SEARCH

SEARCH BY CITATION

Keywords:

  • Bacillus anthracis;
  • Bacillus cereus group;
  • Multiplex detection;
  • Real-time polymerase chain reaction;
  • LightCycler

Abstract

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results
  6. 4Discussion
  7. Acknowledgements
  8. References

Bacillus anthracis has four plasmid possible virulence genotypes: pXO1+/pXO2+, pXO1+/pXO2, pXO1/pXO2+ or pXO1/pXO2. Due to the lack of a specific chromosomal marker for B. anthracis, differentiation of the pXO1/pXO2 form of B. anthracis from closely related Bacillus cereus group species is difficult. In this study, we evaluate the ability of sspE, pXO1 and pXO2 primers to discriminate individual B. anthracis and the B. cereus group genotypes using multiplex real-time PCR and melting curve analysis. Optimal conditions for successful multiplex assays have been established. Purified DNAs from 38 bacterial strains including 11 strains of B. anthracis and 18 B. cereus group strains were analyzed. Nine of the B. cereus group near-neighbor strains were shown by multilocus sequence typing to be phylogenetically proximate to the B. anthracis clade. We have demonstrated that the four plasmid genotypes of B. anthracis and B. cereus group near-neighbors were differentially and simultaneously discriminated by this assay.


1Introduction

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results
  6. 4Discussion
  7. Acknowledgements
  8. References

The Bacillus cereus group is comprised of B. anthracis, B. cereus, B. thuringiensis, B. mycoides, B. weihenstephanensis[1] and B. pseudomycoides[2]. B. anthracis and B. cereus are clinically important because the former is the causative agent of anthrax and an agent used in bioterrorism, and the latter causes food-borne gastroenteritis and opportunistic infections in immunocompromised patients [3–6]. Other members of this group have been reported to be potentially enteropathogenic [7–11]. The unambiguous detection of these organisms has been difficult due to their genetic and phenotypic similarity. A high level of genetic relatedness has been demonstrated by whole-genome DNA hybridization [12,13], 16S and 23S gene rRNA sequence analysis [14,15], sequence analysis of 16S–23S operons [16,17] and the gyrB–gyrA intergenic spacer region [16], pulsed-field gel electrophoresis analysis [16,18], multilocus enzyme electrophoresis [18–20], and restriction fragmentation pattern analysis of the genome [21]. All of these methods failed to discriminate among some members of the B. cereus group. Because of their extremely high genetic homology, some investigators have suggested that B. anthracis, B. cereus and B. thuringiensis should be classified as a single species [12,20].

B. anthracis is a highly fatal infectious agent in animals and humans and therefore its early and unambiguous diagnostic detection is essential for successful treatment and disease prevention. There have been many efforts to utilize rapid DNA-based detection methods, such as PCR [22–33], to replace time-consuming biochemical or culture-based diagnostic tests [34]. PCR-based methods can readily differentiate vaccine or fully virulent B. anthracis plasmid genotypes [22–24,26,35]. However, plasmid-cured B. anthracis[36–39], or near-neighbor species containing B. anthracis closely-related plasmids [40], are very difficult to distinguish from B. anthracis. In addition, plasmids or their virulence genes have been readily transferred within these groups by means of conjugation or transformation [41–50].

PCR methods developed for detection of the B. anthracis chromosome have suffered from lack of assay specificity; Ba813 [25,26,51], vrrA gene [27–29], gyrase B gene (gyrB) [30], SG-850 [31], the β subunit of RNA polymerase gene (rpoB) [32] and the gyrase A (gyrA) gene [33] have shown false positive results in detection of the B. anthracis chromosome (Table 1, manuscript in preparation).

Table 1.  Bacterial strains used in this study and their DNA–based assay response (manuscript in preparation)
SpeciesStrain IDSourceaPlasmidb PCR forSG–749g sspE PCRh 
pXO1pXO2Ba813cgyrBdrpoBegyrAfPCRHaplotype71-bp188-bp   
  1. aATCC, American Type Culture Collection, Manassas, VA, USA; NVRQS, National Veterinary Research and Quarantine Service, Anyang-si, Kyeonggi-do, South Korea; BGSC, Bacillus Genetic Stock Center, Department of Biochemistry, The Ohio State University, Columbus, OH, USA; DSM, Deutsche Sammlung von Mikroorganismen und Zellkulturen, Braunschweig, Germany.

  2. bPlasmids were detected by PCR (51). +, detected; −, not detected.

  3. cDetermined by PCR (25). +, detected; −, not detected; +, false positive reaction.

  4. dDetermined by PCR using primers BA1 and BA2r (30). +, detected; −, not detected; +, false positive reaction.

  5. eDetermined by PCR and sequencing (32). +, detected; −, not detected; +, false positive reaction.

  6. fDetermined by PCR and sequencing (33). +, detected; −, not detected; +, false positive reaction.

  7. gDetermined by PCR and its haplotype was determined by Alu I restriction digestion of the PCR product (31). +, detected; −, not detected; false positive reaction is indicated by boldface K.

  8. hDetermined by PCR (manuscript in preparation). +, detected; −, not detected.

  9. iNot applicable.

