SEARCH

SEARCH BY CITATION

Keywords:

  • Tannerella forsythia;
  • Biofilms;
  • Contact-dependent regulation

Abstract

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results and discussion
  6. Acknowledgement
  7. References

Tannerella forsythia is one of the periodontal organisms implicated in the development of periodontal diseases. The surface associated and secreted protein, BspA (encoded by the bspA gene), of this bacterium is an important virulence factor. The present study was carried out to examine the regulation of the bspA gene during biofilm growth and contact stimuli encountered in interbacterial interactions. The expression levels of the bspA transcript were determined by real-time RT-PCR approach. The levels of bspA transcript were found to be significantly reduced as a result of contact stimulus and in biofilm cells relative to planktonic cells. The results of our study suggest that the likely downregulation of the BspA protein in biofilms and following contact may have implications in pathogenesis as a plausible mechanism of evasion of host immune responses.


1Introduction

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results and discussion
  6. Acknowledgement
  7. References

Tannerella forsythia (formerly Bacteroides forsythus) is one of the microbial pathogens recently implicated in the development of periodontal diseases [1–4]. Information on the pathogenicity of this organism, including its virulence factors and their regulation is generally lacking. We previously identified a cell-surface associated as well as a secreted protein, BspA, from this bacterium [5]. The BspA protein belongs to the leucine-rich repeat (LRR) protein family characterized by the presence of leucine-rich repeat motifs. Most proteins belonging to the LRR family are involved in receptor-ligand recognitions via protein–protein interactions [6]. Our studies have shown that the BspA protein is involved in binding to the extracellular matrix protein components fibronectin and fibrinogen [5], coaggregation with other bacteria [7,8] and induction of proinflammatory cytokines from monocytes [9] as well as a chemokine from osteoblasts [10]. The BspA protein is also the target of host immune responses, as patients with T. forsythia-associated periodontal disease mount a BspA-specific serum antibody response [5]. Recently, we have also shown that the T. forsythia-induced alveolar bone loss in mice requires expression of the BspA protein [11]. Therefore, the BspA protein may represent an important virulence factor of T. forsythia with multifunctional activities involved in bacterial pathogenesis. Since subgingival bacteria form biofilms during the development of periodontitis, regulation of virulence factors during biofilm formation is thought to be important in the etiology of these diseases. Therefore, we focused our studies on the regulation of the BspA virulence factor of T. forsythia in mono- and polymicrobial biofilms.

Environmental sensing by bacteria while attaching to surfaces, during interbacterial interactions and in biofilms is considered to be important for regulation of bacterial gene expression. In this regard, several surface-contact mediated signals that require specific cell surface receptors have been recently recognized in bacteria which modulate the expression of surface factors involved in cell-surface interactions [12–14]. In the above studies, surface-contact has been shown to alter the relative proportions of different outer membrane proteins. The present study was carried out to investigate the effect of contact stimulus encountered in interbacterial interactions and in biofilms of T. forsythia and Fusobacterium nucleatum, a fusiform bacterium of the oral cavity, on the expression of the bspA. F. nucleatum has been shown to coaggregate with many of the early and late colonizing bacteria of the oral cavity [15]. Moreover, as not all of the early colonizers coaggregate with the late colonizers, F. nucleatum is thought to act as a bridge between the early and late colonizing bacteria [15]. In addition, our recent studies have shown that coaggregation of F. nucleatum with T. forsythia is mediated via the BspA protein [8].

2Materials and methods

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results and discussion
  6. Acknowledgement
  7. References

2.1Bacterial strains and culture conditions

The following bacteria were used in the present study: F. nucleatum ATCC 10953 and T. forsythia ATCC 43037. Bacteria were grown anaerobically in brain heart infusion (Difco Laboratories, Detroit, MI, USA) broth containing 5 μg/ml hemin, 0.5 μg/ml menadione, 0.001%N-acetyl muramic acid and 5% fetal bovine serum (Life Technologies, Grand Island, NY, USA) as described previously [5].

