SEARCH

SEARCH BY CITATION

Keywords:

  • Encapsidation;
  • Bacteriophage;
  • Synechococcus;
  • Horizontal gene transfer

Abstract

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results and discussion
  6. Acknowledgements
  7. References

It has been speculated that horizontal gene transfer might be important in the evolution of strains of the marine cyanobacterium Synechococcus and that phages might mediate this process, but until now there has been no direct evidence to support this idea. We have rigorously purified bacteriophages (cyanomyoviruses) from their Synechococcus host and performed a series of experiments on phage-encapsidated DNA to reveal the presence of chromosomal Synechococcus DNA. Quantitative polymerase chain reaction has shown that ∼1 in 105Synechococcus phage particles contain a host marker gene in their capsids. This is the first study that has shown that phages infecting marine Synechococcus strains can package host DNA and this provides evidence for the potential importance of these phage in horizontal gene transfer.


1Introduction

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results and discussion
  6. Acknowledgements
  7. References

Unicellular cyanobacteria of the genera Synechococcus and Prochlorococcus make a major contribution to marine primary production [1–4]. Bacteriophages that infect Synechococcus were first isolated around 10 years ago [5–7] and although their full impact on natural populations of Synechococcus is still not clear, they are thought to exert an effect on the ecosystem as a whole by diverting fixed carbon into the microbial loop (for a review see [8]). Secondly, and of major interest to this study, bacteriophages may affect Synechococcus population evolution by acting as vectors for horizontal gene transfer.

Horizontal gene transfer has been shown to be important in the evolution of prokaryotes in the natural environment [9–11]. However, there is little information concerning the role of bacteriophages in horizontal gene transfer in the marine environment, though transduction has been demonstrated in the case of marine heterotrophic bacteria [12]. Indirect evidence of horizontal gene transfer in marine cyanobacteria has been obtained by Barker et al. [13], who observed varying allelic combinations in isolates of Nodularia from the Baltic Sea. In order to examine the potential of Synechococcus bacteriophages to carry out transduction we have modified a technique described by Sander and Schmieger [14] in which we examine phage-encapsidated DNA for the presence of a Synechococcus chromosomal marker.

2Materials and methods

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results and discussion
  6. Acknowledgements
  7. References

2.1Phages, host strains and media

The cyanomyovirus S-PM2 used in these experiments was originally isolated from water collected off the coast of Plymouth (UK) [7]. The other cyanomyoviruses used were recently isolated in our laboratory from Red Sea samples kindly provided by Dr N. Fuller. Samples were filtered through 0.22-μm filters to remove debris and cells. Isolation of phages was carried out by plaque assay on Synechococcus strains, as previously described [7]. Red Sea bacteriophages (all cyanomyoviruses) were mixed together before testing for their ability to encapsidate host DNA. Phages used in Mixture 1 were: S-RSM41, S-RSM46, S-RSM54, S-RSM48, S-RSM55, S-RSM3, S-RSM71, S-RSM61 and S-RSM67 and in Mixture 2: S-RSM10, S-RSM45, S-RSM12, S-RSM58, S-RSM75, S-RSM59 and S-RSM76.

The host strains used in this study were Synechococcus sp. WH7803 and a derivative, Synechococcus sp. WH7803 ptrA::Km, that carries a cassette encoding kanamycin resistance inserted into the ptrA gene (Dr D. Scanlan, unpublished) and is referred to here as WH7803::Km.

Synechococcus strains were grown in ASW medium in 100-ml batch cultures in 250-ml conical flasks under constant illumination (5–36 μEinstein m−2 s−1) at 25°C. Larger volumes were grown in 1-l vessels to which 0.5 g of NaHCO3 was added. Cultures were aerated and stirred constantly.

2.2Propagation of phages and removal of non-encapsidated DNA

The Red Sea phages, listed in Section 2.1, were combined and were propagated on WH7803::Km grown on solid medium as previously described [7]. The resulting phage progeny were recovered by flooding the plates with TM buffer (50 mM Tris–HCl pH 7.5+8 mM MgSO4·7H2O). In order to remove non-encapsidated DNA, a modification of the protocol of Sander and Schmieger [14] was employed. The phage samples were treated with 100 μl DNase I, 30 μl RNase and 30 μl lysozyme and shaken overnight at 4°C (all enzymes were from Sigma and were used as stock solutions at 10 mg ml−1). The sample was extracted with an equal volume of chloroform and centrifuged for 30 min at 3000 rpm in a microcentrifuge at room temperature. The supernatant was then incubated with 100 μl lysozyme for a further hour at 37°C. A further chloroform treatment and centrifugation was carried out and the samples were treated with a further 100 μl DNase I, 30 μl RNase and 30 μl lysozyme and shaken overnight at 4°C. A final chloroform treatment and centrifugation was then performed. As a control to confirm the removal of non-encapsidated DNA, some samples were spiked with 1 μg of the plasmid pES10 DNA (see below) and treated as described above.

