Characterization of In111, a class 1 integron that carries the extended-spectrum β-lactamase gene blaIBC-1

Authors


*Corresponding author. Tel.: +30 (210) 6478810; Fax: +30 (210) 6423498, E-mail address: miriagou@otenet.gr

Abstract

A class 1 integron, In111, carried by a self-transferable plasmid from an Escherichia coli clinical strain was characterized. The variable region of In111 constituted an array of gene cassettes encoding the extended-spectrum β-lactamase IBC-1, the aminoglycoside-modifying enzymes AAC(6′)-Ib and ANT(3″)-Ia, dihydrofolate reductase I and a putative polypeptide (SMR-2) sharing similarity with the Qac transporters. Transcription of the gene cassettes was driven by a hybrid-type P1 promoter located in a typical 5′ conserved segment (CS). The 3′CS included sulI, qacEΔ1, orf5 and orf6. In111 was bounded on the right by an inversely oriented IRt. The 5′CS was preceded by an intact IS26 element followed by an aphA1 gene.

1Introduction

The integrons most frequently found in antibiotic-resistant bacteria belong to class 1. This structure consists of two conserved segments, 5′CS and 3′CS, flanking a variable region that may contain genes in the form of cassettes. The 5′CS is comprised of the integrase gene (intI1), the recombination site attI1, and the Pc promoter, which directs transcription of the gene cassettes. IntI1 mediates integration of gene cassettes into the attI1 site. The 3′CS may vary in size but usually includes genes encoding resistance to sulfonamides (sulI) and disinfectants (qacEΔ1) [1–4].

Class 1 integrons carrying genes that confer resistance to most of the clinically significant antibiotics such as β-lactams and aminoglycosides are widely distributed among various Gram-negative microorganisms, particularly enterobacterial species [5–8]. Class 1 integrons are frequently located in plasmids that facilitate their spread. In this study a novel class 1 integron, designated In111, has been characterized. In111 carried multiple antibiotic resistance genes, including the extended-spectrum β-lactamase (ESBL) gene blaIBC-1[9], and was associated with an IS26 insertion sequence. In111 was located in a transferable plasmid harbored by an Escherichia coli clinical strain.

2Materials and methods

2.1Bacterial strains, plasmids and susceptibility testing

E. coli AK33 was isolated in March 2002 from a stool specimen of a hospitalized patient in Athens. E. coli strains 14R519 (Nalrlac+) and DH5α were used as recipients in conjugation and transformation experiments, respectively. The chloramphenicol-resistant phagemid pBC SK(+) (Stratagene, La Jolla, CA, USA) and the XcmI-containing vector (pMON38201), that is suitable for cloning PCR products [10], were used for cloning. Susceptibility status to antibiotics was determined with an agar dilution technique as recommended by the National Committee for Clinical Laboratory Standards [11].

2.2Transfer of antibiotic resistance and plasmid characterization

Conjugal transfer of antibiotic resistance was carried out in mixed broth cultures as described previously [9]. Transconjugant clones were selected in LB agar containing nalidixic acid (200 mg l−1) plus ampicillin (50 mg l−1) or ceftazidime (10 mg l−1). Plasmid DNA preparations were obtained from the donor E. coli strain and the E. coli transconjugants by an alkaline lysis technique [12]. Wild-type plasmids were purified from low-melting-point agarose.

2.3Transposon and integron mapping by PCR

Mapping was performed by PCR using oligonucleotide primers specific for conserved segments of the class 1 integrons and the IS26 elements [13–15]. Detection of the antibiotic resistance genes was also performed by PCR. Oligonucleotide primers and the respective amplified fragments are described in Table 1.

Table 1.  Oligonucleotide primers used in various combinations for the characterization of In111 and its flanking regionsa
  1. aThe pBC SK(+)- and pMON38201-specific primers (T3, T7, M13, SK and KS) are not included in the table.

