SEARCH

SEARCH BY CITATION

Keywords:

  • Vibrio vulnificus;
  • Ferrioxamine B;
  • Transcriptional activator;
  • desR

Abstract

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results and discussion
  6. Acknowledgments
  7. References

We previously reported that the 78-kDa outer membrane receptor for ferrioxamine B is induced in iron-starved Vibrio vulnificus cells when desferrioxamine B was supplied exogenously. Based on its N-terminal amino acid sequence, a candidate gene for the ferrichrome B receptor was detected in the V. vulnificus CMCP6 genomic database. Here, two contiguous genes, named desR and desA, encoding a member of the AraC family of transcriptional activators and the ferrioxamine B receptor, respectively, were cloned from V. vulnificus M2799 and characterized. Primer extension analysis mapped the iron-regulated transcription initiation sites for desR and desA, and demonstrated involvement of desferrioxamine B in the induction of desA transcription. Insertion mutation of desR resulted in no production of DesA under iron-limiting conditions even in the presence of desferrioxamine B. The DesA production under the same conditions was restored to wild-type levels when the desR mutant was complemented with desR in trans. These results suggest that the desR gene is required for desferrioxamine B-inducible production of DesA in iron-starved cells.


1Introduction

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results and discussion
  6. Acknowledgments
  7. References

Iron is essential for bacterial growth, but its bioavailability in the natural environment is severely limited by its extreme insolubility at normal biological pH due to the aerobic oxidation of Fe2+ to Fe3+. To satisfy their needs for iron, most bacteria have evolved manifold strategies for acquiring iron. A common mechanism for bacteria living in an aerobic environment is the synthesis and secretion of iron-chelating compounds called siderophores which scavenge iron outside the cell to import back into the cell as ferric siderophore complexes [1,2]. In gram-negative bacteria, the ferric siderophore complex is recognized in highly specific ways by an outer membrane protein that internalize the complex in concert with a TonB system and an ABC transporter [3]. Moreover, almost all genes involved in siderophore biosynthesis and transport are negatively regulated by a repressor protein Fur (ferric uptake regulation) with iron as a corepressor, with increased expression occurring under iron-limiting conditions [4]. On the other hand, it has been shown that some bacteria are capable of utilizing heterologous (exogenous) siderophores which are produced by other micro-organisms and that most of these systems are induced by the respective heterologous siderophores present in the medium [1].

Vibrio vulnificus is a gram-negative bacterium that can produce endotoxic shock following the consumption of raw sea-food and is considered one of the most invasive and rapidly fatal human pathogens known [5]. The outer membrane receptors for a cognate catecholate siderophore, vulnibactin [6], and for heme [7] have been characterized at the gene level. Recently, we have demonstrated that the production of the 78-kDa outer membrane receptor for ferrioxamine B is enhanced in response to the presence of desferrioxamine B [8]. This implied the involvement of a siderophore-inducible transcriptional regulatory mechanism. In this paper, we identified the relevant genes, named desR and desA, encoding a member of the AraC family of transcriptional regulators and the 78-kDa outer membrane receptor for ferrioxamine B, respectively. The role of the desR gene in desferrioxamine B-inducible desA expression was confirmed by construction of a desR mutant, coupled with genetic complementation experiments.

2Materials and methods

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results and discussion
  6. Acknowledgments
  7. References

2.1Bacterial strains and growth conditions

Vibrio vulnificus M2799 [8] was used throughout this study. Bacterial strains were grown at 37°C in Luria-Bertani (LB) medium containing 0.5% (for Escherichia coli) or 3% (for V. vulnificus) NaCl. LB media with and without the iron chelator 2,2′-dipyridyl at 100 μM were used for growth under iron-limiting and iron-replete conditions, respectively. When required, desferrioxamine B mesylate (Desferal) (Sigma) was added to the medium at 100 or 10 μM. Antibiotics were added to media at the following concentrations: ampicillin, 100 μg/ml; chloramphenicol, 5 μg/ml; tetracycline, 15 μg/ml. Cloning and plasmid preparation were carried out in E. coli DH5α. E. coli H1717 used in the Fur titration assay (FURTA) [9] was kindly supplied by the late Dr. I. Stojiljkovic.

