pesticides are used in today's agriculture to protect crops and increase their wealth, the use in biotechnology of host strains resistant to the hydrophobic organic compounds is rewarding. For K. lactis, our knowledge of multidrug resistance (MDR) regulation is much more limited than for S. cerevisiae and pathogenic yeast species. In K. lactis, a single orthologue of the ScPDR1/ScPDR3 genes, named KlPDR1, has been identified (Dujon et al., 2004; Bussereau et al., 2006). This gene belongs to the family of zinc finger transcription factors and combines, in a single gene, properties shared by its orthologues ScPDR1/ScPDR3 from S. cerevisiae. Deletion of KlPDR1 results in a loss of transcriptional control of the major drug efflux transporter encoding gene KlPDR5 and, consequently, decreased drug resistance (Balkova et al., 2009). In this study, we isolated gain-of-function KlPDR1 mutant allele and tested its relevance for multidrug resistance in K. lactis.

Materials and methods

Strains and culture conditions

The K. lactis strain employed in this work was PM6-7A (MATa uraA1 ade2 Rag+ pKD1+) (Chen et al., 1992), its isogenic mutant strain K. lactis PM6-7A/pdr1Δ (MATa, uraA1, ade2, pdr1::kanMX, Rag+, pKD1+) deleted in KlPDR1 ORF (Balkova et al., 2009) and the mutant strain PM6-7A/pdr1-1 harbouring the gain-of-function allele of the KlPDR1 gene (this paper). S. cerevisiae strain used in this study was FY1679-28C/TDEC (MATa ura3-52 trp∆63 leu2∆1 his3∆200 pdr1::TRP1 pdr3::HIS3) (Delaveau et al., 1994). Cells were grown on glucose-rich (YPD) medium (2% glucose, 1% yeast extract, 2% bactopeptone), glycerol-rich (YPG) medium (as YPD but 2% glycerol used instead of 2% glucose) or minimal (YNB) medium (0.67% yeast nitrogen base without amino acids, 2% glucose or 2% glycerol plus 2% ethanol and appropriate nutritional requirements). The media were solidified with 2% bactoagar. The Escherichia coli XL1-Blue strain was used as a host for plasmid constructions and propagation. The bacterial strains were grown at 37°C in Luria–Bertani (LB) medium (1% tryptone, 1% NaCl, 0.5% yeast extract, pH 7.5) supplemented with 100 µg/ml ampicillin for selection of transformants.

Genetic manipulations, transformations and DNA preparations

Standard protocols for generating recombinant DNAs, the restriction enzyme analyses, gel electrophoresis and hybridization were used (Sambrook et al., 1989). Plasmid DNA from E. coli was prepared by the alkaline-lysis method. K. lactis strains were transformed by electroporation (Sánchez et al., 1993, using a Bio-Rad gene pulser at 1.0 kV, 25 μF and 400 Ω in 0.2 cm cuvettes. A 3.9 kb PstI–KpnI fragment containing the wild-type KlPDR1 gene, originated from the pCR2.1–KlPDR1 plasmid (Balkova et al., 2009), was ligated into PstI–KpnI-digested pCXJ18 (Klori, KlCEN2, URA3, ori, AmpR) or pRS306K vector (2 µm, KARS2, ARS1, URA3, ori, AmpR) respectively (Heus et al., 1994; Chen, 1996) and used to transform the K. lactis wild-type (PM6-7A) and its isogenic Klpdr1Δ strain. Plasmid PPDR5-lacZ used in β-galactosidase assays contains the lacZ gene fused with the promoter of the ScPDR5 gene (Nourani et al., 1997).

Drug susceptibility testing

Yeast cultures were grown overnight in YNB, diluted to a density of 1.0 × 107 cells/ml and 10-fold dilutions were performed. Cell suspensions in 5 µl aliquots were spotted onto YNB plates containing drugs. The growth was scored after 5 days of incubation at 30°C.