PrimerNucleotide sequence (from 5′ to 3′)Position in sequence AY260546Specific for gene/segmentReference
F2CCCCAAGGAGAGATCGTCG2945–2963blaIBC-1 (forward)[9]
R2GTAATCTCTCTCCTGGGCTT3562–3543blaIBC-1 (reverse)[9]
INT-3ACACCGTGGAAACGGATGAA1819–1838IntI1 gene of class 1 integrons (forward)This study
INT-FCGTTCCATACAGAAGCTG1539–1556IntI1 (forward – downstream the promoter region)This study
IS26TR-FGATCACTCCACGATTTACCGC232–252tnpA of IS26 (forward)This study
IS26TR-SATGAACCCATTCAAAGGCCG106–125tnpA of IS26 (forward)This study
IS26L-FCACTGTTGCAAATAGTCGGTG45–65Left ITR of IS26 (forward)This study
IS26R-RACTGTTGCAAAGTTAGCGATG859–839Right ITR of IS26 (reverse)This study
AAC6-FACTGAGCATGACCTTGCAAT2190–2209aacA4 (forward)[13]
AAC6-RCTGGCGTGTTTGAACCATGT2675–2655aacA4 (reverse)[13]
DHFRI-FTGGAGTTATCGGGAATGGC4247–4265dhfrI (forward)This study
DHFRI-RGTTAGAGGCGAAGTCTTGGG4649–4630dhfrI (reverse)This study
ANT3-FGTGGATGGCGGCCTGAAGCC4903–4922aadA1 (forward)[14]
ANT3-RATTGCCCAGTCGGCAGCG5429–5412aadA1 (reverse)[14]
QAC-FGTTATCGCAATAGTTGGCG5768–5786qacEΔ1 (forward)[15]
QAC-RAGCTTTTGCCCATGAAGCAACC5994–5973qacEΔ1 (reverse)[15]
SUL-FGATTTTTCTTGAGCCCCGC6617–6635sul1 (forward)[15]
SUL-RTGGACCCAGATCCTTTACAGG6771–6751sul1 (reverse)[15]

2.4Cloning and DNA sequencing

Selected PCR amplicons were cloned into the XcmI-digested pMON38201 plasmid. Also, fragments of pAK33, obtained after partial digestion with PstI or EcoRI restriction enzymes, were cloned into pBC SK(+). Recombinant plasmids were used to transform E. coli DH5α. Nucleotide sequencing was performed directly on several overlapping amplicons and also on cloned fragments using an ABI Prism 377 DNA sequencer (Perkin Elmer, Applied Biosystems Division, Foster City, CA, USA). Sequence similarity searches were carried out with the BLAST program available at the website of the National Center of Biotechnology Information (http://www.ncbi.nlm.nih.gov).

3Results and discussion

3.1Antibiotic resistance phenotype

E. coli AK33 was highly resistant to penicillins, early generation cephalosporins and ceftazidime. Minimal inhibitory concentrations of cefotaxime and aztreonam were below the respective breakpoints (64 and 32 mg l−1, respectively). Resistance to β-lactams was reversed by clavulanic acid. This resistance pattern resembled that conferred by the rare ESBLs of the GES/IBC type [9,16]. The strain was also resistant to streptomycin, kanamycin, neomycin, netilmicin, tobramycin, amikacin, trimethoprim and sulfonamides.

3.2Transfer of resistance

All resistance markers were transferred to susceptible E. coli by conjugation at a frequency of 10−5 transconjugants per donor cell. Plasmid DNA analysis indicated transfer of a plasmid that was approximately 80 kb in size and designated pAK33. Plasmid pAK33 was purified from low-melting-point agarose and used to transform E. coli DH5α, which is an F host. The resulting clones were able to transfer resistance by conjugation suggesting that plasmid pAK33 was self-transferable.

3.3Structure of the antibiotic resistance locus of pAK33

The assembled nucleotide sequences, corresponding to a 7.9-kb segment of pAK33, showed the presence of a class 1 integron designated In111. The variable region included the genes (from 5′CS to 3′CS) aacA4, blaIBC-1, orf0, dhfrI and aadA1 in the form of cassettes. This array of genes matched the antibiotic resistance pattern conferred by pAK33. It was also found that the 5′CS of In111 was preceded by an IS26 insertion sequence that was associated with an aphA1 gene. A graphic presentation of this structure is in Fig. 1A. The sequence has been submitted to the GenBank and assigned number AY260546.

Figure 1.

A: Schematic presentation of In111 and the associated IS26 element. The sequence of the common promoter region is also shown. In B, the sequences of the 14-bp ITRs (ITRL and ITRR) of IS26 and the 25-bp inversely oriented IRt found at the boundaries of In111 are indicated.