2.2Cloning of the desR and desA genes from V. vulnificus M2799

A digoxigenin (DIG)-labeled hybridization probe was prepared by PCR with the V. vulnificus M2799 genomic DNA as a template and the following PCR primers: 5′-CCCAACTTGAAACCATTACG-3′ (nucleotide positions 1857–1876) and 5′-GGTGATAAGTGTTCTCTTGG-3′ (2701–2720). These primers were designed based on a candidate gene detected by the N-terminal amino acid sequence of the 78-kDa ferrioxamine B receptor [8] as described below. PCR was carried out under the conditions recommended in the PCR DIG probe synthesis kit (Roche Diagnostics). To clone the desR and desA genes, V. vulnificus M2799 genomic DNA was digested with Eco RI and ca. 5-kb DNA fragment was ligated into a low-copy-number plasmid pMW118 (Nippon Gene, Osaka, Japan). Colonies on LB agar plates were screened by colony blot hybridization with the DIG-labeled probe, as described previously [10]. A positive recombinant plasmid containing an insert of a desired size was named pDES1 (see Fig. 1).

image

Figure 1. Restriction map and open reading frames in plasmid pDES1 and the relevant plasmids constructed. Open arrows indicate direction of transcription of the listed genes. F and T in circles indicate positions of putative Fur boxes and terminator signals, respectively. The protein products of orf1 and orf4 correspond to VV21339 and VV21336, respectively, in V. vulnificus CMCP6 [13].

Download figure to PowerPoint

For nucleotide sequencing, appropriate pUC19 subclones were constructed from pDES1. Nucleotide sequences were determined with a Hitachi DNA sequencer (SQ5500E) and the Thermo Sequenase premixed sequencing kit (Amersham Pharmacia Biotech) by primer walking. Sequence analysis was conducted with the Genetyx-Mac, version 9.0, software package (GENETYX Software Development Co., Tokyo, Japan). The BLASTP program [11] of the Institute of Chemical Research, Kyoto University, was used to determine homologies of the deduced amino acid sequences to other proteins. The nucleotide sequence data have been deposited in DDBJ, EMBL, and GenBank databases under Accession No. AB208775.

2.3Primer extension

Total RNA samples were prepared from strain M2799 cells grown under various conditions using an RNeasy protect bacteria kit (Qiagen) according to the manufacturer's instruction, and the RNA concentration was determined spectrophotometrically. Primer extension was carried out, as described elsewhere [10], with the primers, 5′-GCTGATGCGATTGAATGTCG-3′ (685–704) complementary to desR, and 5′-CGTAATGGTTTCAAGTTGGG-3′ (1857–1876) complementary to desA, both of which were, prior to use, 5′ labeled with a 5′-oligonucleotide Texas red labeling kit (Amersham Biosciences).

2.4Construction of a desR mutant derived from V. vulnificus

The desR gene in strain M2799 was inactivated by insertion mutation with a single crossover event of homologous recombination [10]. In brief, plasmid pDES2 was constructed by ligating the PCR product internal to desR, after cleavage with Xba I and Eco RI, into the suicide vector pKTN701 cleaved by the same enzymes (Fig. 1). PCR was carried out with pDES1 as a template and the primer pair 5′-CTGTCTCTAGAAGAAATTGCGG-3′ (744–765) and 5′-ATCGGAATTCAAACTGGGCAG-3′ (1335–1355) (the nucleotides changed for generation of the restriction enzyme sites are underlined) under the following conditions: KOD-plus DNA polymerase (Toyobo, Osaka, Japan) was used, and after initial denaturation of 94°C for 2 min, a cycle of 94°C for 15 s, 55°C for 30 s, and 68°C for 1 min was repeated 30 times. pDES2 thus constructed was transferred into E. coli SM10 λpir as a conjugal donor, which was then conjugated with strain M2799 by membrane-filter mating. Some of the chloramphenicol-resistant colonies were isolated, and proper recombination with respect to the corresponding genes was confirmed by comparative PCR for the chromosomal DNAs from the disruptant and the wild-type strains (data not shown). The desR mutant thus constructed was named VVDF1.