2.3Extraction of bacteriophage-encapsidated DNA

Cyanophage-encapsidated DNA was obtained from treated samples by phenol–chloroform extraction according to Maniatis et al. [15]. The DNA was precipitated at −20°C overnight by the addition of 0.4 volume 5 M ammonium acetate and 2 volumes 99% (v/v) ethanol and harvested by centrifugation at 13 000 rpm in a microcentrifuge at room temperature. The pellet was vacuum-dried and resuspended in 50 μl of deionised H2O by gentle insertion and incubation at 4°C for 2 h. DNA was quantified spectrophotometrically at 260 nm and diluted to a concentration of 3 ng μl−1.

2.4Polymerase chain reaction (PCR) amplification

In order to confirm the complete removal of non-encapsidated DNA 1 μl of phage-encapsidated DNA (3 ng μl−1) was added to a PCR (total volume 50 μl) that consisted of 5 μl 10×reaction buffer with (NH4)2SO4 (MBI Fermentas), 4 μl 2 mM dNTPs, 4 μl MgCl2 (25 mM), 1 μl 10 μM primers M13F (GTAAAACGACGGCCAG) and M13R (CAGGAAACAGCTATGAC) and 1 U native Taq DNA polymerase (MBI Fermentas). These primers amplify a ∼550-bp product from the plasmid pES10 which consists of an insert of DNA from the cyanobacterium Synechocystis sp. PCC6803 in the plasmid vector pCR®2.1 (Invitrogen). Non-enzyme-treated samples were used as a positive control. PCR was carried out in a Biometra thermal cycler and the following temperature profiles and extension times were used: a hot start of 94°C for 5 min was linked to 30×(94°C for 30 s, 55°C for 30 s, 72°C for 45 s) and this was linked to 1×72°C for 10 min. PCR products were analysed by gel electrophoresis in a 1% (w/v) agarose gel in 1×TBE and products were visualised using ethidium bromide.

In order to detect the kanamycin resistance cassette in bacteriophage-encapsidated DNA 3 ng of DNA was added to a total of 50 μl PCR mix, as described above, apart from a lower molarity of MgCl2 (2 μl of 25 mM MgCl2 was added) and the primers used were Kan238F (CCGACTCGTCCAACATCAAT) and Kan354R (GTCTCGCTCAGGCGCAATCA). The plasmid pMUT100 [16] from which the kanamycin cassette was originally derived was used as a positive control as was genomic DNA from WH7803::Km.

For real-time PCR 3 ng of phage DNA was added to 18 μl of H2O, 0.8 μl MgCl2 (25 mM), 0.1 μl of 20 pM μl−1 primers, 2 μl of LightCycler-DNA Master SYBR Green 1 (Roche). Amplification was carried out in a Roche light cycler and temperature profiles used were as follows: 94°C for 0 s, 58°C for 5 s and 72°C for 10 s. In each run, the phage sample was compared to a serial dilution of pMUT100 from 1×10−10 to 1×10−15 g. The number of molecules of plasmid used in the serial dilution was calculated by dividing the amount of plasmid added to the reaction by the molecular mass of the plasmid multiplied by Avogadro's number. The number of molecules of phage DNA was calculated in the same way and this value was divided by the above value to determine how many phage genomes had encapsidated host DNA.

3Results and discussion

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results and discussion
  6. Acknowledgements
  7. References

If the cyanomyoviruses to be tested package DNA by a headful mechanism and do not completely degrade the host genome, then a proportion of capsids will contain fragments of host DNA similar in size to the phage genome. Such bacteriophages will represent potential generalised transducing particles. To establish whether this was the case, bacteriophage-encapsidated DNA was screened by PCR for the presence of the kanamycin resistance cassette marker gene, which was present in the genome of the propagating strain WH7803::Km. This required the complete removal of all non-encapsidated nucleic acids and intact host cells by treatment of the bacteriophage lysate with DNase, RNase and lysozyme. It was assumed that encapsidated DNA would be protected. In order to confirm the complete removal of non-encapsidated DNA, plasmid DNA (pES10) containing an insert of DNA from the cyanobacterium Synechocystis sp. PCC 6803 was added to the samples. As the amount of plasmid DNA added in this spike was well in excess of free non-encapsidated DNA present in the sample it is assumed that when the plasmid insert could not be detected by PCR all other non-encapsidated DNA in the sample had been degraded. It is clear that the treatment to remove non-encapsidated DNA reduced the added pES10 DNA below the limits of detection by PCR (Fig. 1).

image

Figure 1. Degradation of non-encapsidated DNA monitored by agarose gel analysis of PCR amplification products obtained using the M13F and M13R primers which amplify a ∼500-bp product from a Synechocystis DNA insert in plasmid pES10. Lane M, 1-kb ladder (Invitrogen); lane 1 is a negative control with no template DNA, lanes 2–4 are phage lysate samples (S-PM2, Red Sea Mixture 1 and Red Sea Mixture 2) which had pES10 DNA added and were not treated to degrade non-encapsidated DNA. Lanes 5–7 are the same phage lysates (S-PM2, Red Sea Mixture 1 and Red Sea Mixture 2, respectively) which had pES10 DNA added and were treated to degrade non-encapsidated DNA.

