SEARCH

SEARCH BY CITATION

Keywords:

  • Candida albicans;
  • Candida glabrata;
  • CDR1, MDR1;
  • Mutation hotspots;
  • Azole antifungals

Abstract

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results
  6. 4Discussion
  7. Acknowledgements
  8. References

The aims of our research were to investigate the gene expression of the multidrug efflux transporter, CDR1 and the major drug facilitator superfamily transporter, MDR1 gene in azole drug-resistant Candida albicans and Candida glabrata clinical isolates recovered from vaginitis patients; and to identify hotspot mutations that may be present in the C. albicans CaCDR1 gene that could be associated with drug-resistance. The relative expression of the CDR1 and MDR1 transcripts in ketoconazole and clotrimazole-resistant isolates and drug-susceptible ATCC strains were determined by semi-quantitative reverse transcription-polymerase chain reaction. Expression of CaCDR1 transcript was upregulated to varying extents in all three azole-resistant C. albicans isolates studied (1.6-, 3.7- and 3.9-fold) and all three C. glabrata isolates tested (at 1.9-, 2.3- and 2.7-fold). The overexpression level of CaCDR1 in the isolates correlated with the degree of resistance as reflected by the minimum inhibitory concentration (MIC) of the drugs. The messenger RNA for another efflux pump, MDR1, was also overexpressed in one of the azole-resistant C. albicans isolates that overexpressed CDR1. This finding suggests that drug-resistance may involve synergy between energy-dependent drug efflux pumps CDR1p and MDR1p in some but not all isolates. Interestingly, DNA sequence analysis of the promoter region of the CaCDR1 gene revealed several point mutations in the resistant clinical isolates compared to the susceptible isolates at 39, 49 and 151 nucleotides upstream from the ATG start codon. This finding provides new information on point mutations in the promoter region which may be responsible for the overexpression of CDR1 in drug-resistant isolates.


1Introduction

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results
  6. 4Discussion
  7. Acknowledgements
  8. References

Candida species are opportunistic pathogens which can cause a wide range of infections from mucocutaneous to systemic infections. In the case of vaginitis, it was estimated that over 75% of women will have at least one episode of vaginitis during their lifetime [1] and a study in Malaysia showed that Candida albicans was the predominant fungal species isolated from vaginal swabs [2]. As a consequence of the increasing number of infections caused by Candida species, the use of antifungal agents has been extensive. However the widespread use of antifungal prophylaxis has led to an increased trend of emergence of drug-resistant Candida, especially C. albicans and C. glabrata[3].

Several molecular mechanisms by which C. albicans developed resistance to antifungal drugs have been reported and reviewed by Prasad and Kapoor [4] including the failure to accumulate azole antifungals and the alteration in the target of the drug. The cellular target of fluconazole and other azole derivatives in yeast is cytochrome P450 (CYP51A1) which is a haemoprotein involved in the 14α-demethylation of lanosterol, an important step in the biosynthesis of ergosterol in the cell membrane. Alterations in the target enzyme (lanosterol 14α-demethylase), including point mutations [5] and upregulation of ERG11 gene expression [6], lead to decreased susceptibilities to azole drugs.

Other studies show that resistance to azole-antifungal agents in Candida species can be mediated by two multidrug efflux transporters, which are coded by ATP-Binding Cassette (ABC) transporter genes called CDR1 and major drug facilitator gene called MDR1[7]. Increased CDR1 expression in a number of drug-resistant C. albicans isolates from AIDS patients suggests the role of this gene in azole-resistance [8]. Overexpression of CDR1 in Saccharomyces cerevisiae by heterologous expression conferred multidrug resistance to this yeast [9] and presented experimental evidence for the function of the CDR1p pump.

Nonetheless, there are currently no findings that could explain how the drug transporter genes become overexpressed in the drug resistant isolates. Several mechanisms have been postulated for the increased gene expression such as higher levels of mRNA stability, gene amplification, or deregulation because of point mutations in the promoter region. Research efforts that investigate whether there is any synergy between the different mechanisms of drug resistance are lacking. In this study, we set out to investigate the mechanism for the drug resistance exhibited by clinical isolates from vaginitis patients, and made an attempt towards unravelling the molecular basis for the mechanism.