2.5Construction of pDES3

pDES3 was constructed for complementation experiments by ligating a PCR product containing the full desR gene into a broad-host-range vector pRK415 [12] (Fig. 1). PCR was carried out using pDES1 as a template under the conditions described above. The following primers were used for PCR: 5′-CCGGAATTCAGAAAACTGAGATAGATAGG-3′ (201–220) and 5′-CTAGTCTAGAACTTGGTGATATACATGAGC-3′ (1591–1610) (nucleotide linkers added to introduce appropriate restriction enzyme sites are underlined). The Eco RI–Xba I-digested fragment of the PCR product was then inserted into pRK415 cleaved with the same restriction enzymes.

2.6Preparation of iron-repressible outer membrane proteins and SDS–PAGE

Wild-type M2799, its desR mutant, VVDF1, and VVDF1 bearing pDES3 or pRK415 were grown for 12 h under iron-limiting conditions with or without desferrioxamine B (100 μM). The outer membrane protein fractions were prepared from cells thus obtained and SDS–PAGE was carried out as described previously [8].

3Results and discussion

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results and discussion
  6. Acknowledgments
  7. References

3.1Identification of a gene encoding 78-kDa ferrioxamine B receptor protein

Screening of the N-terminal amino acid sequence, EQSSIENAQL, determined for the 78-kDa ferrioxamine B receptor [8], by BLASTP [11] detected the V. vulnificus CMCP6 chromosome II protein (VV21337, Accession No. AE016812) [13] with 100% amino acid sequence identity. Additionally, inspection of the surrounding region of the ferrioxamine B receptor gene (named desA) revealed an AraC-like regulator gene directly upstream of the desA gene. This was well correlated with the previous finding [8] that the ferrioxamine B receptor was induced under iron-limiting conditions in response to the presence of desferrioxamine B in the growth medium, since most of the characterized AraC family members become active upon binding a cognate effector molecule [14]. Thus, this gene was named desR.

3.2Sequence analyses of the desR and desA genes and homology searches of their deduced amino acid sequences

A restriction map and two open reading frames identified in the 5-kb insert of pDES1, as well as the relevant plasmids constructed are shown in Fig. 1. pDES1 exhibited a FURTA-positive phenotype when introduced into E. coli H1717, suggesting that the DNA insert in pDES1 might have the in vivo Fur binding function [9]. The subclones, pDES11 and pDES12, derived from pDES1 also conferred a positive phenotype on E. coli H1717 in the FURTA, suggesting that a functional Fur box sequence is present in the respective promoter regions of the desR and desA genes. The entire nucleotide sequence of the insert was determined with overlapping subclones derived from pDES1. The base composition of this region (G + C content = 48.9 mol%) was typical for V. vulnificus. Partial nucleotide sequences with deduced amino acid sequences including the promoter regions of desR and the intergenic region between desR and desA are shown in Fig. 2. The standard initiation codon AUG was not found at the predicted initiation site in the desR gene. Instead, four in-frame rare initiation codons [15], two GUG centered at base positions 652 and 709 and two less potential UUG centered at 640 and 712, were found, none of which, however, was preceded by sequences resembling ribosome binding sites (Fig. 2), an observation that is not unusual for the regulatory genes [16]. The putative Fur box at 15 of 19 bases to the consensus sequence [17] that overlaps with the −10 promoter element was identified in front of desR (Fig. 2). Homology searches revealed that the N-terminal region of DesR (translated from a GUG codon centered at base position 652) shows the greatest similarity (37% identity in a 113-amino acid overlap) to that of E. coli Rob that regulates genes involved in resistance to antibiotics, organic solvents and heavy metals [18]. Rob is classified into a discrete subset of the AraC family regulators [14,18], since it differs from most AraC members in that it has the conserved two helix-turn-helix (HTH) DNA binding motifs at the N-terminal portion of the protein [14]. Interestingly, the N-terminal ?100-amino acid segment of DesR also shares amino acid sequence similarity with the C-terminal ends of known AraC-type siderophore system gene regulators: with 31%, 30%, 25%, and 22% amino acid identity to Bordetella BfeR [19], Pseudomonas aeruginosa PchR [20], Bordetella AlcR [21] and Yersinia pestis YbtA [22], respectively. This indicates that the characteristic HTH motifs are conserved in these proteins, although the level of identity is rather varied. The C-terminal segment of E. coli Rob has been suggested to specifically bind an effector molecule or recognize a signal that regulates the transcriptional activity of the protein [23]. Like Rob, DesR may be activated by interacting with ferrioxamine B through its C-terminal region that seems to confer specificity. Furthermore, it has been reported that the 20-bp consensus marbox sequence of class II (AYnGCACnnWnnRYYA AAYn) is characteristically present 18–19 bp upstream of the −10 element in the promoter regions of the genes regulated by Rob as well as MarA and SoxS to function as their binding sites [18]. A similar sequence (GTTGCACCAAATTGTTAACT, 1631–1650; the conserved nucleotides are underlined) was detected in the promoter region of the desA gene (Fig. 2). However, it remains to be determined whether the predicted sequence is functional as a binding site of DesR.