Quantitative real-time PCR

Yeast cells were grown in minimal medium containing glucose to the mid-logarithmic phase. Total RNA was isolated by the hot acidic phenol extraction method (Ausubel et al., 1989). RNA concentrations were determined spectrophotometrically. Oligonucleotides used for qPCR are listed in Table 1. First-strand cDNA was synthesized from 1 µg total RNA in a 20 µl reaction volume, using 200 U Revert AidTMH Minus M-MuLV Reverse Transcriptase (MBI Fermentas, Vilnius, Lithuania). Quantitative real-time PCRs were performed in triplicate, using the 7900 HT Fast Real-Time PCR System (Applied Biosystems, Foster City, USA). Independent PCRs were performed using the same cDNA for both the gene of interest and the KlACT1 gene, using the ABsoluteTM QPCR SYBR Green ROX Mix (Thermo Scientific, ABgene, Germany). The PCR conditions consisted of polymerase activation at 95οC for 15 min, followed by 40 cycles of denaturation at 95οC for 30 s and annealing/extension at 60οC for 1 min. A dissociation curve was generated at the end of each PCR cycle to verify that a single product was amplified, using software provided with the 7900 Sequence Detection System. The change in fluorescence of SYBR Green dye in every cycle was monitored by the system software, and the threshold cycle (C t) above the background for each reaction was calculated. The C t value of KlACT1 RNA was subtracted from that of the gene of interest to obtain the ΔC t value. The ΔC t value of an arbitrary calibrator (e.g. untreated sample) was subtracted from the ΔC t value of each sample to obtain a ΔΔC t value. The gene expression level relative to the calibrator was expressed as 2–ΔΔC t.

Table 1. List of oligonucleotides used
PurposeGeneSequence (5′→3′)
ForwardReverse
qPCRKlACT1acacctaacctacccaaactcaataactaaagcagcgac
 KlPDR5aggtacgagggtgtgaatcatattcttgatccacgcag
PCRKlPDR1gatatactcgagcaactattccttctcagtggatcaaagcttgaacgacataagagtaacg

Rhodamine 6G accumulation and efflux

The accumulation of rhodamine 6G (Sigma-Aldrich, Tankirchen, Germany) was measured by flow cytometry in a Beckman Coulter FC 500 cell cytometer, as described by Sidorova et al. (2007). Active efflux of rhodamine 6G was determined as described previously (Kolaczkowski et al., 1996; Nakamura et al., 2001; Mukhopadhyay et al., 2002). Approximately 108 cells from an overnight culture were incubated in 100 ml YPD medium and grown for 5 h at 30°C. The cells were pelleted and washed three times with 50 m m HEPES, pH 7.0. The cells were resuspended in 50 m m HEPES containing 2 m m 2-deoxyglucose and 10 μ m rhodamine 6G to a concentration of 107cells/ml and shaken for 2 h at 30°C to exhaust the energy and allow rhodamine 6G accumulation. The cells were then washed three times and resuspended in 50 m m HEPES, pH 7.0, to a concentration of 108 cells/ml. At specific time intervals after addition of glucose (final concentration, 2 m m) to initiate rhodamine 6G efflux, the cells were centrifuged and 100 µl supernatants were added to Nunc 96-well fluoro-/luminunc plates (Nagle Nunc International, Rochester, NY, USA). Rhodamine 6G fluorescences of the samples were measured at an excitation wavelength of 515 nm and an emission wavelength of 555 nm, using a Tecan Saphir II TM spectrofluorimeter (Tecan Austria GmbH, Grődig/Salzburg, Austria). Statistical significance between values in different strains was determined by paired Student's t-test analyses; p < 0.05 was considered to be significant.

β-Galactosidase assays

The transactivational effect of the pdr1-1 allele on the PDR5 target promoter was assessed by measurement of β-galactosidase activity in crude extracts of transformants grown to mid-log phase, as described by Miller (1972). The activity was normalized with protein concentrations assayed by the method of Bradford (1976). Each reported value represents the average of determination [± standard deviation (SD)] from four independent transformants.