B. anthracis14578TATCC+++++++K++
B. anthracisCAU–1Korea+++++++K++
B. anthracisCAU–2Korea+++++++K++
B. anthracisCAU–3Korea+++++++K++
B. anthracisCN1Korea+++++++K++
B. anthracisCN2Korea+++++++K++
B. anthracis14185ATCC++++++K++
B. anthracis14186ATCC++++++K++
B. anthracisSterne 34–F2NVRQS++++++K++
B. anthracisBCChina++++++K++
B. anthracisPasteur #2NVRQS+++++K++
B. thuringiensis4BG1BGSC+++G+
B. thuringiensis4Y1BGSC+++G+
Bacillus spp.9594/3Patra G.+++G+
B. thuringiensis4AY1BGSC++++L+
B. thuringiensis4AJ1BGSC++++E+
B. cereus6E1BGSC+++M+
Bacillus spp.IBRogers J. E.+++M+
Bacillus spp.IIIRogers J. E.+++M+
Bacillus spp.003Rogers J. E.+++M+
B. thuringiensis4CC1BGSC++K+
B. cereus6A7BGSC++G+
B. thuringiensis4AB1BGSC++E+
B. thuringiensis97–27Hernandez E.++E+
B. cereus14579TATCC+A+
B. thuringiensis2046TDSM+A+
B. pseudomycoides12442TDSM+J+
B. weihenstephanensis11821TDSM+G+
B. mycoides6462TATCC+G+
B. subtilis6051TATCCNAi
B. megaterium14581TATCCNA
B. licheniformis14580TATCCNA
B. circulans4513TATCCNA
Escherichia coli4157ATCCNA
Enterbacter aerogenes13048TATCCNA
Salmonella choleraesuis13076TATCCNA
Pseudomonas aeruginosa10145TATCCNA
Clostridium sporogenes3584TATCCNA

We have developed highly specific PCR-based assays for the B. anthracis chromosome using a sequence motif found within a spore structural gene (sspE) (GenBank accession number AF359938 and manuscripts in preparation). We report here the use of specific sspE primers for real-time PCR detection of B. anthracis and the use of melting curve analysis to detect/discriminate B. anthracis plasmid genotypes and the B. cereus group chromosome.

2Materials and methods

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results
  6. 4Discussion
  7. Acknowledgements
  8. References

2.1Bacterial strains and DNA isolation

A total of 38 bacterial strains used in this study are shown in Table 1. The strains, except for B. anthracis, were acquired from the American Type Culture Collection (Manassas, VA, USA), Bacillus Genetic Stock Center (Department of Biochemistry, The Ohio State University, Columbus, OH, USA) and Deutsche Sammlung von Mikroorganismen und Zellkulturen (Braunschweig, Germany). B. anthracis genomic DNA preparations were a gift from Chung-Ang University Medical College. Genomic DNA from other strains was isolated using the Easy-DNA kit (Invitrogen Corp., CA, USA) according to the manufacturer's protocol. DNA concentrations were determined spectrophotometrically [52] and diluted to 10 ng μl−1 in sterile distilled water. Both the quality and quantity of the DNA were evaluated following electrophoresis in a 0.7% agarose gels containing ethidium bromide (0.5 μg ml−1).

2.2Multilocus sequence typing

To assess the genetic relatedness among the 29 B. cereus group isolates used in this study, a phylogenetic tree based on partial nucleotide sequences of seven housekeeping genes and their allelic profiles was constructed using the unweighted pair group method with arithmetic means (UPGMA) with the START v1.0.8 software [53]. In addition, 121 available allele sequences from B. cereus isolates (http://pubmlst.org/bcereus) were included in this analysis to assess the genetic relationship of the 29 strains used in this study to previously studied B. cereus group isolates. Detailed multilocus sequence typing (MLST) methods are available online at http://pubmlst.org/bcereus.

2.3Primers

The chromosomal and plasmid primers used for PCR detection of B. anthracis are shown in Table 2. The sspE-1 primer pair targets the sspE chromosomal gene producing 188- or 71-bp amplicons. The cap-29 primer pair targets the capC gene of the pXO2 plasmid and produces a 318-bp amplicon. The lef-4 primer pair targets the lef gene of the pXO1 plasmid and produces a 475-bp amplicon. To evaluate the applicability of these primers for multiplex detection by melting curve analysis, the melting temperature (Tm) of each amplicon was calculated using Oligo® V6.5 software (Molecular Biology Insights Inc., Cascade, CO, USA).

Table 2.  Multiplex real-time PCR primer sequences
LociPrimersSequence (5′ 3′)Product (bp)aTm (°C)b
  1. aBoldface, B. anthracis specific amplicons.

  2. bCalculated by the nearest-neighbor method; Tm, melting temperature.

sspEsspE1–FGAGAAAGATGAGTAAAAAACAACAA188, 7160.9
(Chromosome)sspE1–RCATTTGTGCTTTGAATGCTAG 59.5
leflef4–FTGAACCCGTACTTGTAATCCAATC47567.6
(pXO1)lef4–RATCGCTCCAGTGTTGATAGTGCT 68
capCcap29–FGTTGTACCTGGTTATTTAGCACTC31862.7
(pXO2)cap29–RACCACTTAACAAAATTGTAGTTCC 62.3

The DNA sequences of the 71- and 188-bp sspE amplicons are:

  • 71-bp sspE amplicon: GAGAAAGATGAGTAAAAAACAACAAggttataacaaggcaacttctggtgCTAGCATT CAAAGCACAAATG

  • 188-bp sspE amplicon: GAGAAAGATGAGTAAAAAACAACAAggttataacaaggcaacttctggtgCTAGCATT CAAAGCACAAATGctagttatggtacagagtttgcgactgaaacaaatgtacaagcagtaaaaca agcaaacgcacaatcagaagctaagaaagcgcaagcttctggtgCTAGCATT CAAAGCACAAATG

Primer sequences are indicated by upper case letters.