image

Figure 2. Partial nucleotide sequences with the predicted amino acid sequences of V. vulnificus desR (a) and desA (b) genes, including the detail of the promoters of desR and desA. The Fur box sequences are boxed. The predicted initiation codons for desR are double underlined in the panel A, and the most probable initiation codon for desR is indicated by a right-angled arrow. The amino acid sequence deduced from desA which is compatible with the N-terminal sequence determined for the DesA protein is indicated by a wavy underline. The terminator signals are indicated by converging arrows. The promoters (−35, −10), the putative ribosome binding site (RBS), the transcription start sites (▾), and termination codons (∗). The nucleotide sequence homologous to known marboxes [18] is put in square brackets. The nucleotide numbers correspond to nucleotide sequence positions in the GenBank/EMBL/DDBJ Accession No. AB208775.

Download figure to PowerPoint

On the other hand, the AUG initiation codon of the desA gene is preceded by a putative ribosome binding site as well as a putative Fur box that is identical at 13 of 19 bases to the consensus sequence [17]. The amino acid sequence deduced from desA exhibits 31% identity and 49% similarity with that of the Yersinia enterocolitica FoxA, characterized as the ferrioxamine B receptor [24]. The N-terminal sequence of the mature DesA protein was consistent with the signal peptide cleavage site predicted by SignalP program [25], and the molecular mass of this protein (77,420 Da) agreed well with the size determined for the ferrioxamine B receptor by SDS–PAGE (78 kDa). Moreover, the potential transcriptional terminator signals for desR and desA were found just downstream of the respective termination codons. Both of DesR and DesA share greater than 98% amino acid sequence identity with the corresponding proteins in the V. vulnificus CMCP6 genome sequence [13].

3.3Regulation of desR and desA gene expression

The putative Fur box sequences detected upstream of the desR and desA coding regions suggested that expression of these genes was likely iron regulated. In agreement with this suggestion, primer extension analysis of total RNA samples from strain M2799 identified the extension products corresponding to the bases within the putative Fur box sequences for desR and desA, although the expression of desA required the presence of desferrioxamine B as an effector molecule in addition to iron limitation (Fig. 3).

image

Figure 3. Primer extension analysis of total RNA from V. vulnificus M2799. Total RNA samples were prepared from cells grown to an OD660 of 0.5 under iron-replete conditions (+Fe), iron-limiting conditions (–Fe) and iron-limiting conditions in the presence of desferrioxamine B (100 μM) [–Fe (DFO)]. Extension products obtained from desR (a) and desA (b) messages were loaded on a sequencing gel alongside the DNA sequence ladder (T, G, C, A) of each control region synthesized with the same Texas red-labeled primer. The transcription start sites identified are shown with arrowheads.

Download figure to PowerPoint

3.4Phenotypic analysis of the desR mutant

To further confirm that desR is associated with induction of DesA, a desR mutant, VVDF1, was constructed from strain M2799 by insertion mutation and its changes in desA expression were assessed by SDS–PAGE of DesA (Fig. 4). VVDF1 showed a total loss of desA expression even in the presence of desferrioxamine B under iron-limiting conditions. However, genetic complementation of VVDF1 by using the desR+ plasmid pDES3 restored desferrioxamine B-responsive production of DesA. As a control, VVDF1 containing the mock plasmid was used, which showed an outer membrane protein profile similar to VVDF1. Consistent with the above-mentioned results, VVDF1 displayed a 80% reduction in growth of the wild-type strain, when they were grown under iron-limiting conditions in the presence of 10 μM desferrioxame B, and VVDF1 complemented with the desR+ plasmid pDES3 revealed growth similar to that of wild-type strain.

