SEARCH

SEARCH BY CITATION

Keywords:

  • recombinant DNA;
  • ura3;
  • homologous recombination;
  • overlap extension PCR

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Recombinant DNAs are traditionally constructed using Escherichia coli plasmids. In the yeast Saccharomyces cerevisiae, chromosomal gene targeting is a common technique, implying that the yeast homologous recombination system could be applied for recombinant DNA construction. In an attempt to use a S. cerevisiae chromosome for recombinant DNA construction, we selected the single ura3Δ0 locus as a gene targeting site. By selecting this single locus, repeated recombination using the surrounding URA3 sequences can be performed. The recombination system described here has several advantages over the conventional plasmid system, as it provides a method to confirm the selection of correct recombinants because transformation of the same locus replaces the pre-existing selection marker, resulting in the loss of the marker in successful recombinations. In addition, the constructed strains can serve as both PCR templates and hosts for preparing subsequent recombinant strains. Using this method, several yeast strains that contained selection markers, promoters, terminators and target genes at the ura3Δ0 locus were successfully generated. The system described here can potentially be applied for the construction of any recombinant DNA without the requirement for manipulations in E. coli. Interestingly, we unexpectedly found that several G/C-rich sequences used for fusion PCR lowered gene expression when located adjacent to the start codon. Copyright © 2013 John Wiley & Sons, Ltd.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

The generation of Escherichia coli plasmid constructs is performed daily in many laboratories worldwide and represents time-consuming work, even though numerous cloning procedures have been developed (Alberti et al., 2007; Suzuki et al., 2005; Matsuyama and Yoshida, 2009). Despite the standardization of many cloning techniques, the frequency of obtaining correct clones is often inconsistent, and the confirmation processes are laborious. Moreover, E. coli plasmid cloning often requires special sequences at the cloning sites, such as multiple-cloning sites consisting of restriction enzyme recognition sequences or recombination-targeting sequences. These additional sequences can be problematic if the boundary sequences must be in-frame with the target insert or contain the inappropriate sequences.

If manipulations in E. coli could be eliminated from recombinant DNA construction procedures, and if additional sequences for cloning sites were not required, such an approach would be attractive for generating recombinants. We speculated that the efficient homologous recombination ability of the yeast Saccharomyces cerevisiae would satisfy all of these requirements. Although plasmid construction systems via recombination in yeasts have been established (Chino et al., 2010; Kouprina et al., 1998; Ma et al., 1987; Oldenburg et al., 1997; Storck et al., 1996), an effective method for DNA construction utilizing yeast chromosomes has not been developed.

To introduce DNA into the chromosome, the DNA fragment to be inserted must be joined with a selection marker. We previously developed a reliable fusion PCR method that efficiently connects two DNA fragments (Cha-aim et al., 2009, 2012). In the present study, using a single locus in the yeast genome as a targeting site combined with a reliable fusion PCR method, we have established a simple system to construct recombinant DNA on the yeast chromosome. We describe herein the generation of several yeast strains containing various DNA constructs inserted at the ura3Δ0 locus, which was selected because it is a single chromosomal locus in S. cerevisiae. These strains can be used as hosts and templates to generate future recombinant DNA constructs. In the present study, we also examined the effects of the presence of additional sequences between promoters or terminators and a target gene on gene expression, because G/C-rich sequences were used for generating fusion PCR products.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Strains, media, and plasmids

The yeast strains used in this study are described in Table 1. The process for constructing each strain is described in the Table S1 (see Supporting information). YPD [1% yeast extract, 2% polypeptone, 2% glucose and 2% agar (if necessary)], YPgal (YPD medium with 2% galactose in place of 2% glucose) and synthetic drop-out (SD) media (0.17% yeast nitrogen base without amino acids and without ammonium sulphate, 0.5% ammonium sulphate, 2% glucose, and required nutrients) were used for yeast culture (Ausubel et al., 1999). 5-Fluoroorotic acid (FOA) medium was used for ura3 mutant selection (Akada et al., 2006).