These primers target an internal coding sequence motif found within the sspE gene which is indicated in bold type. In B. anthracis, this sspE gene sequence motif is repeated, while in all other members of the B. cereus group studied the sspE motif is present as a single copy. The sspE primer pair produces a 71-bp amplicon from all B. cereus group strains and a 188-bp B. anthracis-specific amplicon.

2.4Measurement of amplicon Tm

Simplex real-time PCR with triplicate samples was utilized to measure the average Tm of amplicons from the sspE, capC and lef genes. The reaction mixture (20 μl) contained 2 μl of 10 × LightCycler FastStart DNA Master SYBR Green I (10 mM MgCl2 is contained), 0.5 μM of each primer (Table 2), 10 ng of template DNA, and an additional 2 mM of MgCl2 to make a final concentration of 3 mM MgCl2. Cycling conditions were preincubation for 10 min at 95 °C, 40 cycles of 10 s at 95 °C, 2 s at 58 °C and 25 s at 72 °C. Melting curves were generated by measuring the fluorescent signal while raising the temperature by LightCycler software settings as follows: 0 s at 95 °C, 30 s at 65 °C and temperature increase from 65 to 95 °C with a temperature transition rate of 0.1 °C s−1. The Tm was measured using LightCycler software V 3.5.

2.5Multiplex real-time PCR

To detect the virulence plasmids and chromosome of B. anthracis simultaneously, optimal multiplex real-time PCR conditions were determined using three replicates of each template DNA. PCR conditions were the same as those described above for the simplex PCR except that 0.5 μM sspE-1 primers, 0.25 μM lef-4 primers, and 0.3 μM cap-29 primers were added to the reaction mixture, extension temperature was 65 °C, and the temperature transition rate for the melting curve analysis was 0.05 °C s−1. Multiplex amplification products were also confirmed by electrophoresis using a 2% agarose gel containing 0.5 μg ethidium bromide per ml of gel solution. Detection sensitivity of the multiplex assay was determined by dilution to extinction PCR (50 ng–500 fg of genomic DNA).

3Results

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results
  6. 4Discussion
  7. Acknowledgements
  8. References

3.1MLST genetic relatedness analysis

MLST analysis was used to explore the genetic relationships among the B. cereus group isolates used in this study and 121 reference isolates. We have determined that many of the isolates described here are very closely related to B. anthracis (Fig. 1). Eighteen of the non-B. anthracis isolates clustered within the B. cereus clade and nine strains were phylogenetically proximate to the B. anthracis clade. Eight non-B. anthracis isolates were more closely related to B. anthracis than the B. thuringiensis 97–27 strain which has been reported previously to be a close near-neighbor of B. anthracis[54,55] and B. cereus 2002734342 (G9241) which carries a pXO1-like plasmid [40]. B. thuringiensis BGSC 4AB1 and BGSC 4AJ1 were very closely related to B. anthracis having three or four identical allelic sequences, respectively, to those of B. anthracis (data not shown).

image

Figure 1. Multilocus sequence typing genetic relationships among 29 isolates used in this study and 121 reference isolates from the B. cereus group. The UPGMA tree was produced by multilocus sequence typing methods (http://pubmlst.org/bcereus). The sequences of the 121 isolates provided by http://pubmlst.org/bcereus were included in this analysis to assess the genetic relationships of the 29 strains described here. Eighteen of the non-B. anthracis isolates clustered within the B. cereus clade and nine strains were phylogenetically proximate to the B. anthracis clade. (A) MLST UPGMA tree for 150 B. cereus group strains. (B) Expanded MLST UPGMA tree of the 29 strains used in this study and selected near-neighbors. B. a., B. anthracis; B. c., B. cereus; B. t., B. thuringiensis; B. m., B. mycoides; B. p., B. pseudomycoides; B. w., B. weihenstephanensis; B. sp., Bacillus species.

Download figure to PowerPoint

3.2Calculation and measurement of PCR amplicon Tm

Tms of all possible amplicons that can be produced from B. anthracis DNA using the three primer pairs were estimated by calculations with Oligo® V6.5 software and are shown in Table 3. The differences between the software-estimated Tms ranged from 1 to 7.8 °C. The amplicons showing the smallest Tm differences (1 °C) were lef and capC. The Tms of these two amplicons were measured in triplicate samples by simplex real-time PCR and melting curve analysis (Table 3, Fig. 2). The measured Tm of the lef amplicon (80.19 ± 0.07 °C) was 1 °C less than its estimated Tm (81.3 °C). The measured Tm of the capC amplicon (77.96 ± 0.13 °C) was 2 °C less than its estimated Tm (80.3 °C). Contrary to the software predicted difference (1 °C) between the Tms of the lef and capC amplicons, real-time PCR melting curve analysis demonstrated a larger difference (2 °C) between these two PCR products. The Tm difference between the small sspE (71 bp) and capC amplicons was estimated to be 3.2 °C.

Table 3.  Calculated and measured melting temperatures (Tm) of amplicons targeting sspE, lef, and capC
TargetProduct
 Length (bp)GC (%)Calculated Tm (°C)aMeasured Tm (°C)bMeasured Tm (°C)c
  1. aObtained by using Oligo V6.5 software (nearest-neighbor method).

  2. bObtained by simplex real-time PCR and melting curve analysis using LightCycler V3.5 software, mean ± SD.