2Materials and methods

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results
  6. 4Discussion
  7. Acknowledgements
  8. References

2.1Strains and media

C. albicans and C. glabrata isolates were cultured from vaginal swabs taken from patients with recurrent vulvovaginal candidiasis in a hospital in Malaysia. Two azole drug-susceptible strains (C. albicans ATCC 14053, C. glabrata ATCC 2001) were used as controls.

2.2Antifungal drug susceptibility testing

The broth macrodilution method was performed according to the recommendations of NCCLS M27-A. The test concentrations of clotrimazole and ketoconazole (Sigma, Malaysia) used were 2-fold serial dilutions of 0.016–8 and 0.03–16 μg/ml, respectively. For each isolate, a series of sterile polystyrene tubes containing 0.1 ml of each clotrimazole and ketoconazole dilution were inoculated separately with 0.9 ml of the inoculum suspension which had been adjusted to 0.5 McFarland Standard turbidity and carefully mixed. The tubes were incubated at 35°C for 48 h before the endpoint was read. The clotrimazole MIC of ≥0.5 μg/ml was adopted as the resistance breakpoint as suggested from the study by Pelletier and coauthors [10] while the tentative breakpoint criterion of ketoconazole was set at ≥0.25 μg/ml based on the MIC of C. krusei ATCC6258 and the the distribution of MIC values of a pool of clinically resistant C. albicans isolates.

2.3Total RNA extraction

Yeasts (?1.76 × 109 cells) grown in Sabouraud's Dextrose broth were harvested by centrifugation (5000g, 10 min) and washed three times with phosphate buffered saline. The RNA was then isolated according to the recommendations of the SV Total RNA Isolation System (Promega). The extracted RNA was resuspended in RNAse-free water.

2.4Reverse transcription-PCR analysis

cDNA was synthesised in a total volume of 20 μl containing the DNAse-treated RNA (1 μg), random hexamers (500 ng), 4 μl of 5× reaction buffer (250 mM Tris–HCl, pH 8.3, at 25°C, 250 mM KCl, 20 mM MgCl2, and 50 mM DTT), dNTPs (1.0 mM final concentration), ribonuclease inhibitor (20 U, Promega) and Moloney murine leukemia virus (M-MLV) reverse transcriptase (200 U, Fermentas), at 42°C for 1 h. The reaction was terminated by heating to 70°C for 10 min and the resulting cDNA was subjected to PCR using gene specific primers designed in this study.

Each PCR vial had a parallel reaction that lacked reverse transcriptase to confirm that the subsequent amplified PCR product was derived from cDNA rather than genomic DNA contamination. The PCR reaction mixture contained the following reagents with their respective final concentrations in a final volume of 50 μl: 10× PCR buffer (1×), MgCl2 (1.5 mM), dNTPs (0.2 mM), primers (0.5 pmol/μl), cDNA (0.2 μg), and Taq polymerase (Fermentas, 5 U) which was added last. The primers for amplifying CaCDR1 gene are: forward: 5′ TCGTTATCCCAACTCCAAGTATG 3′ (+3228 to +3251 of GenBank Accession No. X77589) and reverse: 5′ GACCAGCTTCAATATCACCTTTG 3′ (+3674 to +3651). CgCDR1 primers designed in this study are 5′ CAAAAGGTTCAGAAGAATTGG 3′ (4007–4028 of GenBank Accession No. AF109723) and 5′ TGTGCTACAGAAGCATTGGAGT 3′ (+4485 to +4506). The primers for CaACT1, CaMDR1 and CgACT1 genes are from Henry et al. [6].

For quantification purposes, the PCR was carried out for 25 cycles to ensure that amplification during the logarithmic phase was obtained. A housekeeping gene, ACT1 was used as internal control. The cycling conditions for CaCDR1, CgCDR1, CgACT1 and CaACT1 were 94°C for 5 min (initial denaturation), and 25 cycles of 94°C for 1 min, 57°C for 1 min, and 72°C for 1 min; followed by 72°C for 5 min. As for CaMDR1, the cycling conditions were 94°C for 5 min, and 25 cycles of 94°C for 1 min, 52°C for 1 min and 72°C for 1 min followed by 72°C for 5 min.