Table 1. Saccharomyces cerevisiae strains used in this study
Strain nameGenotypeStock name
BY4704MATa ade2Δ::hisG his3Δ200 leu2Δ0 lys2Δ0 met15Δ0 trp1Δ63RAK771
BY4705MATα ade2Δ::hisG his3Δ200 leu2Δ0 lys2Δ0 met15Δ0 trp1Δ63 ura3Δ0RAK772
BY4733MATa his3Δ200 leu2Δ0 met15Δ0 trp1Δ63 ura3Δ0RAK798
BY4741MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0RAK3364
BY4743MATa/α his3Δ1/his3Δ1 leu2Δ0/leu2Δ0 LYS2/lys2Δ0 met15Δ0/MET15 ura3Δ0/ura3Δ0RAK2844
RAK3600MATa ade2Δ::hisG his3Δ200 leu2Δ0 lys2Δ0 met15Δ0 trp1Δ63 ura3Δ0::PpHIS3This study
RAK3613MATa ade2Δ::hisG his3Δ200 leu2Δ0 lys2Δ0 met15Δ0 trp1Δ63 ura3Δ0::HIS3This study
RAK3614MATa ade2Δ::hisG his3Δ200 leu2Δ0 lys2Δ0 met15Δ0 trp1Δ63 ura3Δ0::LEU2This study
RAK3623MATa his3Δ1 leu2Δ0 mekt15Δ0 ura3Δ0::10CATDH3pAscIAoTAANotIPGK1ter15CURA3This study
RAK3624MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0::10CATDH3pAscIAoTAANotIPGK1ter-PpHIS3This study
RAK3625MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0::TDH3pAscIAoTAANotIPGK1ter-LEU2This study
RAK3628MATa his3Δ200 leu2Δ0 met15Δ0 trp1Δ63 ura3Δ0::GAL10p15CURA3This study
RAK3655MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0::TDH3p-PGK1ter-PpHIS3This study
RAK3656MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0::TDH3pAscIAoTAA15CPGK1ter-PpHIS3This study
RAK3659MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0::TDH3pAscIAoTAA15CPGK1ter-LEU2This study
RAK3681MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0::TDH3p15CAoTAANotIPGK1ter-PpHIS3This study
RAK3940MATa his3Δ200 leu2Δ0 met15Δ0 trp1Δ63 ura3Δ0::GAL10p-yEGFP15CPpHIS3This study
RAK4002MATa ade2Δ::hisG his3Δ200 leu2Δ0 lys2Δ0 met15Δ0 trp1Δ63 ura3Δ0::LYS2This study
RAK4003MATa ade2Δ::hisG his3Δ200 leu2Δ0 lys2Δ0 met15Δ0 trp1Δ63 ura3Δ0::TRP1This study
RAK4004MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0::TDH3p15C-PGKp20AoTAANotIPGK1ter-LEU2This study
RAK4007MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0::TDH3p15C-PGKp10AoTAANotIPGK1ter-LEU2This study
RAK4143MATa ade2Δ0A his3Δ1 leu2Δ0 met15Δ0 ura3Δ0This study
RAK4147MATa ade2Δ0A::15CURA3S his3Δ1 leu2Δ0 met15Δ0 ura3Δ0This study
RAK4241MATa his3Δ200 leu2Δ0 met15Δ0 trp1Δ63 ura3Δ0::GAL10p-yESapphire15CPpHIS3This study
RAK4242MATa his3Δ200 leu2Δ0 met15Δ0 trp1Δ63 ura3Δ0::GAL10p-yECitrine15CPpHIS3This study
RAK4243MATa his3Δ200 leu2Δ0 met15Δ0 trp1Δ63 ura3Δ0::GAL10p-yEVenus15CPpHIS3This study
RAK4244MATa his3Δ200 leu2Δ0 met15Δ0 trp1Δ63 ura3Δ0::GAL10p-yECFP15CPpHIS3This study
RAK4257MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0::TDH3p-AoTAANotIPGK1ter-LEU2This study
RAK4263MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0::TDH3p15CAoTAANotIPGK1ter-LEU2This study
RAK4266MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0::TDH3p15GAoTAANotIPGK1ter-LEU2This study
RAK4269MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0::TDH3pAscIAoTAA-PGK1ter-LEU2This study
RAK4272MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0::TDH3p-luc215CURA3This study
RAK4276MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0::TDH3p15CURA3This study
RAK4292MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0::CWP2p15CURA3This study
RAK4296MATa his3Δ200 leu2Δ0 met15Δ0 trp1Δ63 ura3Δ0::GAL10p-yCLuc15CURA3This study
RAK4314MATa ade2Δ0A his3Δ1 leu2Δ0 met15Δ0 ura3Δ0::TDH3p15CURA3This study
RAK4315MATa ade2Δ0A his3Δ1 leu2Δ0 met15Δ0 ura3Δ0::GAL10p15CURA3This study
RAK4316MATa ade2Δ0A his3Δ1 leu2Δ0 met15Δ0 ura3Δ0::GAL10p315CURA3This study
RAK4317MATa ade2Δ0A his3Δ1 leu2Δ0 met15Δ0 ura3Δ0::GAL10p215CURA3This study
RAK4318MATa ade2Δ0A his3Δ1 leu2Δ0 met15Δ0 ura3Δ0::CUP1p15CURA3This study
RAK4319MATa ade2Δ0A his3Δ1 leu2Δ0 met15Δ0 ura3Δ0::CWP2p15CURA3This study
RAK4320MATa ade2Δ0A his3Δ1 leu2Δ0 met15Δ0 ura3Δ0::ILV5p15CURA3This study
RAK4333MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0::TDH3p-yCLuc15CURA3This study
RAK4354MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0::TDH3p-AaBGL115CURA3This study
RAK4357MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0::TDH3p15C-PGKp8AoTAANotIPGK1ter-LEU2This study
RAK4360MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0::TDH3p15C-PGKp6AoTAANotIPGK1ter-LEU2This study
RAK4363MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0::TDH3p15C-PGKp4AoTAANotIPGK1ter-LEU2This study
RAK4365MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0::TDH3p15C-PGKp2AoTAANotIPGK1ter-LEU2This study
RAK4368MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0::TDH3pAscIAoTAA15GPGK1ter-LEU2This study
RAK4370MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0::TDH3pAscIAoTAA5CGCPGK1ter-LEU2This study
RAK4373MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0::TDH3pAscIAoTAA5GCGPGK1ter-LEU2This study
RAK4376MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0::TDH3pAscIAoTAA3CGCPGK1ter-LEU2This study
RAK4379MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0::TDH3pAscIAoTAA3GCGPGK1ter-LEU2This study
RAK4382MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0::TDH3p5CGCAoTAANotIPGK1ter-LEU2This study
RAK4385MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0::TDH3p5GCGAoTAANotIPGK1ter-LEU2This study
RAK4388MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0::TDH3p15TAoTAANotIPGK1ter-LEU2This study
RAK4391MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0::TDH3p15AAoTAANotIPGK1ter-LEU2This study
RAK4394MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0::TDH3p5TATAoTAANotIPGK1ter-LEU2This study
RAK4397MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0::TDH3p5ATAAoTAANotIPGK1ter-LEU2This study
RAK4400MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0::TDH3paatatattAoTAANotIPGK1ter-LEU2This study