Results

Isolation of Klpdr1 mutant alleles

The Klpdr1 mutant alleles were isolated from spontaneously generated clones of wild-type K. lactis strain PM6-7A that were able to grow on YPG supplemented with oligomycin at 1.5 µg/ml, a concentration sufficient to inhibit the growth of the wild-type cells. Two oligomycin resistant mutants exhibiting simultaneous resistance to oligomycin and antifungal azoles (fluconazole, itraconazole, ketoconazole, miconazole) were selected to investigate the molecular mechanisms underlying the development of their drug resistance (as the potential sources of mutated form of the KlPDR1 gene). The KlPDR1 gene from selected mutants was PCR-amplified using the genomic DNA and pairs of gene specific primers (Table 1). Sequences of the resulting amplicons were determined and compared with the published KlPDR1 sequence. In one amplicon, the nucleotide substitution T818C led to L273P amino acid alteration in KlPdr1p. In the second amplicon, the transversion A2404C led to M802L amino acid substitution in the KlPdr1p. To prove that these mutations are responsible for the cell's observed resistance to oligomycin and antifungal azoles, the drug susceptibilities of transformants of the K. lactis PM6-7A wild-type strain as well as its isogenic K. lactis PM6-7A/pdr1∆ mutant strain containing the plasmid born KlPDR1 mutant alleles were determined.

Compared with the wild-type strain K. lactis PM6-7A or its transformants containing the wild-type KlPDR1 gene, on either centromeric or multicopy plasmid, only the presence of one mutant allele, named Klpdr1-1, corresponding to the L273P substitution in the KlPdr1p, led to increased resistance of transformants to oligomycin (Figure 1A) and the antifungal azoles tested (Figure 2). This allele also complemented the oligomycin hypersensitivity phenotype of the deletion mutant strain K. lactis PM6-7A/pdr1∆ (Figure 1B). The second mutation identified (Klpdr1-2) in the KlPDR1 gene, leading to M802L amino acid substitution in the KlPdr1p, did not alter the susceptibility of transformants to the drugs tested compared to the wild-type strain (Figures 1A, 2). Based on these observations, we propose that the M802L amino acid substitution in the KlPdr1p did not alter the function of this transcription factor and represents the natural polymorphism of the KlPdr1p.

Figure 1.

Drug susceptibility testing of K. lactis wild-type strain PM6-7A (A) and PM6-7A/pdr1∆ (B) transformants. Spotting assays were performed with a 10-fold dilution of overnight cultures on YPG medium containing oligomycin. The plates were incubated for 3 days at 30°C

Figure 2.

Susceptibility of K. lactis wild-type strain PM6-7A and its transformants to antifungal azoles. Spotting assays were performed with a 10-fold dilution of overnight cultures on YPD medium containing the antifungal azoles indicated. The plates were incubated for 3 days at 30°C

Increased activation of KlPdr5p by Klpdr1-1 mutant allele

To demonstrate directly that the transport of drugs or toxic compounds is affected in the transformants containing the gain-of-function Klpdr1-1 allele, the accumulation of the fluorescent dye rhodamine 6G (the acknowledged substrate of the KlPdr5p, the main drug efflux pump in K. lactis) was measured by flow cytometry (Table 2). While the Klpdr1∆ cells accumulated higher amounts of the dye, with a five-fold increase in mean intracellular fluorescence intensity compared with the wild-type cells, the presence of the Klpdr1-1 allele diminished the accumulation of the dye in both the wild-type and the Klpdr1∆ mutant cells (Table 2). These results were corroborated by measuring the capacity to efflux an ABC-transporter substrate, rhodamine 6G. The rate of the energy-dependent rhodamine 6G efflux was determined by measuring the drug concentrations in supernatants of starved cells after incubation in drug-free medium. The addition of glucose induced rhodamine 6G efflux, the rate of which was significantly higher in the presence of the Klpdr1-1 mutant allele than in the wild-type one (Figure 3).

Table 2. Rhodamine 6G accumulation in K. lactis transformants of the wild-type strain PM6-7A and the PM6-7A/Klpdr1∆ mutant, as determined by FACS analysis
StrainPlasmidGeometric mean fluorescence 
  – Rhodamine 6G+ Rhodamine 6G
PM6-7A (wt)1.99 ± 0.2418.27 ± 0.44
 pRS306K/KlPDR12.72 ± 0.4713.90 ± 0.36
 pRS306K/Klpdr1-12.98 ± 0.1210.09 ± 1.29
Klpdr12.82 ± 0.1664.50 ± 2.24
 pRS306K/KlPDR13.30 ± 0.5850.50 ± 0.80
 pRS306K/Klpdr1-12.51 ± 0.2927.85 ± 0.76
Figure 3.