2.5PCR amplification of CDR1 for nucleotide sequence analysis

Part of the promoter of C. albicans CaCDR1 gene was amplified by PCR with 0.2 μg of genomic DNA from ATCC and azole-resistant strains. The primers used were 5′ TTTTTTTTTTTAGTTCATCATC (position −184 to −163) and 5′ GGTCATTATTTATTTCTTCAT (position 242–262). The reaction mixture containing the forward and reverse primers, DNA, and dNTPs was subjected to hotstart-PCR at 94°C for 5 min before adding in 1 μl of Taq polymerase (Fermentas). PCR cycling conditions were 35 cycles of 94°C for 1 min, 57°C for 1 min, 72°C for 1 min, and final extension at 72°C for 10 min. Gel electrophoresis of PCR products was carried out using 1.5% (w/v) agarose gel. The gel image was digitally captured using the GeneGenius BioImaging System (Syngene UK) and the intensity of the bands were measured using the Imager software relative to 1.0 μg of standard molecular weight marker (GeneRuler 100 bp DNA Ladder, Fermentas).

2.6DNA Sequencing and sequence analysis

PCR products from all three resistant isolates as well as the susceptible control strain were purified from the agarose gel and sequenced on ABI PRISM 377–96 DNA Sequencer. Each fragment was sequenced on both sense and antisense strands using forward and reverse primers. The ABI PRISM BigDye Terminator kit (ABI-Roche) was used. The samples were loaded onto vertical 5% Long Ranger (BioWhittaker Molecular Applications) DNA sequencing gels. The resultant sequences were analysed by using CLUSTALW and BLAST software.

3Results

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results
  6. 4Discussion
  7. Acknowledgements
  8. References

3.1CDR1 and MDR1 expression in C. albicans isolates

The resistance profiles of six azole-resistant isolates, three each from C. albicans and C. glabrata species used in this study are listed in Table 1. The gene expression profile of the azole-resistant C. albicans isolates HRV3/01-2, HRV36/01–4, HRV33/01 was compared with the azole-susceptible C. albicans ATCC strain via semi-quantitative reverse transcription-PCR (RT-PCR). As presented in Fig. 1, CaCDR1 was expressed at a low level in the ATCC strain, but a remarkable increase in expression was observed in two of the resistant isolates (HRV36/01-4 and HRV33/01).

Table 1. C. albicans and C. glabrata isolates used in this study
Sample IDSpeciesMIC ketoconazole (μg/ml)MIC Clotrimazole (μg/ml)Azole resistance status
HRV 3/01–2C. albicans0.0161Clotrimazole
HRV 33/01C. albicans0.54Ketoconazole + Clotrimazole
     
HRV 36/01–4C. albicans0.58Ketoconazole + Clotrimazole
     
HRV 8/01–2C. glabrata24Ketoconazole + Clotrimazole
     
HRV 10/01C. glabrata24Ketoconazole + Clotrimazole
     
HRV 12/01C. glabrata18Ketoconazole + Clotrimazole
     
ATCC 14053C. albicans<0.25 (0.125)<0.5 (0.125)Not resistant
     
ATCC 2001C. glabrata<0.25 (0.125)<0.5 (0.0625)Not resistant
image

Figure 1. (A) Relative expression of ACT1 and CaCDR1 genes was analysed by semi-quantitative RT-PCR. The amount of ACT1 mRNA expressed was used to normalise the dissimilar starting amount of total RNA in different isolates. Lanes: CaATCC, C. albicans ATCC strain; HRV3/01-2, HRV36/01–4 and HRV33/01, clinical resistant C. albicans isolates; ACT, C. albicans ACT1 gene; CDR, C. albicans CDR1 gene. The representative result from two independent experiments is shown here. (B) Relative quantitation of ACT1 and CaMDR1 genes. Lanes: ACT, C. albicans ACT1 gene; MDR, C. albicans MDR1 gene.