Saccharomyces cerevisiae strains BY4704, BY4705, BY4733, BY4741 and BY4743 (Brachmann et al., 1998) were used as hosts and templates for DNA construction. The chromosomal DNAs of these BY strains were used as template to amplify selection marker genes.

The plasmids used in this study were: pCLY-tdh as a source of secretory luciferase yCLuc (Atto Corp., Tokyo, Japan); pGL4 for intracellular luciferase luc2 (Promega, WI, USA); yEGFP (Cha-aim et al., 2009), pKT102 (yECFP), pKT150 (yESapphire), pKT140 (yECitrine) and pKT103 (yEVenus) (EUROSCARF) for fluorescent proteins; and p316TDH3TAAter for the Taka α-amylase gene from Aspergillus oryzae (Cha-aim et al., 2009). The plasmids pGG116 (Akada et al., 2002), pPpHIS3TDH3p (Hashimoto et al., 2005) and pScLEU2TDH3p (Abdel-Banat et al., 2010) were used as a source of template DNA for marker gene amplification.

α-Amylase and luciferase activities were quantitatively measured using an α-amylase measurement kit (Kikkoman Corp., Tokyo, Japan), a Cluc assay kit (yCLuc; Atto, Tokyo, Japan) and a ONE-GloTM luciferase assay kit (luc2; Promega, WI, USA), as recommended by the suppliers; 1 U amylase activity was determined as 1 µm substrate degradation/min. Luminescence was measured by GloMax-20/20 luminometer (Promega) and activity was shown as relative luminescence units (RLU)/s.

Oligonucleotide primers

The primers used in this study are described in Table S2 (see Supporting information). Normal grade oligonucleotides were used. Primers were typically named based on their features. Briefly: (a) oligonucleotide names are given according to the sequence from the 5′ to the 3′; (b) oligonucleotides are designated by the distance from the ATG start codon of the respective genes; (c) oligonucleotides complementary to the genes are marked by ‘c’ at their ends; and (d) oligonucleotides containing distinct regions are combined with a hyphen (Cha-aim et al., 2012). G/C-rich additional sequences for fusion PCR primers (Cha-aim et al., 2009) are indicated by the following nomenclature: 15C, 5′-ccccccccccccccc-3′; 15G, 5′-ggggggggggggggg-3′; 5CGC, 5′-ccccccgggggcccc-3′; 5GCG, 5′-gggggcccccggggg-3′; 3CGC, 5′-cccgggcccgggccc-3′; and 3GCG, 5′-gggcccgggcccggg-3′.

DNA manipulation

KOD Plus DNA polymerase (Toyobo, Osaka, Japan) was mainly used for PCR, according to the manufacturer's instructions, although KOD Dash and KOD FX DNA polymerases (Toyobo), Phusion DNA polymerase (Finnzyme, Vantaa, Finland) and GXL DNA polymerase (Takara Bio, Otsu, Japan) were also used. PCR reactions were performed in a final volume of 10 µl. The PCR cycles consisted of an initial denaturation step at 94°C for 1 min, followed by 30 cycles of 94°C for 20 s, 50–60°C for 30 s and 68°C for an appropriate time of extension. To join two DNA fragments, fusion PCR was performed according to a previously described method (Cha-aim et al., 2009). DNA concentrations were measured using a Quant-it™ dsDNA Assay Kit and Qubit™ fluorometer (Invitrogen, CA, USA). Yeast chromosomal DNA was isolated as described in a previous paper (Cha-aim et al., 2009).

For the analysis of recombination frequency at the URA3 locus, URA3 was amplified from BY4704 chromosomal DNA, using the primer sets URA3-40/URA3-40c, URA3-80/URA3-80c, URA3-200/URA3-200c, URA3-500/URA3-500c, URA3-40/URA3-80c, URA3-40/URA3-200c and URA3-40/URA3-500c. These primers contained homologous sequences, with lengths in nucleotides indicated by the number in the primer names. The DNA products amplified using these primers were used for the transformation of strain RAK3624.