  3. cObtained by multiplex real-time PCR and melting curve analysis using LightCycler V3.5 software, mean ± SD.

sspE18839.482.682.69 ± 0.0383.59 ± 0.40
sspE7136.677.177.41 ± 0.0476.56 ± 0.96
lef47532.281.380.19 ± 0.0779.97 ± 0.53
capC31831.180.377.96 ± 0.1377.86 ± 0.30
image

Figure 2. Simplex real-time PCR melting curve analysis of three target genes (lef, capC and sspE) of B. anthracis ATCC 14578T and one target gene (sspE) of B. cereus ATCC 14579T. The melting temperatures were determined using LightCycler software V 3.5. The three amplicons representing the two virulence plasmids (lef, capC) and the chromosome (sspE– 188 bp) of B. anthracis generated sharp melting peaks. The B. cereus group sspE amplicon (71 bp) produced one broad melting peak without the specific sspE peak (188 bp) representing the chromosome of B. anthracis. The y axis is the negative differential of fluorescence over temperature (−dF/dT).

Download figure to PowerPoint

3.3Simultaneous differential identification of B. anthracis genotypes and the B. cereus group chromosome using multiplex real-time PCR and melting curve analysis

Multiplex real-time PCR and melting curve analysis utilized primer pairs targeting virulence plasmid (2) and chromosomal (1) genes. Analysis of DNA from fully virulent B. anthracis (pXO1+, pXO2+) detected four amplicons; one B. anthracis-specific sspE gene amplicon (188 bp), one B. cereus group sspE (71 bp) amplicon, the lef gene from the pXO1 plasmid and the capC gene from the pXO2 plasmid (Fig. 3A). The amplitude of the small B. cereus group sspE (71 bp) amplicon (75.6 °C) was diminished in reactions. Compared to the Tms previously measured by melting curve analysis in simplex real-time PCR, the Tm of the large sspE (188 bp) and lef amplicons deviated slightly (+0.9 and −0.21 °C, respectively) from the Tms measured in simplex real-time PCR. The Tm of the capC amplicon also deviated slightly (−0.1 °C) from the estimated Tm measured by simplex real-time PCR. These deviations resulted in improved separation of the melting peaks, allowing improved multiplex amplicon discrimination. Using Sterne B. anthracis (pXO1+, pXO2) template DNA, the melting curve peaks representing the lef and B. anthracis-specific sspE gene amplicons appeared without the capC peak (Fig. 3B). The amplitude of the small B. cereus group sspE (71 bp) amplicon (75.6 °C) was diminished in reactions. Using Pasteur B. anthracis (pXO1, pXO2+) template DNA, melting peaks representing the capC and B. anthracis-specific sspE gene amplicons were produced without the lef amplicon (Fig. 3C). The amplitude of the small B. cereus group sspE (71 bp) amplicon (75.6 °C) was diminished in reactions. Using B. anthracis template DNA derived from a fully attenuated strain (pXO1, pXO2), in addition to the 188-bp B. anthracis-specific sspE peak at 83.6 °C, there was also a prominent melting peak at 76.4 °C representing the small B. cereus group sspE amplicon (71 bp) (Fig. 3d). Using template DNA from B. cereus group species, only the melting peak representing the small sspE amplicon appeared as a broad peak at 76.8 °C (Fig. 3e). Thus, all plasmid genotypes of B. anthracis and strains from the B. cereus group were discriminated simultaneously by multiplex real-time PCR melting curve analysis.

image

Figure 3. Multiplex real-time PCR real-time PCR melting curve analysis of three target genes (lef, capC and sspE). The four plasmid genotypes of B. anthracis, and the B. cereus group chromosome, were differentially discriminated by melting peak analysis. Template DNAs were from: B. anthracis ATCC 14578T, panel A; B. anthracis Sterne 34-F2, panel B; B. anthracis BC, panel C; B. anthracis Pasteur #2, panel D; and B. cereus ATCC 14579T, panel E. The y axis is the negative differential of fluorescence over temperature (−dF/dT).

Download figure to PowerPoint

3.4Agarose gel analysis of real-time PCR products

Agarose gel analysis of multiplex real-time PCR reactions confirmed the presence of the expected PCR products (Fig. 4).

image

Figure 4. Agarose gel analysis of multiplex real-time PCR products. All target amplicons (lef– 475 bp, capC– 318 bp and sspE– 188 bp [B. anthracis-specific] or 71-bp [B. cereus group]) expected were confirmed by agarose gel electrophoresis. Amplicons in lane 6 and 7 are 643 bp in length and were produced from internal positive control DNA containing sspE primers. Lane M, 100 bp DNA ladder; lane 1, B. anthracis ATCC 14578T; lane 2, B. anthracis Sterne 34-F2; lane 3, B. anthracis BC; lane 4, B. anthracis Pasteur #2; lane 5, B. cereus ATCC 14579T; lane 6, B. subtilis ATCC 6051T; and lane 7, negative water control.

Download figure to PowerPoint

3.5Assay specificity and sensitivity

The B. anthracis multiplex real-time PCR assay did not produce false positive reactions with 29 near-neighbor B. cereus group strains and detected all tested B. anthracis genotypes.

The assay sensitivity, as determined by dilution to extinction PCR using DNA from B. anthracis carrying both virulence plasmids, was approximately 500 pg. Assuming that a B. anthracis cell has three copies of pXO1 and two copies of pXO2, this sensitivity corresponds to approximately 83,200 genome copies per PCR reaction.