Download figure to PowerPoint

These phage lysate samples, which contained undetectable amounts of non-encapsidated DNA, were then screened for the presence of the kanamycin resistance cassette which represented a marker for host genomic DNA. The encapsidated DNA was extracted from the treated lysates and the presence of the kanamycin resistance cassette was screened for by PCR. It is clear that in the absence of template DNA, or in the presence of phage DNA propagated on wild-type Synechococcus sp. WH7803, there is no detectable PCR product with primers designed against the kanamycin resistance cassette (Fig. 2). The same result is obtained with Synechococcus sp. WH7803 genomic DNA. A 220-bp product was obtained with genomic DNA from WH7803::Km and with the plasmid pMUT100 which was the original source of the kanamycin resistance cassette. Similarly sized products were obtained with the encapsidated DNA from treated phage lysate, though in the case of S-PM2 the product was only weakly detectable. The 220-bp product was sequenced to confirm its identity (data not shown). These results indicate that the cyanomyoviruses are able to encapsidate Synechococcus genomic DNA.

image

Figure 2. Detection of the host-encoded kanamycin resistance cassette in bacteriophage-encapsidated DNA by agarose gel analysis of PCR amplification products obtained using the Kan238F and Kan354R primers. Lane 1, no template DNA; lane 2, DNA from phage-propagated Synechococcus sp. WH7803 wild-type; lane 3, genomic DNA from wild-type Synechococcus sp. WH7803; lane 4, DNA from WH7803::Km; lanes 5–7, encapsidated DNA from treated lysates of S-PM2, Red Sea Mixture 1 and, Red Sea Mixture 2 respectively. Lane M, 1-kb ladder (MBI Fermentas).

Download figure to PowerPoint

No product was detected in the negative control where no template was added (lane 1). Similarly no product was detected in either wild-type Synechococcus or in phage that were grown on wild-type cells (lanes 2 and 3). A product was amplified from the mutant strain of WH7803::Km (lane 4). All three samples from Fig. 1 had packaged host DNA (lanes 5–7). The S-PM2 sample (lane 5) was focused on as it is of interest to quantify the number of a single phage isolate that have encapsulated host DNA.

In order to quantify this frequency of host DNA carriage by phages we used real-time PCR and the primers designed against the kanamycin resistance cassette. The rate of amplification of the host marker in bacteriophage-encapsidated DNA was compared to the rate of amplification of a serial dilution of plasmid pMUT100 ranging from 10−10 to 10−15 g of plasmid DNA. Initial experiments had shown that 10−15 g was the limit of detection of pMUT100 using real-time PCR. This equates to approximately 165 molecules of the plasmid being present and is consistent with the expected lower limits of detection. The S-PM2-encapsidated DNA sample was included in the real-time PCR at the same time as the plasmid dilution series. It was assumed that the plasmid sample that amplified at the same rate as the encapsidated DNA sample had the same number of molecules of plasmid as there were copies of the kanamycin cassette in the encapsidated DNA. This rate was calculated from the middle point of a curve where fluorescence is plotted against the number of PCR cycles. This was the sample that contained 10−15 g of plasmid DNA, i.e. there were ∼165 copies of the kanamycin resistance cassette in the sample of encapsidated DNA. This is consistent with the faint PCR product that was repeatedly obtained from amplification of S-PM2 which were propagated on WH7803::Km. The S-PM2 lysate was titred prior to DNA extraction. From these values it can be calculated that approximately 10−5 phage packaged the 220-bp region of the kanamycin resistance cassette.

The overall frequency of potential transducing particles can be estimated using two different assumptions. Under the first assumption, phage randomly package the marker fragment independently from other host DNA. Therefore it follows that as the 220-bp fragment is ∼10−4 the size of the host genome, when this value is multiplied by the encapsidation rate it can be estimated that 1/10 phage may possibly encapsidate host DNA of this size.