Yeast cells were transformed using a lithium acetate method (Cha-aim et al., 2009). Briefly, cells were initially grown in 1–2 ml YPD overnight, and 1 ml culture was mixed with 9 ml fresh YPD and further incubated for 5 h at 28–30°C with shaking. The yeast cells were collected by centrifugation, washed once with 1 ml sterile water and then suspended in ca. 150 µl sterile water. Yeast suspension (65 µl) was mixed with 120 µl 60% polyethyleneglycol 3350 (Sigma-Aldrich, Tokyo, Japan), 10 µl 10 mg/ml carrier DNA (salmon testes; Sigma-Aldrich D1626), 5 µl 4 m lithium acetate and 1–2 µl (ca. 30–100 ng) DNA. The resulting mixture was incubated at 42°C for 40–60 min and then spread on SD medium containing the required nutrients. The plates were incubated at 28–30°C for 2–4 days.

To confirm correct targeting at the ura3Δ0 locus of the transformants, colony PCR was performed (Akada et al., 2000). Briefly, yeast cells cultured on YPD plates were collected using toothpicks, suspended in 10 µl sterile water, and 7.5 µl of the resulting suspension was mixed with 2.5 µl 1% sodium dodecyl sulphate (SDS) solution. The resulting mixture was vortexed and 100 µl sterile water was added. After centrifugation, the supernatant (0.4–1 µl) was directly used for PCR.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Gene targeting to the ura3Δ0 locus

To develop an efficient recombinant DNA construction system, we selected the ura3Δ0 locus as a site for gene targeting. The ura3Δ0 locus has no special properties, but the selection of a single locus makes this system versatile. The structure of the ura3Δ0 locus is shown in Figure 1A. The deleted region of URA3 was from nucleotide −223 to +880 (the A of the start codon ‘ATG’ was designated as +1) in the S. cerevisiae BY strains used in this study.

image

Figure 1. Gene targeting to the ura3Δ0 locus. (A) Structure of URA3 and the ura3Δ0 locus of S. cerevisiae BY strains. (B) The URA3 marker containing homologous sequences of the indicated length was used for the transformation to RAK3624 (ura3Δ0::TDH3p-AoTAA-PGKter-PpHIS3; TDH3p, TDH3 promoter; AoTAA, Aspergillus oryzae α-amylase gene; PGK1ter, PGK1 terminator; PpHIS3, Pichia pastoris HIS3). Transformation efficiency and percentages of transformants displaying histidine auxotrophy are indicated. The results of three experiments are shown

Download figure to PowerPoint

To determine the targeting efficiency at the ura3Δ0 locus, URA3 fragments containing homologous sequences of various lengths were prepared by PCR and used for the transformation of strain RAK3624 (Table 1), which contained ura3Δ0::10CATDH3pAscIAoTAANotIPGK1ter-PpHIS3 at the ura3Δ0 locus (Figure 1B). The correct replacement of TDH3pAscIAoTAANotIPGK1ter-PpHIS3 with URA3 was determined by checking the transformants for histidine auxotrophy. In general, when homologous sequences with longer lengths were used, the transformation efficiency became higher. In addition, the use of a fixed 40-base homologous sequence at one end of the target fragment with sequences of longer lengths resulted in higher transformation frequencies and accuracies than those for the fragment containing 40 nucleotides of homologous sequences at both fragment ends. In all cases, the correct transformation frequency always exceeded 75%. Therefore, we concluded that the ura3Δ0 locus can be used for recombinant DNA construction, using target fragments containing at least 40 bp sequences homologous to the regions surrounding the URA3 locus.

Yeast strains for multiple recombinant DNA construction

To perform recombinant DNA construction at the yeast ura3Δ0 locus, we first constructed several standard strains that contained a selection marker, promoter and terminator at the ura3Δ0 locus to serve as hosts and for template preparation (Figure 2).

image

Figure 2. Yeast strains used for recombinant DNA construction. Marker strains contained transformation selection markers in the ura3Δ0 locus. Promoter strains contained various promoters together with selection markers. These strains can be used as both hosts for transformation and templates for DNA construction. URA3-5′ and URA3-3′ regions were used as target sequences for homologous recombination. The numbers above the marker genes indicate the positions of upstream (−) and downstream (+) ends of each marker gene. ‘A’ in translational start codon of each marker was numbered +1. 15C means the sequence used for fusion of promoters and URA3; ter is the PGK1 terminator. The marker genes and the promoters fused with URA3 or ter-PpHIS3 were inserted into ura3Δ0 locus through homologous recombination. Construction procedures are shown in detail in the Supporting information (Table S1)