Energy-dependent rhodamine 6G efflux from cells of the wild-type strain K. lactis PM6-7A and its transformants. Glucose (final concentration 2 m m) was added at time 0. The results are mean ± SD for the four independent experiments

To correlate more precisely the conferred drug resistance and rhodamine 6G efflux with the increased activation function of the Klpdr1-1 mutant allele, quantitative PCR (qPCR) analyses were carried out. As shown in Figure 4, the Klpdr1-1 mutant allele increased the activity of the KlPdr1p transcription factor. Examination of the KlPDR5 transcript levels in strain containing the Klpdr1-1 mutant allele demonstrated that KlPDR5 mRNA abundance was dramatically elevated in the presence of the Klpdr1-1 mutant allele. The results clearly show that the Klpdr1-1 allele promotes the expression of the KlPDR5 gene, resulting in an increased rate of drug efflux from transformed cells. We have therefore identified the amino acid substitution (L273P) in KlPdr1p that is responsible for a constitutive high expression of KlPDR5, the gene encoding the main drug efflux pump in K. lactis.

Figure 4.

Relative KlPDR5, KlPDR16 and KlTPO1 transcript abundance in transformants of the K. lactis wild-type strain PM6-7A containing a plasmid-borne gain-of-function Klpdr1-1 allele. The relative amounts of KlPDR5, KlPDR16 and KlTPO1 are normalized to KlACT1 transcript levels. The values are the averages of three separated experiments and represent the change in the gene expression relative to the wild-type strain PM6-7A (set at 1.0)

In our previous work, based on in silico analyses of K. lactis gene promoter sequences, we proposed that the KlPDR16 gene (involved in lipid biosynthesis and MDR) as well as the KlTPO1 gene (MFS transporter involved in polyamine transport) belong to the KlPDR1 gene regulon (Balkova et al., 2009). Examination of the KlPDR16 and KlTPO1 transcript levels in the K. lactis strain containing the Klpdr1-1 mutant allele demonstrated that the mRNA abundance of both genes was slightly higher than the wild-type control. However, the fold change of mRNA abundance was not so distinctive as in the case of KlPDR5 gene transcript (Figure 4). Transcriptional regulation in yeast is the result of the interaction between networks of transcription factors. Yap1p, for example, was found to be a major determinant of polyamine stress resistance in yeast and is also involved in the control of ScPDR16 expression. We propose that the crosstalk between several transcription factors could explain the observed behaviour.

Klpdr1-1 confers azole resistance in S. cerevisiae and activates the ScPDR5 promoter

S. cerevisiae mutant strain FY1679-28C/TDEC disrupted in the PDR1 and PDR3 genes, hypersusceptible to various drugs, was transformed with the multicopy plasmid containing the wild-type KlPDR1 gene or its Klpdr1-1 mutant allele. As shown in Figure 5A, the Klpdr1-1 mutant allele conferred a higher resistance of the heterologous S. cerevisiae transformants to fluconazole and ketoconazole compared to the tranformants containing the wild-type KlPDR1 gene. Further, the Klpdr1-1 mutant allele was able to activate the expression of the ScPDR5 promoter fused to the lacZ reporter gene. Plasmid carrying the ScPPDR5–lacZ fusion gene was introduced into the FY1679-28C/TDEC host strain together with the Klpdr1-1 mutant allele on pRS306K plasmid, and the β-galactosidase activity was determined. The Klpdr1-1 mutant allele led to increased expression of the fusion gene when compared with the wild-type KlPDR1 (Figure 5B). The β-galactosidase activity driven by the ScPDR5 promoter was stimulated more than three-fold in the presence of the Klpdr1-1 mutant allele. Thus, the amino acid substitution L273P in the KlPdr1p led to the increased activation of the heterologous ScPDR5 promoter.

Figure 5.