The second estimation of encapsidation rate assumes, probably more reasonably, that S-PM2 packages randomly selected host DNA fragments of a similar size to the S-PM2 genome, which is ∼194 kb [17], and that the Synechococcus sp. WH7803 genome is of a similar size to that of Synechococcus sp. WH8102 at ∼2.4 Mb. Thus, the average fragment size for encapsidated host genomic DNA would be ∼194 kb, which represents about 8% of the complete genome and therefore the total frequency of potential transducing particles is going to be of the order of 10−4.

In conclusion, it appears that at least some myoviruses infecting marine Synechococcus strains are capable of encapsidating host DNA at an appreciable frequency and therefore are potential agents of horizontal gene transfer. However, there are other potential barriers to transduction by phage such as their host range and a host-specified restriction system. The ability of these myoviruses to actually transduce genetic markers is currently being studied in this laboratory.

Acknowledgements

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results and discussion
  6. Acknowledgements
  7. References

We would like to acknowledge Nick Fuller for providing Red Sea water samples. This work was supported by a grant to N.H.M. from the Natural Environment Research Council as part of its Marine and Freshwater Microbial Biodiversity thematic programme.

References

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results and discussion
  6. Acknowledgements
  7. References
  • [1]
    Goericke, R., Welschmeyer, N.A. (1993) The marine prochlorophyte Prochlorococcus contributes significantly to phytoplankton biomass and primary production in the Sargasso Sea. Deep Sea Res. 40, 22832294.
  • [2]
    Li, W.K.W. (1995) Composition of ultraphytoplankton in the Central North Atlantic. Mar. Ecol. Prog. Ser. 122, 18.
  • [3]
    Liu, H., Nolla, H.A., Campbell, L. (1997) Prochlorococcus growth rate and contribution to primary production in the equatorial and subtropical North Pacific Ocean. Aquat. Microb. Ecol. 12, 3947.
  • [4]
    Veldhuis, M.J.W., Kraay, G.W., Van Bleijswijk, J.D.L., Baars, M.A. (1997) Seasonal and spatial variation in phytoplankton biomass, productivity and growth in the northwestern Indian Ocean; the southwest and northeast monsoon 1992–1993. Deep Sea Res. 44, 425449.
  • [5]
    Waterbury, J.B., Valois, F.W. (1993) Resistance to co-occurring phages enables marine Synechococcus communities to coexist with cyanophages abundant in seawater. Appl. Environ. Microbiol. 59, 33933399.
  • [6]
    Suttle, C.A., Chan, A.M. (1993) Marine cyanophages infecting oceanic and coastal strains of Synechococcus: abundance, morphology, cross-infectivity and growth characteristics. Mar. Ecol. Prog. Ser. 92, 99109.
  • [7]
    Wilson, W.H., Joint, I.R., Carr, N.G., Mann, N.H. (1993) Isolation and molecular characterization of five marine cyanophages propagated on Synechococcus sp. strain WH7803. Appl. Environ. Microbiol. 59, 37363743.
  • [8]
    Fuhrman, J.A. (1999) Marine viruses and their biogeochemical and ecological effects. Nature 399, 541548.
  • [9]
    Koonin, E.V., Makarova, K.S., Aravind, L. (2001) Horizontal gene transfer in prokaryotes: quantification and classification. Annu. Rev. Microbiol. 55, 709742.
  • [10]
    Droge, M., Puhler, A., Selbitschka, W. (1999) Horizontal gene transfer among bacteria in terrestrial and aquatic habitats as assessed by microcosm and field studies. Biol. Fertil. Soils 29, 221245.
  • [11]
    Davison, J. (1999) Genetic exchange between bacteria in the environment. Plasmid 42, 7391.
  • [12]
    Jiang, S.C., Paul, J.H. (1998) Gene transfer by transduction in the marine environment. Appl. Environ. Microbial. 64, 27802787.
  • [13]
    Barker, G.L.A., Handley, B.A., Vacharapiyasophon, P., Stevens, J.R., Hayes, P.K. (2000) Allele-specific PCR shows that genetic exchange occurs among genetically diverse Nodularia (cyanobacteria) filaments in the Baltic Sea. Microbiology 146, 28652875.
  • [14]
    Sander, M., Schmieger, H. (2001) Method for host-independent detection of generalized transducing bacteriophages in natural environments. Appl. Environ. Microbiol. 67, 14901493.
  • [15]
    Maniatis, T.E., Fritsch, F. and Sambrook, J. (1982) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
  • [16]
    Brahamsha, B. (1996) A genetic manipulation system for oceanic cyanobacteria of the genus Synechococcus. Appl. Environ. Microbiol. 62, 17471751.
  • [17]
    Hambly, E., Tétart, F., Desplats, C., Wilson, W.H., Krisch, H.M., Mann, N.H. (2001) A conserved genetic module that encodes the major virion components in both the coliphage T4 and the marine cyanophage S-PM2. Proc. Natl. Acad. Sci. USA 98, 1141111416.