Download figure to PowerPoint

The five marker strains were constructed. The LYS2, TRP1, PpHIS3, HIS3 and LEU2 genes were amplified by PCR, with the primers containing 40 bp homologous sequences for targeting, and inserted at the ura3Δ0 locus in BY4705 (for LYS2 and TRP1) and BY4704 (for the others) to generate the marker strains RAK4002 (LYS2), RAK4003 (TRP1), RAK3600 (PpHIS3), RAK3613 (HIS3) and RAK3614 (LEU2) (Figure 2). To generate promoter strains, the promoters (indicated by ‘p’) used were TDH3p, CWP2p, ILV5p, CUP1p and GAL10p. TDH3p, CWP2p and ILV5p are constitutive overexpression promoters (Ano et al., 2009; Ghaemmaghami et al., 2003; Kuroda et al., 1994; Petersen and Holmberg, 1986) and CUP1p is a copper-inducible promoter (Mascorro-Gallardo et al., 1996), while GAL10p is a galactose-inducible promoter containing four Gal4 transcription factor binding sites (Johnston and Davis, 1984). We also constructed shorter GAL10p promoters by deleting one (GAL10p3) and two (GAL10p2) Gal4 binding sites from the 5′ region. These shorter promoter sequences resulted in lower expression than the entire GAL10p sequence (data not shown). These promoters and URA3 marker with URA3-3′ were amplified from S. cerevisiae chromosomal DNA with the primers containing 15C/15G sequences. The promoters and URA3 marker were joined by fusion PCR through 15C/15G sequences. The fused DNA fragments were introduced into BY4741 (TDH3p), BY4733 (GAL10p) or RAK4143 (all the promoters) to generate the promoter strains RAK4314/RAK4276 (TDH3p), RAK3628/RAK4315 (GAL10p), RAK4316 (GAL10p3), RAK4317 (GAL10p2), RAK4318 (CUP1p), RAK4319 (CWP2p) and RAK4320 (ILV5p). A terminator strain with PGK1 terminator was also constructed by a similar procedure to that used for promoter strains (Figure 2, RAK3655). The correct replacement was confirmed by loss of the original markers and by colony PCR. Construction procedures of the strains are shown in detail in Table S1 (see Supporting information).

Basic strategy for recombinant DNA construction

The basic recombinant DNA construction strategy used in this study is schematically shown in Figure 3A. To construct recombinant DNA that expresses a coding sequence (ORF1) of interest, it is necessary to insert the target sequence downstream of a promoter of interest (Promoter1). ORF1 is amplified with N-terminal forward and C-terminal reverse primers, in which the former (Promoter1–ORF1 primer) contains an additional 40 bp sequence of the Promoter1 downstream region and the latter (15G–ORF1c primer) contains an additional 15G sequence at the 5′ end.

image

Figure 3. Strategy for recombinant DNA construction in the yeast ura3Δ0 locus. (A) Basic strategy to locate the open reading frame (ORF) of a gene of interest downstream of promoter 1. (B) Example of the construction process used for a yCLuc (luciferase) expression construct under control of the TDH3 promoter. (C) Recombinant DNAs constructed at the ura3Δ0 locus

Download figure to PowerPoint

For the fusion PCR of a selection marker (Marker2) and ORF1, Marker2 is amplified from chromosomal DNA of the Marker2 strain, using the primer 15C–Marker2 and the URA3c locus primer. Using fusion PCR, the ORF1 and Marker2 sequences are then fused to generate a Promoter1 (40 bp)–ORF1–15C–Marker2–URA3-3′ fragment, which is then introduced into a host strain containing the Promoter1–Marker1 sequence at the ura3Δ0 locus. Upon successful recombination, Marker1 of the host is replaced with Marker2; thus, the loss of Marker1 from the transformants can serve as an indicator of success. The recombinant strain would contain ORF1 downstream of Promoter1 without any additional sequences at the insertion boundaries. Sequence confirmation of ORF1 can be performed after the PCR amplification with URA3 locus primers.

As an example, the above-described basic strategy was conducted using the yCLuc gene (Figure 3B), which is a secretory luciferase from Cypridina noctiluca. We amplified the yCLuc coding sequence from pCLY-tdh using the TDH3p40-yCLuc+1 forward primer and the 15G-yCLuc+1662c reverse primer. The URA3 marker was amplified from BY4704 chromosomal DNA using primers 15C–URA3-223 and URA3-300c. The two fragments were joined by fusion PCR using primers TDH3p40-yCLuc+1 and URA3-300c. The fused DNA fragment, which contained 40 bp of the TDH3 promoter sequence and 300 bp of the 3′ downstream region of URA3 at the ends, was used for the transformation of the RAK3655 promoter strain, which contained the TDH3 promoter and PpHIS3 marker at the ura3Δ0 locus (Figure 2). Correct transformants were selected on uracil drop-out SD medium and then screened for histidine auxotrophy, which results from the loss of PpHIS3. The obtained transformants RAK4333 exhibited about 5500 RLU/µl luciferase activity.