2.2Biofilm formation and measurement

Biofilms were studied under static culture conditions on polystyrene surfaces. Briefly, bacterial cultures of T. forsythia and F. nucleatum were grown in half-strength growth medium to an absorbance of 0.05 at 600 nm. Cells were then dispensed (0.5 ml per well) in triplicate wells of 24-well culture plates (Becton Dickinson Labware, Franklin Lakes, NJ, USA) and incubated anaerobically. For mixed biofilms, each bacterial culture was adjusted to an absorbance of 0.05, dispensed into the wells and incubated as above. After a 2-day incubation, planktonic cells were aspirated and biofilms quantified by crystal violet staining [8]. Total biofilms were calculated by normalizing dye binding (absorbance at 595 nm) to total bacterial growth (biofilm cells + planktonic cells) determined from parallel identical wells by measuring the absorbance at 600 nm. The number of T. forsythia cells in biofilms were also estimated by a real-time PCR method. Briefly, the bacterial genomic DNA was isolated from biofilm or planktonic cells using the Puregene DNA isolation kit (Gentra systems, Minneapolis, MN, USA). The real-time PCR was performed using MyiQ single color real-Time PCR detection system (Bio-Rad, Hercules, CA, USA). The reaction mixture (25 μl) for real-time PCR assay contained 2× iQ Supermix (Bio-Rad), 20 pmol of each forward and reverse primers, 10 pmol of fluorescent and quencher labeled probe, and 2.5 μl of extracted DNA. Thermocycling program was 95°C for 3 min, followed by 40 cycles of 94°C for 30 s, 57°C for 30 s, and 72°C for 30 s. A standard curve was plotted using the Ct values for the amplification of DNA extracted from known cfu's of T. forsythia. Theoretical cell numbers in each sample were then extrapolated from the Ct values using the standard curve.

2.3Primers and probes

The sequences of primers and probes used in this study are listed in Table 1. For identification of T. forsythia, published information on the primers and probe sequences specific for T. forsythia 16S rRNA were utilized [16]. On the other hand, primers and probes specific for bspA were designed with the help of the Beacon Designer software (Biosoft International, Palo Alto, CA). Probes for 16S rRNA and bspA labeled with the reporter dye 6-carboxyfluorescein at the 5′ end and with the quencher dye 6-carboxytetramethylrodamine at the 3′ end were synthesized commercially (Integrated DNA Technologies, Coralville, IA, USA).

Table 1.  Oligonucleotide primers and probes
GeneOligonucleotide sequence (5′–3′)
T. forsythensis 16S rRNAFw: ATTGAAATGTAGACGACGGAGAGT
Rev: TTACCTGTTAGCAACTGACAGTCA 
Probe: AGAGCTTTCTTCCCTTCGGGGCGT 
  