4Discussion

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results
  6. 4Discussion
  7. Acknowledgements
  8. References

Bacillus anthracis can contain two virulence determinant plasmids, pXO1 and pXO2, and both plasmids are required for a fully virulent phenotype. pXO1 encodes the genes for two exotoxins, edema toxin and lethal toxin, and protective antigen [36]. The pXO2 plasmid encodes the genes for an antiphagocytic capsule [37,56,57]. Both pXO1 and pXO2 are large plasmids; pXO1 is 181.6 kb and encodes the lef, pagA and cya toxin genes, and pXO2 is 94.8 kb and encodes the capB, capC, and capA genes [58]. Either or both of these plasmids can be lost from the host in nature or by laboratory manipulation, generating four different genotypes of B. anthracis: pXO1+/pXO2+, pXO1+/pXO2, pXO1/pXO2+ and pXO1/pXO2. It has been difficult to distinguish avirulent B. anthracis strains (pXO1/pXO2) from near-neighbor B. cereus group species. In addition, a pathogenic B. cereus strain G9241 containing a plasmid closely related to pXO1 has recently been described [40]. Therefore, accurate discrimination of the B. anthracis chromosome, virulence plasmids and B. cereus group chromosome is required to determine the pathogenic potential of clade members.

The advent of real-time PCR technology [59] has revolutionized DNA detection and quantification. Moreover, the development of improved PCR cycling performance by the use of narrow glass capillary reaction chambers allows completion of as many as 40 reaction cycles within 1 h. This technology has been applied to the detection of many pathogens [60] including B. anthracis[32,35,61–65]. However, these assays have not achieved specific chromosomal discrimination between B. anthracis and near-neighbor species. The results presented here establish that multiplex real-time PCR assays can simultaneously detect B. anthracis plasmid and chromosome targets with high specificity including strains that by MLST phylogeny (Fig. 1) are close near-neighbors of B. anthracis. Eight of the B. anthracis near-neighbor strains studied were more closely related to B. anthracis than the B. thuringiensis 97–27 strain which has been reported previously to be a proximate near-neighbor of B. anthracis[54,55] and B. cereus 2002734342 (G9241) which carries a pXO1-like plasmid [40]. Three of the strains used in this study are the closest near-neighbors to B. anthracis that have been identified by MLST phylogeny. The described melting curve PCR assay was able to differentiate the four plasmid genotypes of B. anthracis and simultaneously discriminate very closely related B. cereus group species.

For successful multiplex PCR melting curve analysis, efficient amplification of all target genes and sufficient differences between amplicon Tms are required. The observed LightCycler melting peaks for amplicons targeting B. anthracis DNAs were sharp and evenly spaced, enabling unambiguous discrimination of all B. anthracis genotypes. The B. cereus group strains showed a broad melting peak representing the small (71 bp) sspE amplicon near the Tm of the capC amplicon that was well separated from the melting peak of the specific (188 bp) B. anthracis sspE amplicon. The use of an sspE coding sequence motif that is repeated in B. anthracis, while in all other members of the B. cereus group is present as a single copy within the sspE gene, provides unambiguous discrimination of B. anthracis from its near-neighbors. Production of the small (71 bp) amplicon was diminished in B. anthracis strains containing pXO1 or pXO2 plasmids. This may be due to more efficient SYBR Green dye binding by larger amplicons produced in these reactions. We have also developed a synthetic positive control DNA that can be used to detect failed PCR reactions (unpublished data and Fig. 4). This DNA template caused a slight broadening of amplicon melting curve peaks produced in multiplex real-time PCR (data not shown) but was useful for identifying inhibited PCR reactions.

The sspE assay detection sensitivity, determined by using fully virulent B. anthracis DNA, was approximately 500 pg (data not shown). For optimal assay results using the SYBR Green detection system, nanogram levels of purified DNA are required.

The multiplex sspE assay described here provides a rapid, inexpensive and sensitive means to simultaneously detect, from purified genomic DNA, all B. anthracis virulence genotypes and near-neighbor B. cereus group chromosomes. This capability will facilitate the analysis of environmental and clinical isolates which may contain B. anthracis or near-neighbor species of unknown virulence potential.

Acknowledgements

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results
  6. 4Discussion
  7. Acknowledgements
  8. References

This research was supported in part by DARPA (T.L., K.W., K.K., C.P.) and a Chung-Ang University research grant in 2003.

