Rapid identification of potentially probiotic Bifidobacterium species by multiplex PCR using species-specific primers based on the region extending from 16S rRNA through 23S rRNA

Authors

  • Hyuk-Sang Kwon,

    1. ILDONG Research Laboratories, ILDONG Pharmaceutical Co., Ltd., Biotechnology Laboratory, 260-5, Eonnam-ri, Kuseong-eup, Yongin, Gyongki-do 449-915, Korea
    Search for more papers by this author
  • Eun-Hee Yang,

    1. ILDONG Research Laboratories, ILDONG Pharmaceutical Co., Ltd., Biotechnology Laboratory, 260-5, Eonnam-ri, Kuseong-eup, Yongin, Gyongki-do 449-915, Korea
    Search for more papers by this author
  • Seung-Hun Lee,

    1. ILDONG Research Laboratories, ILDONG Pharmaceutical Co., Ltd., Biotechnology Laboratory, 260-5, Eonnam-ri, Kuseong-eup, Yongin, Gyongki-do 449-915, Korea
    Search for more papers by this author
  • Seung-Woo Yeon,

    1. ILDONG Research Laboratories, ILDONG Pharmaceutical Co., Ltd., Biotechnology Laboratory, 260-5, Eonnam-ri, Kuseong-eup, Yongin, Gyongki-do 449-915, Korea
    Search for more papers by this author
  • Byung-Hwa Kang,

    1. ILDONG Research Laboratories, ILDONG Pharmaceutical Co., Ltd., Biotechnology Laboratory, 260-5, Eonnam-ri, Kuseong-eup, Yongin, Gyongki-do 449-915, Korea
    Search for more papers by this author
  • Tae-Yong Kim

    Corresponding author
    1. ILDONG Research Laboratories, ILDONG Pharmaceutical Co., Ltd., Biotechnology Laboratory, 260-5, Eonnam-ri, Kuseong-eup, Yongin, Gyongki-do 449-915, Korea
    Search for more papers by this author

  • Edited by W. Kneifel

*Corresponing author. Tel.: +82 31 287 1700; fax: +82 31 287 1800., E-mail address: tykim@ildong.com

Abstract

This study aimed at developing a novel multiplex polymerase chain reaction (PCR) primer set for identification of the potentially probiotic Bifidobacterium species B. adolescentis, B. animalis subsp. animalis (B. animalis), B. bifidum, B. breve, B. longum biovar infantis (B. infantis), B. animalis subsp. lactis B. lactis, B. longum biovar longum (B. longum) and B. pseudolongum. The primer set comprised specific and conserved primers and was derived from the integrated sequences of 16S and 23S rRNA genes and the rRNA intergenic spacer region (ISR) of each species. It could detect and identify type strains and isolates from pharmaceuticals or dairy products corresponding to the eight Bifidobacterium species with high specificity. It was also useful for screening of the related strains from natural sources such as the gastro-intestinal tract and feces. We suggest that the assay system from this study is an efficient tool for simple, rapid and reliable identification of Bifidobacterium species for which probiotic strains are known.

1Introduction

Strains of the genus Bifidobacterium constitute a significant proportion of the probiotic cultures used in the pharmaceutical and food industry [1–3]. Members of Bifidobacterium are among the most common microorganisms in the human colon, and they are considered to be important in maintaining a well-balanced intestinal microflora[4]. It has been postulated that some bifidobacteria have several health promoting effects, including prevention of diarrhea and intestinal infections, alleviation of constipation, production of antimicrobials against harmful intestinal bacteria, and immunostimulation [5,6]. Recently, many efforts have been made to search for potentially probiotic Bifidobacterium strains from human bodies and dairy products. Thus, the development of convenient and accurate methods for identification of Bifidobacterium strains is essential[7].

Conventional biochemical and physiological tests have some limitations in discriminating a large number of isolates showing similar physiological characteristics such as carbohydrate fermentation profiles, cell wall analysis and detection of specific enzymes (transaldolases, β-galactosidases, 6-phosphogluconate dehydrogenase and various isoenzymes)[4]. The phenotypic techniques do not always give clear results, are tedious and sometimes unreliable because of adaptive changes of species to growth conditions[8]. Therefore, much research has focused upon the application of other biological techniques such as the comparison of specific nucleotide sequences for the identification of bifidobacteria[9]. Recently, it has been proposed that Bifidobacterium species can be easily differentiated by pulsed-field gel electrophoresis, random amplified polymorphic DNA, denaturing gradient gel electrophoresis and restriction fragment length polymorphism [9–13].