T. forsythensis bsp AFw: CGAAGCGAAGGACGTATGGAA
Rev: GATTGGTGATGGTGAGGGTTTTG 
Probe: CGGCACGATGGAGAAACGCAACCT 

2.4Quantitative assay for expression of bspA transcript

Total RNA was extracted from bacterial cells using the RNeasy mini kit (QIAGEN, Valencia, CA, USA) as per the manufacture's instructions. Prior to reverse transcriptase (RT) reaction, RNA samples were treated with DNase I (DNA-free, Ambion, Austin, TX, USA) for 1 h at 37°C to remove any contaminating DNA. DNase I was inactivated by a commercially available inactivation solution (DNase inactivating reagent, Ambion). RT addition to generate cDNA was preformed on 1 μg of total RNA using iScript cDNA synthesis kit (BioRad Laboratories, Hercules, CA) in a reaction volume of 20 μl using the iCycler PCR system (BioRad) with a profile of 25°C for 5 min, 42°C for 30 min, and 85°C for 5 min. All samples were analyzed together, and negative controls were run simultaneously that did not contain either RNA (no template controls) or the reverse transcriptase enzyme (RT negative), to control for RNA and genomic DNA contamination, respectively. Following RT, samples were stored at −80°C until realtime PCR analysis. The real-time PCR was performed on cDNA samples with either the16S rRNA specific- or bspA specific primers and probes using IQ-Supermix PCR reagent (Bio-Rad) in the iCycler thermal cycler equipped with the MyIQ realtime PCR detection system as per the manufacturer's recommendations (BioRad Laboratories). Relative expression levels of bspA transcripts were then calculated by normalizing the levels of bspA specific RNA with the levels of 16S rRNA. By normalizing the Ct values for bspA to the total amount of 16S rRNA, all samples were compared and the relative fold change in the samples were calculated using −ΔΔCt method described in the MyIQ real-time PCR detection system (BioRad Laboratories).

2.5Cell–cell contact stimulation

T. forsythia coaggregates with F. nucleatum cells [8] and outer membrane vesicles of P. gingivalis (data not shown). To analyze the time-course of fold change in bspA gene expression following contact with F. nucleatum cells or P. gingivalis vesicles, T. forsythia (2 × 108 cells per ml) were incubated with F. nucleatum cells (2 × 108 cells per ml) or outer membrane vesicles of P. gingivalis at a concentration of 50 μg per ml anaerobically. After 1, 3 and 6 h coincubation with these species, bacterial cells were collected. The sample was flash-frozen in liquid nitrogen and stored at −80°C until RNA isolation for real-time PCR analyses for gene expression changes.

2.6Transwell experiment

These experiments were conducted to determine if any soluble factors of F. nucleatum are involved in the modulation of T. forsythia biofilm formation and bspA expression. The experiments were carried out such that the two species were physically separated by a 0.2 μm filter. Briefly, F. nucleatum or P. gingivalis was placed in the upper compartment and T. forsythia was in the lower compartment of a Transwell (0.2 μm, Becton Dickinson Labware). Thus, components secreted by bacterial species in the upper compartment can diffuse and influence biofilm formation of the bacteria placed in the polystyrene well. Each bacteria was seeded in 1/2 strength broth at OD600 nm of 0.05. Biofilms formed in the polystyrene wells were quantified as described above.

2.7Statistical analysis

Data were considered statistical significant when the Student's P-value was <0.05.

3Results and discussion

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results and discussion
  6. Acknowledgement
  7. References

3.1Analyses of the regulation of bspA in biofilms

We previously reported strong coaggregations between T. forsythia and F. nucleatum and showed that these two bacteria form synergistic biofilms in mixed cultures [8]. Further, the expression of BspA was found to be dispensable for biofilm formation since a mutant defective in BspA was found to have similar biofilm forming abilities as the wild type T. forsythia strain [8]. On the other hand, BspA is an important virulence determinant of T. forsythia[11]. In the present study we sought to examine the regulation of this important virulence factor during biofilm growth and during interbacterial interaction. Since coaggregation is one of the mechanisms by which interbacterial interactions and cell–cell communications are facilitated, we hypothesized that cell–cell interactions between F. nucleatum and T. forsythia during synergistic biofilm formation may play roles in the regulation of expression of bspA.

As shown in Fig. 1(a), T. forsythia and F. nucleatum formed synergistic biofilms in mixed cultures as compared to when each was inoculated alone. The levels of T. forsythia in mixed biofilms were 3–4-fold higher as compared to levels in T. forsythia monobiofilms (Fig. 1(b)). Moreover, this biofilm synergy required cell–cell contact since no significant increase in T. forsythia biofilm cells was observed when the two species were separated in Transwells (Fig. 1(b)) as compared to T. forsythia monobiofilms. The real-time RT-PCR was then utilized to compare the expression of bspA between biofilm and planktonic cells. The results of the realtime RT-PCR assay showed that there was approximately a 5-fold and a 2-fold reduction in the levels of bspA transcript in mixed T. forsythia and F. nucleatum and T. forsythia monobiofilms, respectively, as compared to levels of bspA transcript in planktonic cells (Fig. 2). Moreover, the reduction in the level of the bspA transcript was dependent on the robustness of the biofilm as there was a significant reduction in the level of bspA transcription in the mixed synergistic biofilms as compared to T. forsythia monobiofilms or T. forsythus biofilms formed in a contact-independent manner with F. nucleatum (Fig. 2).