References

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results
  6. 4Discussion
  7. Acknowledgements
  8. References
  • [1]
    Lechner, S., Mayr, R., Francis, K.P., Pruss, B.M., Kaplan, T., Wiessner-Gunkel, E., Stewart, G.S., Scherer, S. (1998) Bacillus weihenstephanensis sp. nov. is a new psychrotolerant species of the Bacillus cereus group. Int. J. Syst. Bacteriol. 48 (Pt 4), 13731382.
  • [2]
    Nakamura, L.K. (1998) Bacillus pseudomycoides sp. nov. Int. J. Syst. Bacteriol. 48 (Pt 3), 10311035.
  • [3]
    Jaruratanasirikul, S., Kalnauwakul, S., Lekhakula, A. (1987) Traumatic wound infection due to Bacillus cereus in an immunocompromised patient: a case report. Southeast Asian J. Trop. Med. Public Health 18, 112114.
  • [4]
    van der Zwet, W.C., Parlevliet, G.A., Savelkoul, P.H., Stoof, J., Kaiser, A.M., van Furth, A.M., Vandenbroucke-Grauls, C.M. (2000) Outbreak of Bacillus cereus infections in a neonatal intensive care unit traced to balloons used in manual ventilation. J. Clin. Microbiol. 38, 41314136.
  • [5]
    Ueda, K., Konishi, M., Maeda, K., Hamada, K., Sakamoto, M., Yoshimoto, E., Majima, T., Mikasa, K., Kita, E., Sano, R., Masutani, T., Narita, N. (1998) Bacillus cereus septicemia in a patient with severe aplastic anemia. Kansenshogaku Zasshi 72, 13251329.
  • [6]
    Carretto, E., Barbarini, D., Poletti, F., Marzani, F.C., Emmi, V., Marone, P. (2000) Bacillus cereus fatal bacteremia and apparent association with nosocomial transmission in an intensive care unit. Scand. J. Infect. Dis. 32, 98100.
  • [7]
    Hansen, B.M., Hendriksen, N.B. (2001) Detection of enterotoxic Bacillus cereus and Bacillus thuringiensis strains by PCR analysis. Appl. Environ. Microbiol. 67, 185189.
  • [8]
    Gaviria Rivera, A.M., Granum, P.E., Priest, F.G. (2000) Common occurrence of enterotoxin genes and enterotoxicity in Bacillus thuringiensis. FEMS Microbiol. Lett. 190, 151155.
  • [9]
    Stenfors, L.P., Mayr, R., Scherer, S., Granum, P.E. (2002) Pathogenic potential of fifty Bacillus weihenstephanensis strains. FEMS Microbiol. Lett. 215, 4751.
  • [10]
    Hsieh, Y.M., Sheu, S.J., Chen, Y.L., Tsen, H.Y. (1999) Enterotoxigenic profiles and polymerase chain reaction detection of Bacillus cereus group cells and B. cereus strains from foods and food-borne outbreaks. J. Appl. Microbiol. 87, 481490.
  • [11]
    Pruss, B.M., Dietrich, R., Nibler, B., Martlbauer, E., Scherer, S. (1999) The hemolytic enterotoxin HBL is broadly distributed among species of the Bacillus cereus group. Appl. Environ. Microbiol. 65, 54365442.
  • [12]
    Kaneko, T., Nozaki, R., Aizawa, K. (1978) Deoxyribonucleic acid relatedness between Bacillus anthracis, Bacillus cereus and Bacillus thuringiensis. Microbiol. Immunol. 22, 639641.
  • [13]
    Seki, T., Chung, C., Mikami, H., Oshima, Y. (1978) Deoxyribonucleic acid homology and taxonomy of the genus Bacillus. Int. J. Syst. Bacteriol. 28, 182189.
  • [14]
    Ash, C., Farrow, J.A., Dorsch, M., Stackebrandt, E., Collins, M.D. (1991) Comparative analysis of Bacillus anthracis, Bacillus cereus, and related species on the basis of reverse transcriptase sequencing of 16S rRNA. Int. J. Syst. Bacteriol. 41, 343346.
  • [15]
    Ash, C., Collins, M.D. (1992) Comparative analysis of 23S ribosomal RNA gene sequences of Bacillus anthracis and emetic Bacillus cereus determined by PCR-direct sequencing. FEMS Microbiol. Lett. 73, 7580.
  • [16]
    Harrell, L.J., Andersen, G.L., Wilson, K.H. (1995) Genetic variability of Bacillus anthracis and related species. J. Clin. Microbiol. 33, 18471850.
  • [17]
    Bourque, S.N., Valero, J.R., Lavoie, M.C., Levesque, R.C. (1995) Comparative analysis of the 16S to 23S ribosomal intergenic spacer sequences of Bacillus thuringiensis strains and subspecies and of closely related species. Appl. Environ. Microbiol. 61, 16231626.
  • [18]
    Carlson, C.R., Caugant, D., Kolstø, A. (1994) Genotypic diversity among Bacillus cereus and Bacillus thuringiensis strains. Appl. Environ. Microbiol. 60, 17191725.
  • [19]
    Helgason, E., Caugant, D.A., Lecadet, M.M., Chen, Y., Mahillon, J., Lovgren, A., Hegna, I., Kvaloy, K., Kolstø, A.B. (1998) Genetic diversity of Bacillus cereus/B. thuringiensis isolates from natural sources. Curr. Microbiol. 37, 8087.
  • [20]
    Helgason, E., Okstad, O.A., Caugant, D.A., Johansen, H.A., Fouet, A., Mock, M., Hegna, I. Kolstø (2000) Bacillus anthracis, Bacillus cereus, and Bacillus thuringiensis– one species on the basis of genetic evidence. Appl. Environ. Microbiol. 66, 26272630.
  • [21]
    Henderson, I., Duggleby, C.J., Turnbull, P.C. (1994) Differentiation of Bacillus anthracis from other Bacillus cereus group bacteria with the PCR. Int. J. Syst. Bacteriol. 44, 99105.
