SEARCH

SEARCH BY CITATION

Keywords:

  • Salmonella;
  • LAMP;
  • Rapid;
  • Sensitive;
  • Detection

Abstract

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results
  6. 4Discussion
  7. Acknowledgement
  8. References

Loop-mediated isothermal amplification (LAMP) assay detected Salmonella within 60 min. The 220 strains of 39 serotypes of Salmonella subsp. enterica and 7 strains of Salmonella enterica subsp. arizonae were amplified, but not 62 strains of 23 bacterial species other than Salmonella. The sensitivity of the LAMP assay was found to be >2.2 cfu/test tube using nine serotypes. The specificity was similar to that of a PCR assay, but the sensitivity of LAMP was greater. Both fluorescence and turbidity were able to detect the products in the LAMP assay. S. enteritidis in a liquid egg sample artificially inoculated with the organism was detected by the LAMP assay at 2.8 cfu/test tube, although negative by PCR assay. These results indicate that the LAMP assay is a rapid, specific and sensitive detection method for Salmonella.


1Introduction

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results
  6. 4Discussion
  7. Acknowledgement
  8. References

Sensitive and rapid detection methods for Salmonella in food are required. Many detection methods have been developed. Salmonella contamination levels in food are generally low compared to clinical samples and hence culture enrichment has been necessary for food. Sensitive culture methods using a two-step enrichment with buffered peptone water (BPW) or trypticase soy broth, followed by culture in Rappaport–Vassiliadis (RV) broth and tetrathionate (TT) broth, and plating on selective agar media such as xylose lysine deoxycholate (XLD), modified brilliant green (BGM) agar, or CHROMagar Salmonella have been performed [1,2]. These culture methods require more than three days and rapid detection methods such as Enzyme immunoassay (EIA) need a high population of target pathogen [3,4]. The polymerase chain reaction (PCR) assay was developed to rapidly detect target pathogens in enrichment cultures. However, the PCR assay generally needs electrophoresis to detect the amplicon which can take several hours. Recently, real-time PCR assays have been applied to detect food-borne pathogens. However, the real-time PCR assays need an expensive thermal cycler with a fluorescence detector [5].

Loop-mediated isothermal amplification (LAMP) is a novel nucleic acid amplification method that relies on an auto-cycling strand displacement DNA synthesis performed by the Bst DNA polymerase large fragment [6–9]. LAMP is different from PCR in that four or six primers perform the amplification of the target gene, the amplification uses a single temperature step at 60–65 °C for about 60 min, and the amplification products have variously sized structures consisting of alternate inverted repeats of the target sequence on the same strand in large amounts. Thus, LAMP is more specific, rapid and simple to perform than PCR. Furthermore, because the LAMP method synthesizes a large amount of DNA, the products can be detected by simple turbidity. Thus expensive equipment is not necessary to give a high level of precision, equivalent or greater, when compared to PCR techniques.

In this study, we report the application of a LAMP assay with six primers for the rapid and sensitive detection of Salmonella.

2Materials and methods

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results
  6. 4Discussion
  7. Acknowledgement
  8. References

2.1Bacterial strains

As a control, 220 strains of 39 serotypes of Salmonella subsp. enterica, 7 strains of Salmonella enterica subsp. arizonae and 62 strains of 23 bacterial species other than Salmonella (Table 1) were used to test the specificity of the LAMP assay. Listeria was cultured on 5% sheep blood agar medium under 5% CO2 for 18 h at 35 °C. Vibrio was cultured on tryptic soy agar medium (TSA) (Difco, Detroit, MI) containing 3% NaCl for 18 h at 37 °C. The other bacteria were cultured on heart infusion agar medium at 37 °C for 18 h. Colonies were suspended to #2 McFarland standard turbidity in 5 ml phosphate buffered saline (PBS). The bacterial suspension was diluted in PBS to 106 CFU/ml. The dilutions were used for the LAMP and PCR assays.

Table 1.  Specificities of amplification of invA by LAMP and PCR assays
StrainsNo. of strainsAmplification of invA
LAMPPCR   
Salmonella enterica subsp. enterica
SerotypeAgona1++
Albany (Dusseldorf)2++ 
Anatum2++ 
Blockley9++ 
Braenderup10++ 
Bredeney2++ 
Cerro1++ 
Choleraesuis6++ 
Cremieu1++ 
Corvallis4++ 
Derby1++ 
Dublin5++ 
Enteritidis38++ 
Gallinarum (Pullorum)6++ 
Give2++ 
Haardt2++ 
Hadar1++ 
Heidelberg2++ 
Infantis15++ 
Isangi1++ 
Juba1++ 
Kivu5++ 
Montevideo1++ 
Newport1++ 
Nyborg1++ 
Obogu1++ 
Oranienburg3++ 
Paratyphi A10++ 
Paratyphi B6++ 
Potsdam1++ 
Saintpaul1++ 
Schwarzengrund3++ 
Senftenberg4++ 
Stanley1++ 
Tennessee3++ 
Thompson5++ 
Typhi44++ 
Typhimurium15++ 
Virchow3++ 
Salmonella enterica subsp. arizonae7++
     
Citrobactor freundii2
Enterobactor cloacae2
Enterobacter aerogenes2
Escherichia coli10
Hafnia alvei 2
Klebsiella pneumoniae2
Listeria monocytogenes10
Listeria ivanovii2
Listeria seeligeri1
Listeria grayi 1
Listeria innocua2
Morganella morganii3
Proteus vulgaris2
Proteus mirabilis3
Providencia alcalifaciens1
Pseudomonas fluorescens1
Serratia marcescens2
Shigella sonnei1
Vibrio alginolyticus1
Vibrio cholerae1
Vibrio mimicus1
Vibrio parahaemolyticus5
Vibrio vulnificus5