image

Figure 1. (a) Total biofilms formed in polystyrene wells were quantified by crystal violet dye staining (OD595) normalized to total bacterial growth (OD600). (b) The cell number of T. forsythia in biofilm was estimated by real-time PCR. Tf alone: T. forsythia biofilm; Fn alone: F. nucleatum alone biofilm; Tf + Fn: T. forsythia and F. nucleatum mixed biofilm; Tf + (Fn): T. forsythia biofilm in the presence of F. nucleatum soluble component (Transwell). *: P < 0.01 when compared with Tf or Fn alone biofilm.

Download figure to PowerPoint

image

Figure 2. Comparison of bspA gene expression between in planktonic cells and biofilm cells determined by real-time RT-PCR. Tf biofilm: T. forsythia alone biofilm; Fn alone: F. nucleatum alone biofilm; Tf + Fn biofilm: T. forsythia and F. nucleatum mixed biofilm; Tf + (Fn) biofilm: T. forsythia biofilm in the presence of F. nucleatum soluble components (Transwell experiment). *, P < 0.01 compared to Tf planktonic; †, P < 0.01 compared to Tf + Fn biofilm.

Download figure to PowerPoint

3.2Analysis of bspA expression following contact-stimulus

Experiments were then carried out to determine if regulation of bspA gene expression in biofilms was the result of cell–cell interactions, contact encountered in biofilms or is the result of physiological state of bacteria during biofilm growth. The expression of bspA transcript was monitored over time by real-time RT-PCR following coincubation of the coaggregating partners T. forsythia and F. nucleatum. Under these conditions, there was a time dependent reduction in the levels of bspA transcript as compared to T. forsythia cells incubated alone. As early as 1 h following coincubation, there was a significant reduction in the bspA transcript levels and between 3 and 6 h the levels had reached 5–6-fold below that of the T. forsythia cells incubated alone (Fig. 3). The levels of bspA transcript did not change when T. forsythia was present alone, during which time it does not autoaggregate [8]. To confirm that this phenomenon is contact-dependent, we utilized P. gingivalis outer-membrane vesicles prepared according to a previously described procedure [8]. The P. gingivalis vesicles were found to be potent aggregators of T. forsythia (data not shown) and thus promote physical interactions encountered in bacterial coaggregations and in biofilms. In the presence of P. gingivalis vesicles as T. forsythia aggregating partners we also observed time dependent down regulation of bspA transcripts. The Transwell experiments ruled out the effect of any soluble factors from F. nucleatum that could interact with surface receptors on T. forsythia in the regulation of bspA (Fig. 4), The expression of bspA was monitored in transwells where T. forsythia cells were physically separated from F. nucleatum. Under these conditions there was no effect on the expression of levels of bspA (Fig. 4), confirming that contact is one of the important environmental stimuli responsible for the regulation of bspA.

image

Figure 3. Contact dependent downregulation of bspA following coaggregations of T. forsythia with F. nucleatum or P. gingivalis vesicles. The expression of bspA rapidly decreased during the first 3 h post-T. forsythia coaggregations with F. nucleatum or P. gingivalis vesicles (Pgv). The bspA expression in T. forsythia following no contact stimulation (T. forsythia alone) did not change at either time points. Data values represent average (±SE) of three independent experiments.