The use of rRNA and its encoding genes as target molecules has been one of the most widely used molecular approaches in taxonomic studies[14]. Molecular techniques based on 16S rDNA and 16-23S rDNA intergenic spacer region (ISR) sequences have attracted attention as reliable methods for identification of Bifidobacterium species [15,16], and 23S rDNA-targeted primers for PCR assay have successfully identified specific species among Bifidobacterium and other genera [17,18]. In addition, the multiplex PCR technique can simultaneously accomplish the rapid identification and correct differentiation of several species[8]. Compared with phenotypic methods, multiplex PCR primer sets, established for identification of Bifidobacterium species, have improved the accuracy of species identification and the convenience of procedure.

But multiplex PCR assays place a limit on the detection of more than five species because the primers have mostly been derived from only the specific sequences on either 16S rDNA or ISR and flanking 23S rDNA. In our previous study[19], more discriminative primers were designed by integrating all sequences of 16S rDNA, ISR, and 23S rDNA in Lactobacillus species. The multiplex PCR primer set developed detected seven species at a time.

In this work, we designed another convenient multiplex PCR for detecting 8 major, potentially probiotic Bifidobacterium species, with primers targeted to 16S and 23S rRNA genes and their ISR. In order to validate the multiplex PCR system, we applied it to the identification of bifidobacteria isolated from commercial probiotics and natural sources.

2Materials and methods

2.1Bacterial strains and growth conditions

Thirteen type strains were used for the verification of specific primers designed in this study: B. adolescentis ATCC 15703T, B. angulatum ATCC 27535T, B. animalis ATCC 25527T, B. bifidum ATCC 29521T, B. breve ATCC 15700T, B. catenulatum ATCC 27539T, B. dentium ATCC 27534T, B. infantis ATCC 15697T, B. lactis DSM 10140T, B. longum ATCC 15707T, B. minimum ATCC 27538T, B. pseudocatenulatum ATCC 27919T, and B. pseudolongum ATCC 25526T. Bifidobacterium strains from KCTC (Korean Collection for Type Cultures, Korea) were applied to species identification. Bifidobacterial isolates from commercial probiotics and the stools of infants were tested for the evaluation of the multiplex PCR primer set as a screening tool for probiotic strains. Isolation of these strains was performed by the method of Temmerman et al.[20] and Mullie et al.[8], respectively. All strains were cultured on BL (Eiken Chemical, Tokyo, Japan) agar at 37 °C in an Anaerobic System (BBL GasPak, Becton Dickinson and Company, Cockeysville, MD).

2.2Design of the multiplex PCR primer set for identification of Bifidobacterium species

To design specific and conserved primers based on the 16S and 23S rRNA genes and their ISR, bifidobacterial rDNA sequences were acquired from GenBank (http://www.ncbi.nlm.nih.gov/). 16S rDNA sequences shorter than 0.5 kb and the sequences of 23S rDNA and ISR shorter than 0.2 kb were filtered out for efficient data processing and 222 nucleotide sequences remained. Assembling rDNA sequences, making representative sequences, and designing primers was performed as previously described[19]. Twenty-three representative rDNA sequences were generated. Among these, the representative sequences of the target species in this study were integrated from the sequences listed in Table 1. Finally, eight species- or group-specific and two Bifidobacterium genus-conserved primers were designed for amplification of the differentiated target specific PCR product. Primer sequences and expected size of the amplicons are shown in Table 2.