  • [22]
    Makino, S.I., Iinuma-Okada, Y., Maruyama, T., Ezaki, T., Sasakawa, C., Yoshikawa, M. (1993) Direct detection of Bacillus anthracis DNA in animals by polymerase chain reaction. J. Clin. Microbiol. 31, 547551.
  • [23]
    Reif, T.C., Johns, M., Pillai, S.D., Carl, M. (1994) Identification of capsule-forming Bacillus anthracis spores with the PCR and a novel dual-probe hybridization format. Appl. Environ. Microbiol. 60, 16221625.
  • [24]
    Beyer, W., Glockner, P., Otto, J., Bohm, R. (1995) A nested PCR method for the detection of Bacillus anthracis in environmental samples collected from former tannery sites. Microbiol. Res. 150, 179186.
  • [25]
    Patra, G., Sylvestre, P., Ramisse, V., Therasse, J., Guesdon, J.L. (1996) Isolation of a specific chromosomic DNA sequence of Bacillus anthracis and its possible use in diagnosis. FEMS Immunol. Med. Microbiol. 15, 223231.
  • [26]
    Brightwell, G., Pearce, M., Leslie, D. (1998) Development of internal controls for PCR detection of Bacillus anthracis. Mol. Cell. Probes 12, 367377.
  • [27]
    Patra, G., Vaissaire, J., Weber-Levy, M., Le Doujet, C., Mock, M. (1998) Molecular characterization of Bacillus strains involved in outbreaks of anthrax in France in 1997. J. Clin. Microbiol. 36, 34123414.
  • [28]
    Andersen, G.L., Simchock, J.M., Wilson, K.H. (1996) Identification of a region of genetic variability among Bacillus anthracis strains and related species. J. Bacteriol. 178, 377384.
  • [29]
    Jackson, P.J., Walthers, E.A., Kalif, A.S., Richmond, K.L., Adair, D.M., Hill, K.K., Kuske, C.R., Andersen, G.L., Wilson, K.H., Hugh-Jones, M., Keim, P. (1997) Characterization of the variable-number tandem repeats in vrrA from different Bacillus anthracis isolates. Appl. Environ. Microbiol. 63, 14001405.
  • [30]
    Yamada, S., Ohashi, E., Agata, N., Venkateswaran, K. (1999) Cloning and nucleotide sequence analysis of gyrB of Bacillus cereus, B. thuringiensis, B. mycoides, and B. anthracis and their application to the detection of B. cereus in rice. Appl. Environ. Microbiol. 65, 14831490.
  • [31]
    Daffonchio, D., Borin, S., Frova, G., Gallo, R., Mori, E., Fani, R., Sorlini, C. (1999) A randomly amplified polymorphic DNA marker specific for the Bacillus cereus group is diagnostic for Bacillus anthracis. Appl. Environ. Microbiol. 65, 12981303.
  • [32]
    Qi, Y., Patra, G., Liang, X., Williams, L.E., Rose, S., Redkar, R.J., DelVecchio, V.G. (2001) Utilization of the rpoB gene as a specific chromosomal marker for real-time PCR detection of Bacillus anthracis. Appl. Environ. Microbiol. 67, 37203727.
  • [33]
    Hurtle, W., Bode, E., Kulesh, D.A., Kaplan, R.S., Garrison, J., Bridge, D., House, M., Frye, M.S., Loveless, B., Norwood, D. (2004) Detection of the Bacillus anthracis gyrA gene by using a minor groove binder probe. J. Clin. Microbiol. 42, 179185.
  • [34]
    Logan, N.A., Carman, J.A., Melling, J., Berkeley, R.C. (1985) Identification of Bacillus anthracis by API tests. J. Med. Microbiol. 20, 7585.
  • [35]
    Bell, C.A., Uhl, J.R., Hadfield, T.L., David, J.C., Meyer, R.F., Smith, T.F. F.R. Cockerill 3rd (2002) Detection of Bacillus anthracis DNA by LightCycler PCR. J. Clin. Microbiol. 40, 28972902.
  • [36]
    Mikesell, P., Ivins, B.E., Ristroph, J.D., Dreier, T.M. (1983) Evidence for plasmid-mediated toxin production in Bacillus anthracis. Infect. Immun. 39, 371376.
  • [37]
    Green, B.D., Battisti, L., Koehler, T.M., Thorne, C.B., Ivins, B.E. (1985) Demonstration of a capsule plasmid in Bacillus anthracis. Infect. Immun. 49, 291297.
  • [38]
    Turnbull, P.C., Hutson, R.A., Ward, M.J., Jones, M.N., Quinn, C.P., Finnie, N.J., Duggleby, C.J., Kramer, J.M., Melling, J. (1992) Bacillus anthracis but not always anthrax. J. Appl. Bacteriol. 72, 2128.
  • [39]
    Turnbull, P.C. (1999) Definitive identification of Bacillus anthracis– a review. J. Appl. Microbiol. 87, 237240.
  • [40]
    Hoffmaster, A.R., Ravel, J., Rasko, D.A., Chapman, G.D., Chute, M.D., Marston, C.K., De, B.K., Sacchi, C.T., Fitzgerald, C., Mayer, L.W., Maiden, M.C., Priest, F.G., Barker, M., Jiang, L., Cer, R.Z., Rilstone, J., Peterson, S.N., Weyant, R.S., Galloway, D.R., Read, T.D., Popovic, T., Fraser, C.M. (2004) Identification of anthrax toxin genes in a Bacillus cereus associated with an illness resembling inhalation anthrax. Proc. Natl. Acad. Sci. USA 101, 84498454.
  • [41]
    Ruhfel, R.E., Robillard, N.J., Thorne, C.B. (1984) Interspecies transduction of plasmids among Bacillus anthracis, B. cereus, and B. thuringiensis. J. Bacteriol. 157, 708711.
  • [42]
    Green, B.D., Battisti, L., Thorne, C.B. (1989) Involvement of Tn4430 in transfer of Bacillus anthracis plasmids mediated by Bacillus thuringiensis plasmid pXO12. J. Bacteriol. 171, 104113.