Effect of additional artificial sequences on gene expression in yeast

In our recombination system, artificial G/C-rich sequences were used for the fusion of target DNA fragments. The artificial sequences could be located either downstream or upstream of the target ORF, depending on whether the fusion PCR proceeded at these locations. To evaluate the effects of artificial G/C-rich sequences on gene expression, we first inserted 15C (RAK3659), 15G (RAK4368), 5CGC (RAK4370), 5GCG (RAK4373), 3CGC (RAK4376), 3GCG (RAK4379) and none (RAK4269) sequences (see Materials and methods for sequence information; see also Supporting information, Table S1) between the AoTAA α-amylase stop codon and PGK1 (3-phosphoglycerate kinase) terminator, and then measured the α-amylase activity of transformants (Figure 4A). None of the constructs resulted in significant differences in activity, indicating that the addition of G/C-rich sequences at the terminator region had no effect on yeast gene expression.

image

Figure 4. Effect of artificial sequences on gene expression. Artificial sequences were located downstream or upstream of the AoTAA amylase coding sequence. (A) G/C-rich artificial sequences were located between the stop codon and PGK1 terminator. Amylase activities were measured in triplicate, except for duplicates in 15C and 15G. (B) G/C or A/T rich sequences were located between the start codon and TDH3 promoter. Amylase activities were measured in triplicate. (C) PGK1 promoter sequences adjacent to the start codon were located between the start codon and 15C. Amylase activities were measured in triplicate except for duplicate in 4 nt

Download figure to PowerPoint

Similarly, we inserted 15C (RAK4263), 15G (RAK4266), 5CGC (RAK4382), 5GCG (RAK4385), AscI (5′-ggcgcgcc-3′, RAK3625), 15T (RAK4388), 15A (RAK4391), 5′-aatatatt-3′ (RAK4400) and none (RAK4257) sequences at the boundary between the TDH3 promoter and start codon of AoTAA (Figure 4B). The strains (see Supporting information, Table S1) with G/C-rich sequences showed lower amylase activities compared to strains with A/T-rich sequences and the control strain lacking additional insertion sequences. Even though the AscI restriction enzyme sequence consists of only eight G and C nucleotides, insertion of this sequence upstream of the start codon markedly reduced AoTAA expression.

To determine the effect of inserting a 15C sequence upstream of the start codon, we inserted PGK1 promoter sequences of various lengths at the boundary between the 15C and AoTAA α-amylase start codon sequences (Figure 4C). The addition of short PGK1 promoter sequences (0 nt, RAK4263; 2 nt, ca, RAK4365; 4 nt, aaca, RAK4363; 6 nt, aaaaca, RAK4360; 8 nt, ataaaaca, RAK4357; 10 nt, atataaaaca, RAK4007; 20 nt, tttacaacaaatataaaaca, RAK4004) relieved the reduced AoTAA expression. The PGK1 promoter sequence is relatively A/T-rich, further supporting the finding that G/C-rich, but not A/T-rich, upstream sequences adjacent to the start codon affect gene expression. These results suggested that GC-rich sequences between promoters and target ORFs should be avoided for recombinant DNA construction, especially in quantitative analysis.

Construction of strains for gene expression

Based on the recombination strategy described above, we generated recombinant DNA constructs to express several types of foreign genes in S. cerevisiae (Figure 3C; see also Supporting information, Table S1). For the expression of a cytosolic luciferase, luc2 (Promega) was joined with the URA3 marker and placed downstream of the TDH3 promoter. The resulting strain RAK4272 showed activity of about 1 × 106 RLU/µl. RAK4333 is another TDH3p-driven luciferase expressing strain carrying the yCLuc gene (Tochigi et al., 2010). yEGFP (RAK3940), yECFP (RAK4244), yESapphire (RAK4241), yECitrine (RAK4242) and yEVenus (RAK4243) were joined with the PpHIS3 marker and placed downstream of GAL10p. All the constructs showed galactose-inducible expression of the fluorescence, as observed by fluorescence microscopy.

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Our yeast genetic manipulation system can be applied for the construction of various types of recombinant DNAs. Several variations of the recombination strategy are schematically illustrated in Figure 5. The selected donor strain can be used as both a host and template for PCR. For promoter exchange, DNA from a Promoter1–ORF1–Marker2 donor strain is used as the template to amplify the target fragment with the primer Promoter2–ORF1 and the URA3-3′ locus primer. The amplified fragment is then used for the transformation into the Promoter2–Marker1 strain, with the resulting loss of Marker1 serving as an indicator of the correct insertion.

image

Figure 5. Schematic diagram for repeated use of the recombinant DNA system for promoter exchange, ORF deletion and in-frame ORF fusion

Download figure to PowerPoint

For the deletion of C-terminal coding sequences, the donor strain is used as the host. The targeting fragment is amplified with a primer containing 40 bp of the ORF1 sequence terminated by a stop codon at the deletion site and an annealing sequence for the amplification of selection Marker1, and a universal primer at the URA3-3′ region from Marker1 strain as a template. Any marker, with the exception of markers carried by the host strains (Figure 2), can be incorporated into the targeting DNA fragment. The amplified fragment is used for the transformation to the donor strain, with the resulting loss of Marker1 as an indicator of success. By designing primers containing different ORF1 regions, any ORF1 site can be deleted using the same procedure.