Table 1.  Reference sequences of 16S rDNA, 16S–23S rDNA ISR and flanking 23S rDNA used for construction of representative sequences and the type strains and potentially probiotic Bifidobacterium species
SpeciesType strainGenBank Accession number
B. adolescentisATCC 15703AB125904, AB125906, AF275881, AB275882, AY305304, M58729, U09511, U09512, U09513, U09514
B. animalisATCC 25527AB027536, AB050132, AB050133, AB050134, AB050135, AB050137, AB050138, AB125926, AY151397, AY166508, AY166509, AY166510, AY166511, AY166512, AY225132, D86185, L36967, U09858, X70971
B. bifidumATCC 29521M84777, S83624, U09517, U09831, U25951, U25952
B. breveATCC 15700AB006658, AF491832, AF491833, AF491834, AF491835, AF491836, AJ245850, AJ311605, AY172656, AY172657, AY267190, AY513711, AY513712, AY513713, M58731, M84776, U09518, U09519, U09520, U09521, X70972, X70973
B. infantisATCC 15697AB125903, AJ245851, AJ311604, AY151398, AY166531, AY166532, AY166533, AY166534, AY166535, AY166536, D86184, M58738, M84782, M84783, U09525, U09527, U09792, X70974
B. lactisDSM 10140AB050136, X89513
B. longumATCC 15707AB125903, AB125915, AB125916, AJ245849, AJ311606, AY151399, AY166537, AY166538, M58739, M84781, U09832, U10152
B. pseudolongumATCC 25526AY174105, AY174106, AY174109, AY174114, AY174115, AY174116, AY174117, AY174118, AY174119, AY174120, D86194, D86195, M58742, U09879
Table 2.  Multiplex PCR primer set used in this study
TargetPrimeraSequence (5′–3′)Target sitebProduct (bp)c
  1. aIDBC1R and IDBC2F, Bifidobacterium- conserved primer; IDB11F, IDB21F, IDB31F, IDB41F, IDB51F, and IDB71R, species-specific primers; IDB61F and IDB81R, group-specific primers.

  2. bEach target site indicates the start to end point of the complementary sequences annealing the forward and reverse primer respectively and all the primer sequences were numbered according to E. coli numbering of the 16S rRNA gene[30].

  3. cProduct indicates approximated length of each PCR product derived from primer pair composed of species-specific and bacterial conserved primer (IDBC1R or IDBC2F).

  4. dPrimer IDB71R is modified sequence formerly described by Ventura et al.[18].

BifidobacteriumIDBC1RATCCGAACTGAGACCGGTT1256–1238
BifidobacteriumIDBC2FATCGCAGTCTGCAACTCGA1255–1273
B. adolescentisIDB11FATCGGCTGGAGCTTGCT60–761197
B. bifidumIDB21FTGAGGTAACGGCTCACCAAGGCT239–2611018
B. breveIDB31FTAGGGAGCAAGGCACTTTGTGT430–451827
B. pseudolongumIDB41FCCCTTTTTCCGGGTCCTGT786–804471
B. longumIDB51FCGGTCGTAGAGATACGGCTT956–975301
B. animalis B. lactisIDB61FGCATGTTGCCAGCGGGTGA1069–1087188
B. lactisIDB71RdCCACACCACACAATCCAATACG1636–1615382
B. infantis B. longumIDB81RAGCAACACACACCATGAAGGTG1934–1913680

2.3Preparation of DNA templates and PCR assay

Both purified genomic DNAs and colony suspensions were used as templates for PCR. DNA templates were purified as described in our previous study[19]. PCR mixture (20 μl) contained 2 μl of 10× PCR buffer (Thermophilic DNA Polymerase with Mg-free 10× Reaction Buffer, Promega Corporation, Madison, WI), primer mixture comprising 50 pmol of each primer, 625 μM of each deoxyribonucleotide triphosphate (Promega), 2.5 mM MgCl2, 1.0 U Taq DNA polymerase (Promega), and DNA template. PCR amplification was performed with a PTC-200 DNA Engine (MJ Research, Waltham, MA) as follows: Initial heating at 96 °C for 2 min, followed by 35 cycles consisting of denaturation at 94 °C for 30 s, annealing at 63 °C for 40 s, and extension at 72 °C for 30 s, and a 5 min final extension step at 72 °C. In colony PCR, after initially heating the PCR samples at 96 °C for 5 min for cell disruption and DNA release, PCR procedures were carried out as described above. Amplicons were separated by electrophoresis in 1.5% agarose gels and visualized by ethidium bromide staining.