Download figure to PowerPoint

image

Figure 4. Regulation of expression of bspA transcript in response to F. nucleatum soluble factors. T. forsythia was either incubated alone (Tf) or in the presence of F. nucleatum in the upper compartment of the Transwell, Tf + (Fn). No significant difference in bspA expression was observed between T. forsythia alone and T. forsythia in the presence of soluble F. nucleatum factors.

Download figure to PowerPoint

Several bacteria regulate their virulence factor expression in a contact-dependent manner. For example, abiotic surface contact mediated gene expression changes in cell surface structures of Escherichia coli via the Cpx signaling pathways [12–14,17], global gene expression changes in Pseudomonas putida in response to surface sensing [18], and downregulation of capsule and pilli synthesis in Neisseria meningitides[19]. A recent study showed downregulation of Campylobacter jejuni flagellum genes following colonization [20]. In oral bacteria, such as P. gingivalis, protein expression is modulated following contact with host epithelial cells [21] and P. gingivalis fimA gene expression is downregulated following contact with Streptococcus cristatus[22]. In biofilms, expression of the fimA gene encoding the major fimbrial protein is downregulated as assessed by microarray analysis (Chen and Kuramitsu, unpublished results). Contact-dependent down-regulation of the bspA gene reported in this study which likely also results in downregulation of surface-expressed BspA protein may be a mechanism for evading host immune responses following attachment and biofilm growth. Two component regulatory networks are likely involved in this contact dependent regulation. This assumption is based on the involvement of Cpx based two-component regulatory networks reported above. The surface associated BspA protein may initially be required for bacterial attachment and coaggregation with other bacteria in the oral cavity but once the infection has been established it would be advantageous to downregulate the synthesis of the BspA protein, which is a target for recognition by the host immune response. Studies are in progress to determine the precise regulatory pathways that may be involved in the contact-dependent regulation of bspA.