Furthermore, constructed deletion strains can be used as the hosts for site-directed mutagenesis and chimeric gene construction of ORF1. For site-directed mutagenesis, the donor strain, which was used as a host for deletion, provides a template. A part of ORF1 with Marker2 is amplified with a universal primer at the URA3-3′ and a primer consisting of 40 bp sequence homologous with the end of deleted ORF1, the following sequence with mutations and the precise 20–25 bp annealing sequence. Transformation of the deletion strain with the amplified DNA resulted in loss of Marker1 and generation of full-length of ORF1 with designed mutations. In the case of chimeric gene construction, the chromosome of a strain containing an ORF1 orthologue and a marker gene, except for Marker2 at ura3Δ0 locus, is used as a template.

Our system can also be used for the generation in-frame fusions (Figure 5). For example, to generate a GFP fusion, a primer containing the target ORF (ORF1) C-terminal sequence and GFP coding sequence is designed, in which the ORF1 coding sequence is in-frame with the GFP N-terminal sequence. This primer and the universal URA3-3′ locus primer is then used to amplify the GFP-Marker1 fragment from GFP–Marker1 strain as a template. The amplified fragment is used for the transformation to the donor strain. The loss of Marker 2 indicates successful transformation.

The use of a single locus, such as ura3Δ0, is important for imparting versatility to this system. The examples presented in Figure 5 are basically designed using the 3′ region of URA3 as a long homologous sequence. However, the same recombination strategy can be applied using the 5′ region of URA3 as the long homologous sequence. For example, a marker with URA3-5′ region and various promoters amplified from S. cerevisiae chromosomes are joined with a G/C-rich sequence by fusion PCR and resulting URA3-5′–Marker–Promoter–upstream 40 bp of a coding sequence can be inserted into the upstream of a reporter gene such as yCLuc to analyse promote activity. The use of a single locus provides another advantage to the recombinant DNA construction system. The newly constructed strains serve as PCR templates and hosts for subsequent recombinant DNA construction. Actually, the strain RAK3625 (ura3Δ0::TDH3p-AscI-AoTAA-NotI-PpHIS3), which was constructed for an overexpression strain, was used as a PCR template to determine the effect of GC-rich sequences between TDH3p and AoTAA. AoTAA served as a reporter gene in the resulting strains (Figure 4).

Targeting to the ura3Δ0 locus always replaces pre-existing DNA segments. The loss of the selection marker and resulting auxotrophy serve as an indicator of correct recombination (Mirisola et al., 2007). This approach also allows for unlimited DNA manipulations when at least two selection markers are used. The strains generated by the integration at the ura3 locus on the yeast chromosome are all clones after single-colony isolation. These yeast cells can be stored easily for long periods as glycerol stock solutions in a freezer and can be transported without any special requirements at room temperature (McGinnis et al., 1974; Kaiser et al., 1994).

Fusion PCR with G/C-rich sequences makes this method easier, but we found that the presence of these sequences at the boundary between promoters and ORFs has deleterious effects on gene expression (Figure 4). Fusion PCR can be used to join a promoter and ORF with G/C-rich sequences. However, our result suggests that additional sequences, even restriction enzyme sites, should not be located at the boundary between the start codon and promoter to achieve efficient expression. The yeast homologous recombination system described here allows this layout to be achieved. At present we have no explanation for why such sequences affect gene expression.

When designating primer names and describing strains generated using this system, we recommend the use of general nomenclature. The use of standard nomenclature will aid recombinant DNA construction by other researchers. Primers can be designated according to the target ORF sequence (Cha-aim et al., 2012). Importantly, added fusion sequences should be indicated in the strain description, because the presence of these G/C-rich sequences will influence subsequent PCR primer design. As an example, here, we provided genotypes with special fusion sequences as a subscript (Table 1).

In conclusion, the yeast-based recombinant DNA construction system described here is useful for all researchers aiming to construct recombinant DNA. This system is applicable to any type of DNA construct, except in instances when circular DNA is required, and eliminates most of the DNA manipulation steps that are required when E. coli plasmids are used.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

We would like to thank Ms Yukie Misumi for technical assistance. We also thank NBRC (National Bioresource Center, Japan) and EUROSCARF (European Saccharomyces cerevisiae archive for functional analysis) for the plasmids and strains used in this study. This work was supported in part by a MEXT-ARDA grant from Japan and Thailand, JSPS KAKENHI Grant No. 24658096, the Adaptable and Seamless Technology Transfer Programme through Target-Driven R&D, and the Advanced Low Carbon Technology Research and Development Program (JST, Japan).