2.4Identification of strains from probiotics and fecal sample

All isolates were assigned to the genus Bifidobacterium on the basis of their anaerobic requirement, cellular morphology, Gram staining and fructose-6-phosphate phosphoketolase activity. Among the isolates, bifidobacteria were finally selected by a PCR assay using the Bifidobacterium genus-specific primer pair (primer g-Bifid-F, 5′-CTCCTGGAAACGGGTGG-3′; primer g-Bifid-R, 5′-GGTGTTCTTCCCGATATCTACA-3′)[15]. To identify unknown bifidobacterial isolates, PCR assays for detection of human-originated Bifidobacterium species were performed, as described by Mullie et al.[8]. The species-identified isolates were certified by sequence analysis. Cloned 16S rRNA genes were sequenced with ABI PRISM Dye Terminator Cycle Sequencing Ready Reaction kit (Perkin–Elmer Inc., Wellesley, MA). The nucleotide sequences were analyzed for sequence similarity by BLAST (http://www.ncbi.nlm.nih.gov/blast) and compared with those of representative Bifidobacterium species by multiple alignments using Clustal X (Des Higgins, Germany). Also, phylogenetic relationships were confirmed through comparing the 16S rDNA sequence of each isolate with those corresponding to related species by BLAST2 (http://www.ncbi.nlm.nih.gov/blast/bl2seq) pair-wise alignments.

3Results

3.1Establishment of the multiplex primer set for identification of potentially probiotic Bifidobacterium species

A novel multiplex PCR primer set for identification of eight potentially probiotic Bifidobacterium species comprising B. adolescentis, B. animalis, B. bifidum, B. breve, B. infantis, B. lactis, B. longum and B. pseudolongum was constructed from the sequences of 16S rDNA and 16S–23S rDNA ISR containing flanking 23S rDNA. The multiplex primer set was composed of ten primers (Table 2) derived from six species-specific, two group-specific and two Bifidobacterium genus-conserved sequences (Fig. 1). All species-specific primers produced single amplicons representing species-specificity together with either one of the conserved primers, IDBC1R and IDBC2F, as a counterpart. The group-specific primers, IDB61F and IDB81R were designed for detecting B. animalis- and B. longum- group, respectively. Since the sequences of group-specific primers are commonly present in rDNAs of the species in each group, the primers therefore yielded group-specific amplicons of equal size. The group-specific primers, ID61F and ID81R, provided the same amplicons of 188 and 680 bp to B. lactis and B. animalis and to B. longum and B. infantis, respectively. The group-specific amplicons, together with species-specific amplicons, helped to discriminate species in a group. They clearly discriminated B. lactis from B. longum and B. psuedolongum because the species-specific amplicon of B. lactis showed a small difference (less than 80–90 bp) in length compared with the others (Table 2).

Figure 1.

Sizes of PCR products and alignments of the approximate locations of PCR primers. PCR primers designed in this study are described in Table 2. Arrows indicate annealing positions and directions of primers on genomic DNA sequences of Bifidobacterium species. The designations in the arrows stand for: B1 (IDB11F), B2 (IDB21F), B3 (IDB31F), B4 (IDB41F), B5 (IDB51F), B6 (IDB61F), C1 (IDBC1R), C2 (IDBC2F), B7 (IDB71R), and B8 (IDB81R). Lower lines indicate expected sizes of amplicons.

3.2Discrimination of potentially probiotic Bifidobacterium species by the multiplex PCR

To verify whether all specific primers were available for identification of respective species, the PCR assay was performed with thirteen Bifidobacterium type strains. Each pair of specific and conserved primers produced an amplicon of expected length (ca. 0.2–1.2 kb). Group-specific primer IDB61F together with its counterpart IDBC1R produced amplicons of equal size from B. animalis and B. lactis. Primer IDB81R with IDBC2F also generated group-specific amplicons from the type strains of B. infantis and B. longum (data not shown).

It was then tested whether the multiplex primer set consisting of all ten primers in equimolar amounts could be applicable to the identification of each species. The primers did not interfere with each other and the multiplex PCR correctly detected and discriminated eight target Bifidobacterium type strains (Fig. 2). Two group-specific amplicons were produced: 188 bp from B. animalis and B. lactis (Fig. 2, lanes 3 and 9) and 680 bp from B. infantis and B. longum (Fig. 2, lanes 8 and 10). It is interesting that the multiplex PCR with B. lactis generated an unexpected amplicon (ca. 0.5–0.6 kb). It was estimated as an amplicon produced from primer pairing, IDB61F–IDB71R (570 bp, see Table 2 and Fig. 1). However, no amplicon was observed in a similar case of possible primer pairing, IDB51F–IDB81R in B. longum.