Download figure to PowerPoint

Quantification of the mRNA level indirectly by measuring the intensity of the RT-PCR product revealed that the amounts of CaCDR1 mRNA relative to ACT1 (encoding the constitutively expressed housekeeping gene, actin) mRNA in drug resistant strains HRV36/01–4 and HRV33/01 were significantly higher at 3.9- and 3.7-fold compared to that of the ATCC isolate (Table 2). The other isolate, HRV3/01-2, showed a slight increase in CaCDR1 mRNA (1.6-fold relative to ATCC strain).

Table 2.  Comparison of C. albicans CaCDR1 and CaMDR1 mRNA in three resistant isolates and a susceptible C. albicans ATCC14053 control strain
Lane (strain, gene)aConcentration of RT-PCR product (ng/μl)Ratio of CaCDR1 and CaMDR1 to ACT1 mRNA levelFold of gene expression relative to ATCC strain
  1. aThe order of the lanes are according to Fig. 1A and B.

CaATCC, actin37.11.2
CaATCC, CDR146.1  
    
HRV 3/01–2, actin32.72.01.6
HRV 3/01–2, CDR164.3  
    
HRV 36/01–4, actin35.34.83.9
HRV 36/01–4, CDR1168.6  
    
HRV 33/01, actin34.74.63.7
HRV 33/01, CDR1157.6  
    
CaATCC, actin30.51.2
CaATCC, MDR137.1  
    
HRV 3/01–2, actin30.91.10.9
HRV 3/01–2, MDR12.5  
    
HRV 36/01–4, actin32.70.90.8
HRV 36/01–4, MDR129.3  
    
HRV 33/01, actin30.22.31.9
HRV 33/01, MDR177.7  

The relative amounts of the CaMDR1 mRNA in two drug-resistant strains HRV3/01-2 and HRV36/01–4 were marginally lower than that of the drug-susceptible ATCC strain (Table 2). However, CaMDR1 mRNA level in HRV 33/01 was approximately 1.9-fold higher than that of the ATCC strain.

3.2CgCDR1 expression in C. glabrata isolates

CgCDR1 was expressed constitutively but at low level in C. glabrata ATCC 2001 strain. All three resistant strains (HRV8/01–2, HRV10/01, HRV12/01) overexpressed CgCDR1 gene compared to the azole-susceptible ATCC strain as shown in Fig. 2. Quantification with Instant Imager revealed that the relative amounts of CgCDR1 mRNA in drug-resistant strains were 1.9–2.7 folds higher than that of the drug-susceptible strain (Table 3).

image

Figure 2. Relative expression of CgACT1 and CgCDR1 genes was analysed by semi-quantitative RT-PCR. Lanes: CgATCC, C. glabrata ATCC strain; HRV8/01–2, HRV10/01, and HRV 12/01, clinical resistant C. glabrata isolates; Actin, C. glabrata ACT1 gene; CDR, C. glabrata CgCDR1 gene.

Download figure to PowerPoint

Table 3.  Comparison of C. glabrata CgCDR1 mRNA levels in three C. glabrata resistant isolates and a susceptible control (C. glabrata ATCC2001) strain
Lane (strain, gene)Concentration of RT-PCR product (ng/μl)Ratio of CgCDR1 to actin expressedFold of gene expression relative to ATCC strain
CgATCC, actin115.60.8
CgATCC, CgCDR193.4  
    