References

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results and discussion
  6. Acknowledgement
  7. References
  • [1]
    Tran, S.D., Rudney, J.D., Sparks, B.S., Hodges, J.S. (2001) Persistent presence of Bacteroides forsythus as a risk factor for attachment loss in a population with low prevalence and severity of adult periodontitis. J. Periodontol. 72, 110.
  • [2]
    Tanner, A., Maiden, M.F., Macuch, P.J., Murray, L.L. R.L. Kent Jr. (1998) Microbiota of health, gingivitis, and initial periodontitis. J. Clin. Periodontol. 25, 8598.
  • [3]
    Grossi, S.G., Zambon, J.J., Ho, A.W., Koch, G., Dunford, R.G., Machtei, E.E., Norderyd, O.M., Genco, R.J. (1994) Assessment of risk for periodontal disease. I. Risk indicators for attachment loss. J. Periodontol. 65, 260267.
  • [4]
    Grossi, S.G., Genco, R.J., Machtei, E.E., Ho, A.W., Koch, G., Dunford, R., Zambon, J.J., Hausmann, E. (1995) Assessment of risk for periodontal disease. II. Risk indicators for alveolar bone loss. J. Periodontol. 66, 2329.
  • [5]
    Sharma, A., Sojar, H.T., Glurich, I., Honma, K., Kuramitsu, H.K., Genco, R.J. (1998) Cloning, expression, and sequencing of a cell surface antigen containing a leucine-rich repeat motif from Bacteroides forsythus ATCC 43037. Infect. Immun. 66, 57035710.
  • [6]
    Kobe, B., Deisenhofer, J. (1994) The leucine-rich repeat: a versatile binding motif. Trends Biochem. Sci. 19, 415421.
  • [7]
    Ikegami, A., Honma, K., Sharma, A., Kuramitsu, H.K. (2004) Multiple functions of the leucine-rich repeat protein LrrA of Treponema denticola. Infect. Immun. 72, 46194627.
  • [8]
    Sharma, A., Inagaki, S., Sigurdson, W., Kuramitsu, H.K. (2005) Synergy between Tannerella forsythia and Fusobacterium nucleatum in biofilm formation. Oral Microbiol. Immunol. 20, 3942.
  • [9]
    Hajishengallis, G., Martin, M., Sojar, H.T., Sharma, A., Schifferle, R.E., DeNardin, E., Russell, M.W., Genco, R.J. (2002) Dependence of bacterial protein adhesins on toll-like receptors for proinflammatory cytokine induction. Clin. Diagn. Lab. Immunol. 9, 403411.
  • [10]
    Ruddy, M.J., Shen, F., Smith, J.B., Sharma, A., Gaffen, S.L. (2004) Interleukin-17 regulates expression of the CXC chemokine LIX/CXCL5 in osteoblasts: implications for inflammation and neutrophil recruitment. J. Leukoc. Biol. 76, 135144.
  • [11]
    Sharma, A., Inagaki, S., Honma, K., Sfintescu, C., Baker, P.J., Evans, R.T. (2005) Tannerella forsythia (Bacteroides forsythus) Induced Alveolar Bone Loss in Mice Involves Leucine-Rich Repeat BspA Protein. J. Dent. Res. 84, 462467.
  • [12]
    Otto, K., Silhavy, T.J. (2002) Surface sensing and adhesion of Escherichia coli controlled by the Cpx-signaling pathway. Proc. Natl. Acad. Sci. USA 99, 22872292.
  • [13]
    Otto, K., Norbeck, J., Larsson, T., Karlsson, K.A., Hermansson, M. (2001) Adhesion of type 1-fimbriated Escherichia coli to abiotic surfaces leads to altered composition of outer membrane proteins. J. Bacteriol. 183, 24452453.
  • [14]
    Prigent-Combaret, C., Vidal, O., Dorel, C., Lejeune, P. (1999) Abiotic surface sensing and biofilm-dependent regulation of gene expression in Escherichia coli. J. Bacteriol. 181, 59936002.
  • [15]
    Kolenbrander, P.E., Andersen, R.N., Blehert, D.S., Egland, P.G., Foster, J.S., Palmer Jr., R.J.Communication among oral bacteria Microbiol. Mol. Biol. Rev. 66 2002 486 505 table of contents
  • [16]
    Shelburne, C.E., Prabhu, A., Gleason, R.M., Mullally, B.H., Coulter, W.A. (2000) Quantitation of Bacteroides forsythus in subgingival plaque comparison of immunoassay and quantitative polymerase chain reaction. J. Microbiol. Meth. 39, 97107.
  • [17]
    Winther-Larsen, H.C., Koomey, M. (2002) Transcriptional, chemosensory and cell-contact-dependent regulation of type IV pilus expression. Curr. Opin. Microbiol. 5, 173178.
  • [18]
    Sauer, K., Camper, A.K. (2001) Characterization of phenotypic changes in Pseudomonas putida in response to surface-associated growth. J. Bacteriol. 183, 65796589.
  • [19]
    Deghmane, A.E., Giorgini, D., Larribe, M., Alonso, J.M., Taha, M.K. (2002) Down-regulation of pili and capsule of Neisseria meningitidis upon contact with epithelial cells is mediated by CrgA regulatory protein. Mol. Microbiol. 43, 15551564.
  • [20]
    Stintzi, A., Marlow, D., Palyada, K., Naikare, H., Panciera, R., Whitworth, L., Clarke, C. (2005) Use of genome-wide expression profiling and mutagenesis to study the intestinal lifestyle of Campylobacter jejuni. Infect. Immun. 73, 17971810.
  • [21]
    Park, Y., Lamont, R.J. (1998) Contact-dependent protein secretion in Porphyromonas gingivalis. Infect. Immun. 66, 47774782.
  • [22]
    Xie, H., Cook, G.S., Costerton, J.W., Bruce, G., Rose, T.M., Lamont, R.J. (2000) Intergeneric communication in dental plaque biofilms. J. Bacteriol. 182, 70677069.