Figure 2.

Agarose gel electrophoresis of PCR products obtained by multiplex PCR assay. Multiplex PCR was performed with the primer set containing 8 specific and 2 conserved primers. Lanes 1–12 designate PCR product from each genomic DNA used as PCR template. Lane 1, B. adolescentis ATCC 15703T; lane 2, B. angulatum ATCC 27535T; lane 3, B. animalis ATCC 25527T; lane 4, B. bifidum ATCC 29521T; lane 5, B. breve ATCC 15700T; lane 6, B. catenulatum ATCC 27539T; lane 7, B. dentium ATCC 27534T; lane 8, B. infantis ATCC 15697T; lane 9, B. lactis DSM 10140T; lane 10, B. longum ATCC 15707T; lane 11, B. pseudocatenulatum ATCC 27919T; lane 12, B. pseudolongum ATCC 25526T; lane M, 100 bp-DNA ladder (kb). Arrow indicates the position of the amplicon generated by primer pairing, IDB61F–IDB71R.

To test the possibility of rapid and simple detection without DNA extraction, the same experiments were repeated using cell suspensions as PCR templates. The results were in agreement with those using purified genomic DNA. In addition, individual strains in mixed cell suspensions were readily discerned (Fig. 3). Even in the cases of the mixed sample containing B. lactis and B. longum, each species could be clearly distinguished from one another by the group-specific amplicon (Fig. 3, lanes 1, 2, and 7).

Figure 3.

Agarose gel electrophoreses of PCR products from multiplex PCR assays. Lanes 1–7 designate PCR products from unequally mixed cell suspension used as PCR template. Lane 1, B. adolescentis ATCC 15703T, B. bifidum ATCC 29521T, B. breve ATCC 15700T, B. lactis DSM 10140T, B. longum ATCC 15707T, and B. pseudolongum ATCC 25526T; lane 2, B. infantis ATCC 15697T, B. lactis DSM 10140T, B. longum ATCC 15707T, and B. pseudolongum ATCC 25526T; lane 3, B. animalis ATCC 25527T, B. breve ATCC 15700T, B. infantis ATCC 15697T, and B. pseudolongum ATCC 25526T; lane 4, B. bifidum ATCC 29521T, B. breve ATCC 15700T, and B. lactis DSM 10140T; lane 5, B. animalis ATCC 25527T, B. breve ATCC 15700T, B. lactis DSM 10140T, and B. pseudolongum ATCC 25526T; lane 6, B. animalis ATCC 25527T and B. lactis DSM 10140T; lane 7, B. lactis DSM 10140T, B. longum ATCC 15707T, and B. pseudolongum ATCC 25526T; lane M, 100 bp-DNA ladder (kb). Arrow indicates the position of the amplicon from primer pairing, IDB61F–IDB71R.

3.3Verification of the multiplex PCR with the reference strains

In order to study whether the multiplex primer set was appropriate for species identification of various strains, forty-one Bifidobacterium strains from KCTC were tested (Table 3). Among these, twenty-two strains belonged to eight potentially probiotic Bifidobacterium species. Prior to the investigation, it was confirmed by Bifidobacterium genus-specific PCR that all strains were bifidobacteria (data not shown). The multiplex PCR assay produced specific amplicons in twenty-three strains. With one exception, the strain B. suis KCTC 3229T, the twenty-two positive strains belonged to the eight target species while the eighteen negative strains did not. The multiplex PCR assay also identified each of the twenty-two strains as one of the eight target species with high accuracy (20/22). Only two strains, B. animalis KCTC 3126 and B. animalis KCTC 3356 were identified as B. lactis with the multiplex PCR results.

Table 3.  PCR identification of reference Bifidobacteria
SpeciesStrainaPCR resultsbOrigin
  1. aKCTC, Korean Collection for Type Cultures; Superscript “T” designated type strains.

  2. b–, no PCR product.