HRV 8/01–2, actin115.51.61.9
HRV 8/01–2, CgCDR1180.9  
    
HRV 10/01, actin115.51.82.3
HRV 10/01, CgCDR1210.7  
    
HRV 12/01, actin117.12.22.7
HRV 12/01, CgCDR1257.3  

3.3DNA sequence analysis of CaCDR1 promoter region

We postulated that the alteration in the rate of transcription initiation may be a reason underlying the upregulation of the CaCDR1 mRNA in the clinical resistant isolates of C. albicans species. Thus, primers that amplify the region upstream from the ATG (+1) start codon were used for sequencing this specific DNA region. Sequence analysis revealed the existence of point mutations in the promoter region of each of the resistant strains, which is displayed in the multiple sequence alignment in Fig. 3. All three resistant isolates had the same point mutation of T1064 [RIGHTWARDS ARROW] C (151 nucleotides upstream of ATG start codon). HRV3/01-2 and HRV33/01 had the same point mutation at T1162 [RIGHTWARDS ARROW] G (position −49). The other isolate, HRV36/01–4 had a base substitution of A1172 [RIGHTWARDS ARROW] G (position 39).

image

Figure 3. Multiple sequence alignment analysis of the CaCDR1 gene of the clinical drug-resistant isolates (HRV35/01-4, HRV3/01–2 and HRV33/01) in comparison with the CaCDR1 gene of the C. albicans ATCC (CaATCC) isolate. The region analysed include the promoter region near the TATA box (boxed nucleotides) and upstream of the transcription start point (inline image the position of tsp is as reported by Harry et al. [21]). The nucleotide position shown corresponds to the CaCDR1 gene sequence in GenBank, accession number X77589. Asterisks (∗) mark the conserved nucleotides. Shaded nucleotides indicates point mutations. M, S, and D are one-letter codes for amino acids translated from the gene.

Download figure to PowerPoint

4Discussion

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results
  6. 4Discussion
  7. Acknowledgements
  8. References

The most commonly reported azole drug resistance mechanism in C. albicans is reduced intracellular accumulation of the drug resulting from increased efflux through energy-dependent pumps [11–13]. Several studies correlated increased expression of CDR1 and MDR1 genes with resistance to various azole antifungals [14–16].

In support of the notion that CDR1 might be involved in azole resistance in the isolates obtained from Malaysian recurrent vaginitis patients, we found that all the ketoconazole and/or clotrimazole-resistant C. albicans and C. glabrata strains expressed increased amount of CDR1 mRNA, albeit to varying extents. In a Japanese study, Maebashi et al. [11] found that two C. albicans isolates from AIDS patients utilised the CDR pumps while one isolate demonstrated energy-dependent drug efflux without overexpression of CDR1-4 or CaMDR1, indicating that some other mechanism may be operating. Previous data [17] had shown that overexpression of CDR1 and MDR1 genes were not due to gene amplification.

The results in our study suggest that certain but not all clinically drug-resistant strains may employ two or more mechanisms synergistically for conferring drug resistance to azole drugs as exhibited by HRV33/01. HRV36/01-4 and HRV3/01–2 use the ATP-binding transporter Cdr1p as their main mechanism of drug efflux, while HRV33/01 apparently derives its resistant attribute from both the Cdr1p and CaMDR1p efflux pumps. Cross resistance to different azole drugs was demonstrated by HRV33/01, indicating that the MDR1p might complement the CDR1p to produce a synergistic effect of pumping out the drugs. The differences in the expression of CaCDR1 and CaMDR1 mRNA between the drug-resistant and sensitive strains can be further confirmed using realtime quantitative PCR.

For the C. glabrata isolates, the results here imply the important role that CgCDR1 plays in the resistance mechanism for C. glabrata. However it is still unknown whether CgMDR1 is also involved as a complement to CgCDR1 as the primers designed for amplifying CgMDR1 failed to amplify the targeted gene.

Previous data [8] suggested that CaMDR1, previously known as BENr, is more specific towards hydrophilic azoles such as fluconazole whereas CDR1 can export a wide spectrum of azoles. However, we had not investigated the fluconazole susceptibilities of HRV33/01 as the pure grade fluconazole powder was not made available to us by the supplier (Pfizer).

An interesting phenomenon observed in this study was that overexpression of CDR1 mRNA correlates with the elevation of MICs of ketoconazole and clotrimazole. For instance, C. albicans HRV36/01–4 with the highest MIC (8 μg/ml) to clotrimazole among the 3 isolates had the greatest overexpression of the CaCDR1 gene. On the other hand, HRV3/01 with a lower MIC of clotrimazole at 1 μg/ml had relatively lower expression of CaCDR1 compared to the other two clinical samples. The same correlation was found for C. glabrata, where the highest level of CgCDR1 overexpressed was displayed by isolate HRV12/01 with the highest MIC (8 μg/ml) for clotrimazole.