(A) Drug susceptibility and (B) β-galactosidase activity of S. cerevisiae transformants containing the plasmid-borne KlPDR1 and Klpdr1-1 alleles. Serial dilution and β-galactosidase activity assays were performed against the background of FY1679/TDEC (pdr1pdr3∆). Spotting assays were performed with serial dilutions of overnight cultures onto YPD medium containing different drugs, as indicated. The plates were incubated for 3 days at 30°C

Discussion

In this paper we describe the isolation and characterization of gain-of-function mutation in the multidrug resistance transcription factor encoded by the KlPDR1 gene in K. lactis. In K. lactis, as in C. glabrata, only one orthologue of the ScPDR1/ScPDR3 genes was found which combines the properties of both ScPDR1/ScPDR3 from S. cerevisiae. The Klpdr1-1 mutant allele was isolated from a spontaneously generated oligomycin-resistant mutant of the K. lactis wild-type strain PM6-7A. In this allele, one specific mutation, T818C, leading to the L273P amino acid substitution in KlPdr1p, was identified. Although the Klpdr1-1 mutant allele was isolated as a clone able to grow on plates containing 1.5 µg/ml oligomycin, the Klpdr1-1 mutant allele was insufficient to induce this level of oligomycin resistance in the transformants of Klpdr1∆ host strain. Based on these facts, we propose that other mutations may have been contributing to the oligomycin resistance in the original isolate. Putative functional domains in the KlPdr1p–DBD (DNA binding domain), MHR (middle homology region), AD (transcriptional activation domain) could be deduced by similarity with ScPdr1p/ScPdr3p from S. cerevisiae (Figure 6). The localization of the KlPDR1 gain-of-function mutation is similar to gain-of-function mutations described in the S. cerevisiae homologues ScPdr1p/ScPdr3p or CgPdr1p in C. glabrata. It appears that the Klpdr1-1 mutation maps in front of the first two motifs of the inhibitory domain, where some ‘hot spot’ mutations of ScPdr3p and CgPdr1p are also localized. These gain-of-function mutations in the vicinity of the inhibitory domain might impair transcriptional inhibition and thus induce hyperactivation, as proposed for pdr3 mutations in S. cerevisiae (Nourani et al., 1997).

Figure 6.

Localization of gain-of-function mutation relative to the structural motifs of KlPdr1p. (*) conserved amino acid residues; (:) conservation between groups of strongly similar amino acids; (.) conservation between groups of weakly similar amino acids

Some gain-of-function mutations in CgPdr1p map to the XBD and may therefore activate the transcription factor by mimicking the binding of xenobiotics (Thakur et al., 2008; Ferrari et al., 2009). Other mutations were found in the region that interacts with the mediator complex and may promote this interaction in the absence of inducing drugs. Alternatively, these transcription factors could also be activated by upstream signalling pathways in response to cellular stress caused by the drugs. The M802L amino acid substitution in KlPdr1p did not alter its function. The observed ability of cells to grow in the presence of oligomycin (1.5 µg/ml) can thus be the result of other mutations in the nuclear or mitochondrial genome of K. lactis cells.

It is now well established that S. cerevisiae ScPdr1p/ScPdr3p act through cis-acting sites present in the promoters of target genes. The consensus motif is named the pleiotropic drug resistance element (PDRE) and is present in several ABC transporter gene promoters. In K. lactis the sequence 5′-TCCGT/g/cGG/c/tA/g-3′ (variable bases in a consensus motif are in lower case) was identified as a strong candidate for the K. lactis PDRE. Differences in the number and/or sequence of the PDRE present in the efflux pump promoters could influence the KlPdr1p regulatory activity. Alternatively, the function of KlPdr1p might be subjected to regulation by other transcription factor(s). In fact, two sequences matching the consensus of KlYap1p binding sites (TTA/TG/CTAA) (YRE, Yap1-Responsive Element) are located within the KlPDR1 promoter, raising the possibility that KlYap1p, a bZip transcription factor involved in cellular responses to oxidative stress, might regulate the expression of KlPDR1 by binding to this element (Hodurova et al., 2011). The gain-of-function mutation detected in KlPdr1p may alter these interactions in a positive or negative manner and thus could result in altered gene expression patterns. However the activity of additional, still unidentified, transcription factors could not be excluded.

Acknowledgements

This study was supported by the Slovak Grant Agency of Science (Grant No. VEGA 1/0867/12) and the Slovak Research and Developmental Agency (Grant No. APVV-0282-10). The publication is also the result of the project implementation ‘Centre of Excellence for Exploitation of Informational Biomacromolecules in the Disease Prevention and Improvement of Quality of Life’ (Grant No. ITMS 262–40120027), supported by the Research and Development Operational Programme funded by the ERDF.

Ancillary