B. adolescentisKCTC 3216TB. adolescentisIntestine of adult
B. adolescentisKCTC 3267B. adolescentisIntestine of adult
B. angulatumKCTC 3236THuman feces
B. angulatumKCTC 3475Sewage
B. animalisKCTC 3126B. lactisChicken feces
B. animalisKCTC 3219TB. animalisRat feces
B. animalisKCTC 3355B. animalisRat feces
B. animalisKCTC 3356B. lactisSewage
B. asteroidesKCTC 3271THindgut of honeybee
B. bifidumKCTC 3202TB. bifidumStool of breast fed infant
B. bifidumKCTC 3418B. bifidumIntestine of infant
B. bifidumKCTC 3440B. bifidumAdult intestine
B. bifidumKCTC 3441B. bifidumNursing stools
B. boumKCTC 3227TRumen of cattle
B. breveKCTC 3220TB. breveIntestine of infant
B. breveKCTC 3419B. breveIntestine of infant
B. breveKCTC 3461B. breveIntestine of infant
B. catenulatumKCTC 3221THuman feces
B. catenulatumKCTC 3358Human feces
B. catenulatumKCTC 3360Sewage
B. choerinumKCTC 3275TPiglet feces
B. dentiumKCTC 3222TDental caries
B. dentiumKCTC 3362Human vagina
B. dentiumKCTC 3363Pleural fluid from adult
B. indicumKCTC 3230THindgut of honeybee
B. infantisKCTC 3249TB. infantisIntestine of infant
B. infantisKCTC 3460B. infantisFeces of infant
B. infantisKCTC 3473B. infantisBaby feces
B. longumKCTC 3128TB. longumIntestine of adult
B. longumKCTC 3421B. longumIntestine of infant
B. longumKCTC 3466B. longumCalf feces
B. magnumKCTC 3228TRabbit feces
B. minimumKCTC 3273TSewage
B. pseudocatenulatumKCTC 3223TFeces of infant
B. pseudocatenulatumKCTC 3481Sewage
B. pseudolongum subsp. globosumKCTC 3234TB. pseudolongumBovine rumen
B. pseudolongum subsp. pseudolongumKCTC 3224TB. pseudolongumSwine feces
B. pseudolongum subsp. pseudolongumKCTC 3463B. pseudolongumChicken feces
B. subtileKCTC 3272TSewage
B. suisKCTC 3229TB. longumPig feces
B. thermophilumKCTC 3225TSwine feces

3.4Application of the multiplex PCR to identification of new isolates

The established primer set was applied to the identification of Bifidobacterium strains isolated from pharmaceuticals and dairy products. Fifteen probiotic isolates were identified as B. bifidum, B. infantis, B. lactis, and B. longum (Table 4). To verify whether the primer set correctly detected target species, each isolate was phylogenetically analyzed on the basis of its partial 16S rDNA sequence. It was shown that the results of multiplex PCR matched those of DNA sequence analysis (data not shown).

Table 4.  Identification of Bifidobacteria from commercial probiotics and feces of infants
TaxonNumber of positive strains (% of total)
 Commercial products (n= 15)Infant feces (n= 44)
B. adolescentis0 (0)0 (0)
B. animalis0 (0)0 (0)
B. bifidum1 (6.7)4 (9.1)
B. breve0 (0)3 (6.8)
B. infantis3 (20.0)4 (9.1)
B. lactis8 (53.3)0 (0)
B. longum3 (20.0)10 (22.7)
B. pseudolongum0 (0)0 (0)
Other Bifidobacterium0 (0)23 (52.3)

In order to estimate whether the multiplex PCR system is a reliable tool for the screening of probiotic Bifidobacterium strains from various samples, we also tested bifidobacterial isolates from feces of infants. Forty-four strains were isolated from fecal samples and assigned to Bifidobacterium by the genus-specific PCR assay. Among these, only twenty-one were identified as the probiotic Bifidobacterium strains by the multiplex PCR. B. longum were predominant and B. bifidum, B. breve, and B. infantis were present in similar proportion (Table 4). Amplicons corresponding to B. adolescentis, B. animalis, B. lactis, and B. pseudolongum were not found. The remaining twenty-three isolates were investigated with PCR assays established by Mullie et al.[8]. Many of them were identified as B. angulatum and B. catenulatum/B. pseudocatenulatum (data not shown).