image

Figure 4. SDS–PAGE of iron-repressible outer membrane proteins from the wild-type M2799 (a), its desR mutant (VVDF1) (b) and the mutant complemented in trans with the wild-type desR gene in pDES3 or with an empty plasmid pRK415 (c). Growth conditions and procedures for outer membrane preparation and SDS–PAGE are described in Section 2. Minus and plus symbols in the top of the lanes represent the absence and presence of desferrioxamine B (DFO), respectively, in the growth medium. All lanes received 20 μg of protein and only the relevant portion of the gels is shown. The positions of molecular mass standards are indicated on the lane M. The HupA and VuuA proteins in V. vulnificus M2799 have been identified as the heme receptor and ferric vulnibactin receptor, respectively, based on their N-terminal amino acid sequences by Aso et al. [8], and the IutA protein as ferric aerobactin receptor (Aso et al., GenBank Accession No. AB074151).

Download figure to PowerPoint

3.5Identification of the ABC transporter genes for ferrioxamine B

We have recently cloned from V. vulnificus M2799 a Fur-regulated operon consisting of three genes named vatC, -D, and -B which encode an ATP-binding protein, a periplasmic binding protein, and an inner membrane permesase, respectively, components of the ABC transport system for ferric aerobactin (Aso et al., GenBank Accession No. AB074151). The polar vatD disruptant unable to utilize aerobactin for growth under iron-limiting conditions also failed to grow in the presence of desferrioxamine B (10 μM) (data not shown). In contrast, the wild-type strain grew well at the same conditions [8], suggesting that this system also serves for inner membrane transport of ferrioxamine B into cell cytosol. In the V. vulnificus CMCP6 genome sequence [13], the vat operon is also present in the chromosome II, but ca. 380 kb distant from desRA.

In conclusion, we identified the desA ferrioxamine B receptor gene in V. vulnificus, and then found a gene, named desR, directly upstream of desA, which encodes a protein homologous to the AraC family transcriptional regulators. However, DesR has the conserved two HTH motifs at the N-terminal region of the protein, different from the known and characterized AraC-type siderophore system gene regulators [19–22]. The data presented here suggest that inducible production of the DesA ferrioxamine B receptor may require both of DesR and the exogenous desferrioxamine B siderophore together with iron starvation. Future studies, including the purification of the DesR protein, will examine DNA binding and transcriptional regulation by this protein in combination with the effector molecule.

Acknowledgments

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results and discussion
  6. Acknowledgments
  7. References

This work was supported in part by a Grant-in-Aid for Scientific Research (C) from the Ministry of Education, Culture, Sports, Science and Technology, and a Health and Labour Sciences, Research Grant on Emerging and Re-emerging Infectious Diseases, Japan.