3.4Gene cassettes of In111

The total size of the gene cassette region of In111 was 3458 bp. The first cassette (from 5′CS to 3′CS) included aacA4 that is an allele of aac(6′)-Ib gene. The deduced polypeptide, AAC(6′)-Ib, is an acetyl-transferase conferring resistance to tobramycin, netilmicin and amikacin. This was followed by a blaIBC-1 cassette encoding the extended-spectrum β-lactamase IBC-1 that preferentially hydrolyzes ceftazidime and is strongly inhibited by clavulanic acid and imipenem [9]. The sequences of aacA4 and blaIBC-1 and the respective 59 base elements (59-be) were identical with those of a partially characterized IBC-encoding integron found previously in Enterobacter cloacae[9] except a single codon (nts 3167–3169, AY260546) corresponding to the amino acid position 125 of the IBC-1 enzyme (Ambler's numbering scheme) that was erroneously reported as CTG (Leu) (AF208529, GenBank) instead of GCT (Ala). The blaIBC gene was followed by a cassette that included an open reading frame (ORF) of 318 bp that was 97% homologous to the orf0 previously described in a class 1 integron from Serratia marcescens (AF453998, GenBank). The latter encodes a protein exhibiting similarity with the Qac transporters [17]. The similarity of the two polypeptides was limited to the N-terminal ends due to the deletion of four nucleotides in orf0 of In111 (corresponding to nt positions 4196, 4213, 4226, 4245 of AF453998) changing the hypothetical reading frame. However, BLASTP search showed that the putative product of the orf0 gene found here (designated SMR-2) was 87% similar with the SMR-1, an integron-encoded protein from Stenotrophomonas maltophilia (AAL07365, GenBank). Both SMR polypeptides possess the typical motifs of the small multi-drug resistance proteins mediating efflux of lipophilic cations [18]. Notably, the 60-bp-long 59-be of the orf0 cassette of In111 was 96% homologous to the 59-be of the qacF cassette of In40 (AF034958, GenBank) [19]. The fourth cassette included an allele of the dhfrI gene mediating resistance to trimethoprim. The last cassette of the variable region included an aadA1 gene encoding ANT(3″)-Ia, an aminoglycoside-modifying enzyme that inactivates streptomycin and spectinomycin.

3.5The 5′ and 3′CS of In111 and its flanking sequences

The intI1 allele of 5′CS encoded a DNA integrase characteristic of class 1 integrons. Transcription of the gene cassettes was most likely driven by a P1 hybrid-type promoter (TGGACA-N17-TAAACT), that along with the ‘strong’ and ‘weak’ P1 types, are commonly found in class 1 integrons [20]. A segment corresponding to the inactive form of P2 was also observed within the 5′ end of intI1 (Fig. 1A). The 3′CS typically comprised a deletion derivative of qacE (qacEΔ1) and the sulfonamide resistance gene sul1. The latter was followed by orf5 (501 bp) and orf6 (288 bp). In the right boundary of In111 an inversely oriented IRt (25 bp) as in the In4-type integrons such as In33 [8] was detected. However, the IRi, that is the left side counterpart of IRt was not found. Instead, at a 144-bp distance of the stop codon of IntI1, an IS26 element was detected (Fig. 1). IS26 was 820 bp long, faced inwards and included a transposase-encoding gene (705 bp) identical with the tnpA gene of the kanamycin resistance transposon Tn2680[21]. The tnpA gene was bounded by inverted terminal repeats (ITRs) characteristic of the IS26 elements (Fig. 1B) [22]. Upstream of IS26, a segment of 555 bp that was homologous with the 5′ end of the aphA1 gene was detected. The latter is an 816-bp gene encoding resistance to kanamycin and neomycin and is commonly associated with transposable elements such as Tn2680, Tn4352, Tn903 and Tn602.

3.6Concluding remarks

Most gene cassettes carried by class 1 integrons confer resistance to various antibiotic classes. In111 is yet another example of a class 1 integron mediating resistance to clinically significant antibiotic classes including expanded-spectrum cephalosporins and aminoglycosides. Of note is the presence of a blaIBC-1 gene cassette in the variable region of In111. IBC-1 and the highly similar GES-1 and GES-2 constitute a cluster of ESBLs found in sporadic enterobacterial and Pseudomonas aeruginosa strains [9,16,23]. These rare β-lactamases, along with VEB-1 [24], are the sole integron-encoded class A β-lactamases described to date. Spread of class 1 integrons conferring resistance to newer β-lactams has apparently been facilitated by the intensive use of these antibiotics. The means of spread of In111 seems to be the self-transferable plasmid pAK33. Examination of IBC-producing enterobacteria isolated sporadically in Greek hospitals [25] suggested acquisition of pAK33-like plasmids carrying the structure described in this study (data not shown).

IS26 elements have been described as parts of various composite transposons [21,26,27]. These transposons include two IS26 in direct repeat flanking regions of variable size that contain antibiotic resistance genes. The IS26 and the partial aphA1 sequence found in the left boundary of In111 may comprise a part of such a composite transposon. Class 1 integrons are considered incapable of self-transposition. Yet, the wide spread of these structures in distinct genetic units suggests implication of transpositional mechanisms [8]. It was recently shown that the VEB-1-encoding class 1 integron In53 is flanked by two IS26 elements forming the novel transposon Tn2000[26]. IS26-mediated transposition proceeds through a replicative process that requires the presence of two intact external ITRs. However, we were unable to locate such sequences beyond the right end of In111. Thus, the significance of the association of In111 with IS26 is unclear.

Acknowledgments

We thank Dr. Yohei Doi (National Institute of Infectious Diseases, Tokyo, Japan) for pointing out the error in codon 125 of the blaIBC genes.

Ancillary