4Discussion

There are reports identifying Bifidobacterium strains by oligonucleotide probes or PCR assays [16,21–23]. In conventional studies, PCR-based methods have been performed to detect a single or a few species. Recently, many multiplex PCR techniques such as group-specific PCR have been introduced to identify Bifidobacterium species from various sources [8,22]. So far no PCR system could discriminate more than five species at once. This was due to the use of primer sets based on individual specific sequences of 16S, 23S rRNA gene or ISR[24]. Therefore, our studies focused on developing a multiplex primer set to detect various potentially probiotic Bifidobacterium species with a single PCR assay.

We constructed a multiplex PCR primer set containing two conserved and eight specific primers. The primer set was designed to produce two PCR products in B. longum and B. lactis, a species-specific and a group-specific one, respectively. The group-specific amplicon discriminated between species in a group and those that produce the species-specific amplicons with a small difference in size. However, it can also give rise to extra-amplicons from the species-specific pairing such as IDB51F-IDB81R for B. longum and IDB61F-IDB71R for B. lactis. Among these, only B. lactis generated the amplicon corresponding to extra-pairing of the primers. Nevertheless, all the type strains were easily identified by amplicons of unique size and number.

When the multiplex primer set was applied to the identification of forty-one Bifidobacterium strains, it presented a relatively high accuracy with only three exceptions, two of B. animalis and one of B. suis strains. In the case of the two strains of B. animalis, the multiplex primer set recognized B. animalis KCTC 3126 and B. animalis KCTC 3356 as B. lactis. However, Ventura et al. have already classified B. animalis ATCC 27536 and B. animalis ATCC 27674 into B. lactis, and these strains are identical to B. animalis KCTC 3126 and B. animalis KCTC 3356, respectively [23,25]. These results suggest that these strains may be closer to B. lactis than to B. animalis in phylogenetic relationship. The type strain of B. suis species, KCTC 3229T was detected as B. longum in the multiplex PCR. The rDNA sequence analyses revealed that the B. longum species-specific primer was different from the corresponding sequences of B. suis in only one base pair. We presume that it is impossible to distinguish B. suis from B. longum by PCR assay using the B. longum– species-specific primer based on 16S rDNA gene and ISR. If all these factors are taken into consideration, the accuracy of the multiplex PCR may be as high as 97.6% (40/41).

The multiplex primer set established in this study has several advantages over the conventional ones composed of only species-specific primers. Successful introduction of the group-specific and conserved primers made it possible to devise more primers from the defined region and to easily optimize the multiplex PCR conditions. The primer set could detect eight species in a PCR assay without unexpected amplicons, as described on our previous study[19]. In addition, the incorporation of the latest information on rDNA sequences for primer set design allowed realization of the discrimination not only between B. infantis and B. longum, even if not B. suis, which are the member of biovars in B. longum, but also between B. animalis and B. lactis, the latter having recently been described as a subspecies of B. animalis[26,27].

We examined the applicability of the primer set to identify bifidobacteria isolated from pharmaceuticals and dairy products. The isolates could be easily identified as a bifidobacteria belonging to B. bifidum, B. infantis, B. lactis or B. longum. To verify the applicability of the PCR assay as a screening tool for probiotic strains, we also tested a number of Bifidobacterium isolates from feces of infants. Among the isolates, B. longum were predominant and B. bifidum, B. breve and B. infantis were found in relatively small proportion. This result is in agreement with those of another recent report[8]. To ensure that the multiplex primer set did not produce false-negative results, the unidentified strains were further investigated. Among them, some were ascertained to belong to B. angulatum, B. catenulatum and B. pseudocatenulatum. According to the phylogenetic relationship, others may be estimated to be Bifidobacterium-related species existing in human gastro-intestinal tract such as Gardnerella vaginalis, Scardovia inopinata and Parascardovia denticolens[8]. Identical sequences with those of Bifidobacterium-specific primers were found in their 16S rDNA (AB029087, D89331, D89332, M58744). Even though classified recently, these species were hardly distinguished from Bifidobacterium because they had the fructose-6-phosphate phosphoketolase known as the specific enzyme of Bifidobacterium, and very high similarities in their rDNA sequence [28,29].

In conclusion, we established a multiplex PCR primer set for the rapid identification of potentially probiotic Bifidobacterium species. The method can be applied to, and contribute to the development, management and investigation of useful probiotics. In addition, we confirmed that the design of multiplex PCR primers based on the integration of rDNA sequences is a readily available and applicable method.

Ancillary