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information
  • Abdel-Banat BM, Nonklang S, Hoshida H, Akada R. 2010. Random and targeted gene integrations through the control of non-homologous end joining in the yeast Kluyveromyces marxianus. Yeast 27: 2939.
  • Akada R, Hirosawa I, Kawahata M, et al. 2002. Sets of integrating plasmids and gene disruption cassettes containing improved counter-selection markers designed for repeated use in budding yeast. Yeast 19: 393402.
  • Akada R, Kitagawa T, Kaneko S, et al. 2006. PCR-mediated seamless gene deletion and marker recycling in Saccharomyces cerevisiae. Yeast 23: 399405.
  • Akada R, Murakane T, Nishizawa Y. 2000. DNA extraction method for screening yeast clones by PCR. Biotechniques 28: 668674.
  • Alberti S, Gitler AD, Lindquist S. 2007. A suite of Gateway cloning vectors for high-throughput genetic analysis in Saccharomyces cerevisiae. Yeast 24: 913919.
  • Ano A, Suehiro D, Cha-Aim K, et al. 2009. Combinatorial gene overexpression and recessive mutant gene introduction in sake yeast. Biosci Biotechnol Biochem 73: 633640.
  • Ausubel FM, Brent R, Kingston RE, et al. (eds). 1999. Short Protocols in Molecular Biology. Wiley: New York.
  • Brachmann CB, Davies A, Cost GJ, et al. 1998. Designer deletion strains derived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for PCR-mediated gene disruption and other applications. Yeast 14: 115132.
  • Cha-aim K, Fukunaga T, Hoshida H, Akada R. 2009. Reliable fusion PCR mediated by GC-rich overlap sequences. Gene 434: 4349.
  • Cha-aim K, Hoshida H, Fukunaga T, Akada R. 2012. Fusion PCR via novel overlap sequences. In Gene Synthesis Methods and Protocols, Peccoud J (ed). Humana: New York; 97110.
  • Chino A, Watanabe K, Moriya H. 2010. Plasmid construction using recombination activity in the fission yeast Schizosaccharomyces pombe. PLoS One 5: e9652.
  • Ghaemmaghami S, Huh WK, Bower K, et al. 2003. Global analysis of protein expression in yeast. Nature 425: 737741.
  • Hashimoto S, Ogura M, Aritomi K, et al. 2005. Isolation of auxotrophic mutants of diploid industrial yeast strains after UV mutagenesis. Appl Environ Microbiol 71: 312319.
  • Johnston M, Davis RW. 1984. Sequences that regulate the divergent GAL1–GAL10 promoter in Saccharomyces cerevisiae. Mol Cell Biol 4: 14401448.
  • Kaiser C, Michaelis S, Mitchell A. 1994. Methods in Yeast Genetics: A Cold Spring Harbor Laboratory Course Manual. Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY.
  • Kouprina N, Campbell M, Graves J, et al. 1998. Construction of human chromosome 16- and 5-specific circular YAC/BAC libraries by in vivo recombination in yeast (TAR cloning). Genomics 53: 2128.
  • Kuroda S, Otaka S, Fujisawa Y. 1994. Fermentable and nonfermentable carbon sources sustain constitutive levels of expression of yeast triosephosphate dehydrogenase 3 gene from distinct promoter elements. J Biol Chem 269: 61536162.
  • Ma H, Kunes S, Schatz PJ, Botstein D. 1987. Plasmid construction by homologous recombination in yeast. Gene 58: 201216.
  • Mascorro-Gallardo JO, Covarrubias AA, Gaxiola R. 1996. Construction of a CUP1 promoter-based vector to modulate gene expression in Saccharomyces cerevisiae. Gene 172: 169170.
  • Matsuyama A, Yoshida M. 2009. Systematic cloning of an ORFeome using the Gateway system. Methods Mol Biol 577: 1124.
  • McGinnis MR, Padhye AA, Ajello L. 1974. Storage of stock cultures of filamentous fungi, yeasts, and some aerobic actinomycetes in sterile distilled water. Appl Microbiol 28: 218222.
  • Mirisola MG, Colomba L, Amodeo R, De Leo G. 2007. Yeast vectors for the integration/expression of any sequence at the TYR1 locus. Yeast 24: 761766.
  • Oldenburg KR, Vo KT, Michaelis S, Paddon C. 1997. Recombination-mediated PCR-directed plasmid construction in vivo in yeast. Nucleic Acids Res 25: 451452.
  • Petersen JG, Holmberg S. 1986. The ILV5 gene of Saccharomyces cerevisiae is highly expressed. Nucleic Acids Res 14: 96319651.
  • Storck T, Krüth U, Kolhekar R, et al. 1996. Rapid construction in yeast of complex targeting vectors for gene manipulation in the mouse. Nucleic Acids Res 24: 45944596.
  • Suzuki Y, Kagawa N, Fujino T, et al. 2005. A novel high-throughput (HTP) cloning strategy for site-directed designed chimeragenesis and mutation using the Gateway cloning system. Nucleic Acids Res 33: e109.
  • Tochigi Y, Sato N, Sahara T, et al. 2010. Sensitive and convenient yeast reporter assay for high-throughput analysis by using a secretory luciferase from Cypridina noctiluca. Anal Chem 82: 57685776.

Supporting Information

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Supporting information may be found in the online version of this article:

FilenameFormatSizeDescription
yea_2957_tableS1.docWord document127KConstruction process of the strains used in this study
yea_2957_tableS2.docWord document44KPrimers used in this study

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.