Sequence analysis of the CaCDR1 gene disclosed several point mutations near the promoter of the resistant strains. The eukaryotic promoter consists of core elements, which include the TATA box and an Inr (Initiator) sequence that form the core promoter, and regulatory elements, which either enhance or repress transcription in a gene-specific manner [18].

The T1064C mutation found in the CaCDR1 gene in this study is -27 nucleotides proximal to the TATA box; whereas the T1162G mutation is near the initiator sequence. This could be one of the molecular bases for the observed overexpression of this gene. The point mutations could be within the recognition sequence for the binding of trans-acting transcription factors and hence changes to the nucleotide sequence could cause either less efficient binding of transcriptional repressors; or increase in the affinity of activators to the promoter region and thus lead to the overexpression of CDR1; conferring resistance to these strains.

A drug-response element (DRE) which is a type of regulatory sequence element, was previously discovered in the promoter of CDR1[19] at position 751 of the CaCDR1 gene. However, the point mutations found in this study were not situated within the DRE but are more proximal to the transcription start site, and hence could be part of another cis-regulatory element or enhancer. Further functional studies should verify whether these point mutations in the CaCDR1 promoter region could confer resistance to azole drugs.

The finding of point mutations and their correlation to the drug resistance phenotype has been well established for the azole drug target enzyme ERG11p. However, these mutations occur at the protein-coding part of the ERG11 gene, of which the most common are Y132H and T315A (Asai et al. [20]). Thus far, ongoing research by our group has shown no point mutations in the protien-coding portion of CaCDR1 in several resistant isolates.

This research has taken a step in the direction of studying the role of CDR1 and MDR1 genes of C. albicans as well as C. glabrata in azole resistance. Although only a few clinical isolates were used in this study, this report is worthwhile as it has revealed a number of new findings. It is reported here for the first time that point mutations in the non-translated region upstream from the start codon of CaCDR1 may contribute towards its overexpression. Further work to clone and sequence the promoter elements further upstream of the sequences already analysed is currently being done to investigate whether any other mutation hotspots exist.

Acknowledgements

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results
  6. 4Discussion
  7. Acknowledgements
  8. References

We thank the Ministry of Science, Technology and Innovation for funding the project through an IRPA grant (project no. 06-02-04–0598-EA001).