References

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results and discussion
  6. Acknowledgments
  7. References
  • [1]
    Wooldrige, K.G., Williams, P.H. (1993) Iron uptake mechanisms of pathogenic bacteria. FEMS Microbiol. Rev. 12, 325348.
  • [2]
    Winkelmann, G. (1991) Specificity of iron transport in bacteria and fungi. In: Handbook of Microbial Iron Chelates (Winkelmann, G., Ed.), pp.65–106 CRC Press, Boca Raton, FL.
  • [3]
    Braun, V., Hantke, K., Köster, W. (1998) Bacerial iron transport: mechanisms, genetics, and regulation. Met. Ions Biol. Syst. 35, 67145.
  • [4]
    Bagg, A., Neilands, J.B. (1987) Molecular mechanism of regulation of siderophore-mediated iron assimilation. Microbiol. Rev. 51, 509518.
  • [5]
    Linkou, D.A., Oliver, D.J. (1999) Pathogenesis of Vibrio vulnificus. FEMS Microbiol. Lett. 174, 207214.
  • [6]
    Webster, A.C.D., Litwin, C.M. (2000) Cloning and characterization of vuuA, a gene encoding the Vibrio vulnificus ferric vulnibactin receptor. Infect. Immun. 68, 526534.
  • [7]
    Litwin, C.M., Byrne, B.L. (1998) Cloning and characterization of an outer membrane protein of Vibrio vulnificus required for heme utilization: regulation of expression and determination of the gene sequence. Infect. Immun. 66, 31343141.
  • [8]
    Aso, H., Miyoshi, S., Nakao, H., Okamoto, K., Yamamoto, S. (2002) Induction of an outer membrane protein of 78 kDa in Vibrio vulnificus cultured in the presence of desferrioxamine B under iron-limiting conditions. FEMS Microbiol. Lett. 212, 6570.
  • [9]
    Stojiljkovic, I., Bäumler, A.J., Hantke, K. (1994) Fur regulon in gram-negative bacteria. Identification and characterization of new iron-regulated Escherichia coli genes by a Fur titration assay. J. Mol. Biol. 236, 531545.
  • [10]
    Funahashi, T., Moriya, K., Uemura, S., Miyoshi, S., Shinoda, S., Narimatsu, S., Yamamoto, S. (2002) Identification and characterization of pvuA, a gene encoding the ferric vibrioferrin receptor protein in Vibrio parahaemolyticus. J. Bacteriol. 184, 936946.
  • [11]
    Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Miller, W., Lipman, D.L. (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25, 33893402.
  • [12]
    Keen, N.T., Tamaki, S., Kobayashi, D., Trollinger, D. (1988) Improved broad-host-range plasmids for DNA cloning in gram-negative bacteria. Gene 70, 191197.
  • [13]
    Kim, Y.R., Lee, S.E., Kim, C.M., Kim, S.Y., Shin, E.K., Shin, D.H., Chung, S.S., Choy, H.E., Progulske-Fox, A., Hilman, J.D., Handfield, M., Rhee, J.H. (2003) Characterization and pathogenic significance of Vibrio vulnificus antigen preferentially expressed in septicemic patients. Infect. Immun. 71, 54615471.
  • [14]
    Gallegos, M.-T., Schleif, R., Bairoch, A., Hofmnn, K., Ramos, J. (1997) AraC/XylS family of transcriptional regulators. Microbiol. Mol. Biol. Rev. 61, 393410.
  • [15]
    Romero, A., García, P. (1991) Initiation of translation at AUC, AUA and AUU codons in Escherichia coli. FEMS Microbiol. Lett. 84, 325330.
  • [16]
    Van Hove, B., Staudenmaier, H., Braun, V. (1990) Novel two-component transmembrane transcription control: regulation of iron dicitrate transport in Escherichia coli K-12. J. Bacteriol. 172, 67496758.
  • [17]
    Braun, V., Hantke, K. (1991) Genetics of bacterial iron transport. In: Handbook of Microbial Iron Chelates (Winkelmann, G., Ed.), pp.107–138 CRC Press, Boca Raton, FL.
  • [18]
    Martin, R.G., Gillette, W.K., Rhee, S., Rosner, J.L. (1999) Structural requirements for marbox function in transcriptional activation of mar/sox/rob regulon promoters in Escherichia coli: sequence, orientation and spatial relationship to the core promoter. Mol. Microbiol. 34, 431441.
  • [19]
    Anderson, M.T., Armstrong, S.K. (2004) The BfeR regulator mediates enterobactin-inducible expression of Bordetella enterobactin utilization genes. J. Bacteriol. 186, 73027311.
  • [20]
    Heinrichs, D.E., Poole, K. (1993) Cloning and sequence analysis of a gene (pchR) encoding an AraC family activator of pyochelin and ferripyochelin receptor synthsis in Pseudomonas aeruginosa. J. Bacteriol. 175, 58825889.
  • [21]
    Beaumont, F.C., Kang, H.Y., Brickman, T.J., Armstrong, S.K. (1998) Identification and characterization of alcR, a gene encoding an AraC-like regulator of alcaligin siderophore biosynthesis and transport in Bordetella pertussis and Bordetella bronchiseptica. J. Bacteriol. 180, 862870.
  • [22]
    Fetherston, J.D., Bearden, S.W., Perry, R.D. (1996) YbtA, an AraC-type regulator of the Yersinia pestis pesticin/yersiniabactin receptor. Mol. Microbiol. 22, 315325.
  • [23]
    Kwon, H.J., Bennik, M.H.J., Demple, B., Ellenberger, T. (2000) Crystal structure of the Escherichia coli Rob transcription factor in complex with DNA. Nat. Struct. Biol. 7, 424430.
  • [24]
    Bäumler, A.J., Hantke, K. (1992) Ferrioxamine uptake in Yersinia enterocolitica: characterization of the receptor protein FoxA. Mol. Microbiol. 6, 13091321.
  • [25]
    Nielsen, H., Engelbrecht, S., Brunak, S., von Heijne, G. (1997) Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Protein Eng. 10, 16.