  • [43]
    Pannucci, J., Okinaka, R.T., Sabin, R., Kuske, C.R. (2002) Bacillus anthracis pXO1 plasmid sequence conservation among closely related bacterial species. J. Bacteriol. 184, 134141.
  • [44]
    Vodkin, M.H., Leppla, S.H. (1983) Cloning of the protective antigen gene of Bacillus anthracis. Cell 34, 693697.
  • [45]
    Ivins, B.E., Welkos, S.L. (1986) Cloning and expression of the Bacillus anthracis protective antigen gene in Bacillus subtilis. Infect. Immun. 54, 537542.
  • [46]
    Robertson, D.L., Leppla, S.H. (1986) Molecular cloning and expression in Escherichia coli of the lethal factor gene of Bacillus anthracis. Gene 44, 7178.
  • [47]
    Mock, M., Labruyere, E., Glaser, P., Danchin, A., Ullmann, A. (1988) Cloning and expression of the calmodulin-sensitive Bacillus anthracis adenylate cyclase in Escherichia coli. Gene 64, 277284.
  • [48]
    Tippetts, M.T., Robertson, D.L. (1988) Molecular cloning and expression of the Bacillus anthracis edema factor toxin gene: a calmodulin-dependent adenylate cyclase. J. Bacteriol. 170, 22632266.
  • [49]
    Cataldi, A., Labruyere, E., Mock, M. (1990) Construction and characterization of a protective antigen-deficient Bacillus anthracis strain. Mol. Microbiol. 4, 11111117.
  • [50]
    Tedikov, V.M., Dobritsa, A.P. Cloning and expression of determinants of Bacillus anthracis protective antigen in Escherichia coli, Bacillus subtilis, and Bacillus anthracis cells Mol. Gen. Mikrobiol. Virusol. 1993 13 16
  • [51]
    Ramisse, V., Patra, G., Garrigue, H., Guesdon, J.L., Mock, M. (1996) Identification and characterization of Bacillus anthracis by multiplex PCR analysis of sequences on plasmids pXO1 and pXO2 and chromosomal DNA. FEMS Microbiol. Lett. 145, 916.
  • [52]
    Sambrook, J., Russell, D.W. (2001) Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
  • [53]
    Jolley, K.A., Feil, E.J., Chan, M.S., Maiden, M.C. (2001) Sequence type analysis and recombinational tests START. Bioinformatics 17, 12301231.
  • [54]
    Radnedge, L., Agron, P.G., Hill, K.K., Jackson, P.J., Ticknor, L.O., Keim, P., Andersen, G.L. (2003) Genome differences that distinguish Bacillus anthracis from Bacillus cereus and Bacillus thuringiensis. Appl. Environ. Microbiol. 69, 27552764.
  • [55]
    Hill, K.K., Ticknor, L.O., Okinaka, R.T., Asay, M., Blair, H., Bliss, K.A., Laker, M., Pardington, P.E., Richardson, A.P., Tonks, M., Beecher, D.J., Kemp, J.D., Kolstø, A.B., Wong, A.C., Keim, P., Jackson, P.J. (2004) Fluorescent amplified fragment length polymorphism analysis of Bacillus anthracis, Bacillus cereus, and Bacillus thuringiensis isolates. Appl. Environ. Microbiol. 70, 10681080.
  • [56]
    Welkos, S.L. (1991) Plasmid-associated virulence factors of non-toxigenic pX01Bacillus anthracis. Microb. Pathog. 10, 183198.
  • [57]
    Uchida, I., Sekizaki, T., Hashimoto, K., Terakado, N. (1985) Association of the encapsulation of Bacillus anthracis with a 60 megadalton plasmid. J. Gen. Microbiol. 131 (Pt 2), 363367.
  • [58]
    Kaspar, R.L., Robertson, D.L. (1987) Purification and physical analysis of Bacillus anthracis plasmids pXO1 and pXO2. Biochem. Biophys. Res. Commun. 149, 362368.
  • [59]
    Higuchi, R., Fockler, C., Dollinger, G., Watson, R. (1993) Kinetic PCR analysis: real-time monitoring of DNA amplification reactions. Biotechnology (NY) 11, 10261030.
  • [60]
    Uhl, J.R., Bell, C.A., Sloan, L.M., Espy, M.J., Smith, T.F., Rosenblatt, J.E. F.R. Cockerill 3rd (2002) Application of rapid-cycle real-time polymerase chain reaction for the detection of microbial pathogens: the Mayo-Roche rapid anthrax test. Mayo Clin. Proc. 77, 673680.
  • [61]
    Makino, S.I., Cheun, H.I., Watarai, M., Uchida, I., Takeshi, K. (2001) Detection of anthrax spores from the air by real-time PCR. Lett. Appl. Microbiol. 33, 237240.
  • [62]
    Patra, G., Williams, L.E., Qi, Y., Rose, S., Redkar, R., Delvecchio, V.G. (2002) Rapid genotyping of Bacillus anthracis strains by real-time polymerase chain reaction. Ann. NY Acad. Sci. 969, 106111.
  • [63]
    Drago, L., Lombardi, A., Vecchi, E.D., Gismondo, M.R. Real-time PCR assay for rapid detection of Bacillus anthracis spores in clinical samples J. Clin. Microbiol. 40 2002 4399
  • [64]
    Levine, S.M., Perez-Perez, G., Olivares, A., Yee, H., Hanna, B.A., Blaser, M.J. (2002) PCR-based detection of Bacillus anthracis in formalin-fixed tissue from a patient receiving ciprofloxacin. J. Clin. Microbiol. 40, 43604362.
  • [65]
    Ryu, C., Lee, K., Yoo, C., Seong, W.K., Oh, H.B. (2003) Sensitive and rapid quantitative detection of anthrax spores isolated from soil samples by real-time PCR. Microbiol. Immunol. 47, 693699.