References

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results
  6. 4Discussion
  7. Acknowledgements
  8. References
  • [1]
    Lanchares, J.L., Hernandez, M.L. (2000) Recurrent vaginal candidiasis: changes in etiopathogenical patterns. Int. J. Gynecol. Obstet. 71, S29S35.
  • [2]
    Ng, K.P., Madasamy, M., Saw, T.L., Baki, A., He, J., Soo-Hoo, T.J. (1999) Candida biotypes isolated from clinical specimens in Malaysia. Mycopathologia 144, 135140.
  • [3]
    Boschman, C.R., Bodnar, U.R., Tornatore, M.A., Obias, A.A., Noskin, G.A., Englund, K., Postelnick, M.A., Suriano, T., Peterson, L.R. (1998) Thirteen-year evolution of azole resistance in yeast isolates and prevalence of resistant strains carried by cancer patients at a large medical center. Antimicrob. Agents Chemother. 42, 734738.
  • [4]
    Prasad, R., Kapoor, K. (2005) Multidrug resistance in yeast Candida. Int. Rev. Cytol. 242, 215248.
  • [5]
    Sanglard, D., Ischer, F., Koymans, L., Bille, J. (1998) Amino acid substitutions in the cytochrome P-450 lanosterol 14alpha-demethylase (CYP51A1) from azole-resistant Candida albicans clinical isolates contribute to resistance to azole antifungal agents. Antimicrob. Agents Chemother. 42, 241253.
  • [6]
    Henry, K.W., Nickels, J.T., Edlind, T.D. (2000) Upregulation of ERG genes in Candida species by azoles and other sterol biosynthesis inhibitors Antimicrob. Agents Chemother. 44, 26932700.
  • [7]
    Sanglard, D., Ischer, F., Monod, M., Bille, J. (1997) Cloning of Candida albicans genes conferring resistance of azole antifungal agents: characterization of CDR2, a new multidrug ABC transporter gene. Microbiology 143, 405416.
  • [8]
    Sanglard, D., Kuchler, K., Pagani, J.L., Monod, M., Bille, J. (1995) Mechanism of resistance to azole antifungal agents in Candida albicans isolates from AIDS patients involve specific multidrug transporters. Antimicrob. Agents Chemother. 39, 23782386.
  • [9]
    Niimi, M., Niimi, K., Takano, Y., Holmes, A.R., Fischer, F.J., Uehara, Y., Cannon, R.D. (2004) Regulated overexpression of CDR1 in Candida albicans confers multidrug resistance. J. Antimicrob. Chemother. 54, 9991006.
  • [10]
    Pelletier, R., Peter, J., Antin, C., Gonzalez, C., Wood, L., Walsh, T.J. (2000) Emergence of resistance of Candida albicans to clotrimazole in human immunodeficiency virus-infected children: in vitro and clinical correlations. J. Clin. Microbiol. 38, 15631568.
  • [11]
    Maebashi, K., Niimi, M., Kudoh, M., Fischer, F.J., Makimura, K., Niimi, K., Piper, R.J., Uchida, K., Arisawa, M., Cannon, R.D., Yamaguchi, H. (2001) Mechanisms of fluconazole resistance in Candida albicans isolates from Japanese AIDS patients. J. Antimicrob. Chemother. 47, 527536.
  • [12]
    Albertson, G.D., Niimi, M., Cannon, R.D., Jenkinson, H.F. (1996) Multiple efflux mechanisms are involved in Candida albicans fluconazole resistance. Antimicrob. Agents Chemother. 40, 28352841.
  • [13]
    Morschhauser, J. (2002) The genetic basis of fluconazole resistance development in Candida albicans. Biochim. Biophys. Acta 1587, 240248.
  • [14]
    Odds, F.C. (1996) Resistance of clinically important yeasts to antifungal agents. Int. J. Antimicrob. Agents 6, 145147.
  • [15]
    Franz, R., Kelly, S.L., Lamb, D.C., Kelly, D.E., Ruhnke, M., Morshhauser, J. (1998) Multiple molecular mechanisms contribute to a stepwise development of fluconazole resistance to azole. J. Med. Vet. Mycol. 25, 329333.
  • [16]
    White, T.C. (1997) Increased mRNA levels of ERG16, CDR, and MDR1 correlate with increases in azole ressitance in Candida albicans isolates from a patient infected with human immunodeficiency virus. Antimicrob. Agents Chemother. 41, 14821487.
  • [17]
    Lyons, C.N., White, T.C. (2000) Transcriptional analyses of antifungal drug resistance in Candida albicans. Antimicrob. Agents Chemother. 44, 22962303.
  • [18]
    Hampsey, M. (1998) Molecular genetics of the RNA Polymerase II general transcriptional machinery. Microbiol. Mol. Biol. Rev. 62, 465503.
  • [19]
    de Micheli, M., Bille, J., Schueller, C., Sanglard, D. (2002) A common drug-responsive element mediates the upregulation of the Candida albicans ABC transporters CDR1 and CDR2, two genes involved in antifungal drug resistance. Mol. Microbiol. 43, 11971214.
  • [20]
    Asai, K., Tsuchimori, N., Okonogi, K., Perfect, J.R., Gotoh, O., Yoshida, Y. (1999) Formation of azole-resistant Candida albicans by mutation of sterol 14-demethylase P450. Antimicrob. Agents Chemother. 43, 11631169.
  • [21]
    Harry, J.B., Song, J.L., Lyons, C.N., White, T.C. (2002) Transcription initiation of genes associated with azole resistance in Candida albicans. Med. Mycol. 40, 7381.