Cultures of Salmonella Blockley, Salmonella Braenderup, Salmonella Bredeney, Salmonella Cerro, Salmonella Corvallis, Salmonella Enteritidis, Salmonella Haardt, Salmonella Isangi, and Salmonella Virchow were tested for sensitivity in the LAMP and PCR assays. They were cultured in buffered peptone water (BPW, Oxoid, UK) at 37 °C for 18 h and serially 10-fold diluted in PBS to 10−4–10−7. Each dilution was used for the LAMP and PCR assays. In addition, 1 ml of each dilution of S. enteritidis culture was added to 9 ml of the enrichment culture of a liquid egg sample in BPW. The sample was preliminarily confirmed to be Salmonella-negative by culture, PCR and LAMP methods. This Salmonella-added enrichment culture of liquid egg was used to determine the sensitivity of the LAMP and PCR assays. To determine inoculum size, 0.1 ml of the each dilution of Salmonella culture was plated onto TSA in duplicate. After incubation at 37 °C for 18 h, the number of colonies was counted.

2.2LAMP assay

In this study, six primers, two inner primers, two outer primers and two loop primers (Table 2), targeting Salmonella enterica invasion protein (invA) gene [10] were used for the LAMP reactions [9]. The region which these primers target are shown in Fig. 1. The LAMP reaction was performed using a Loopamp DNA amplification kit (Eiken Chemical Co., Ltd.). Each 50 μl of the samples prepared for the LAMP assay described above was added to 50 μl of the extraction solution (pH 12.5) (BLA6600150, Eiken Chemical Co., Ltd.) and heated at 100 °C for 5 min to extract DNA. The samples were centrifuged (Tomy, Tokyo) at 2000g for 1 min, and the supernatant was transferred to a new microcentrifuge tube and used as the template DNA solution for the LAMP assay. The LAMP reaction mixture contained the primers for Salmonella detection (20 μl), Bst polymerase (1 μl), YO-PRO-1 iodide (intercalating Molecular Probe, OR) (0.125 μl), and template DNA solution (5 μl). The reaction components were mixed in a tube, incubated at 65 °C for 60 min using a thermal cycler (ABI7700, Applied BioSystems, Foster City, CA.) and then heated to 80 °C for 2 min to terminate the reaction. The LAMP amplicon was detected as a value of fluorescence (delta Rn) in real-time using an increase in fluorescence intensity from the intercalating dye. In addition, turbidity produced by magnesium pyrophosphate [6], a by-product during the reaction was noted visually. Salmonella DNA extracted from a suspension of S. enteritidis cells was used as positive control each time.

Table 2.  LAMP primers
PrimerSequence (5′–3′)
FIPGACGACTGGTACTGATCGATAGTTTTTCAACGTTTCCTGCGG
BIPCCGGTGAAATTATCGCCACACAAAACCCACCGCCAGG
F3GGCGATATTGGTGTTTATGGGG
B3AACGATAAACTGGACCACGG
Loop FGACGAAAGAGCGTGGTAATTAAC
Loop BGGGCAATTCGTTATTGGCGATAG
image

Figure 1. Nucleotide sequences of targets for primers in the LAMP assay on Salmonella Typhimurium invA. To find specific nucleotide sequences of Salmonella spp., a multiple alignment was determined with analyses of various invA sequences (M90846, U43273, U43237–U43252, U43271, U43272) from DDBJ/EMBL/GenBank data base. The sequences are M90846 (S. Typhimurium).

Download figure to PowerPoint

Aliquots of 1 μl of LAMP products were electrophoresed in a 2% agarose gel. After staining with ethidium bromide, the products were detected under UV light.

2.3PCR assay

The bacterial dilutions in PBS other than S. enteritidis described above were heated at 95 °C for 10 min and centrifuged at 10,000g for 5 min. Enrichment culture of liquid egg, which was inoculated with S. enteritidis dilutions, was heated at 95 °C for 10 min and centrifuged at 10,000g for 5 min. The supernatant was transferred to a new microtube as the template DNA solution for the PCR method. PCR targeting invA gene was performed as follows. Primer set- SIN-1 & 2 (each 0.5 μl) (Takara Bio, Ohtsu, Japan) [11,12], dNTP Mixture (4 μl), 10× Taq buffer (5 μl), Takara Taq (0.25 μl), template DNA solution (2.5 μl) and DW (37.25 μl) were mixed in a reaction tube. The reaction was performed at 94 °C for 1 min for denaturation, at 55 °C for 1 min for annealing and 72 °C for 1 min for extension using a thermal cycler (ABI7000, Applied BioSystems). After 35 cycles and heating to 72 °C for 10 min, PCR products were electrophoresed in a 3% agarose gel and stained with ethidium bromide. The size of the PCR product (378 bp) was compared to that of a S. enteritidis strain used as a positive control.

3Results

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results
  6. 4Discussion
  7. Acknowledgement
  8. References

All of the 220 strains of 39 serotypes of Salmonella subsp. enterica and 7 strains of Salmonella enterica subsp. arizonae were shown to be positive using the LAMP reaction assay. The PCR method was also positive for these strains (Table 1), whereas, all other bacteria tested in this study were negative. There was no difference between the LAMP results detected by fluorescence or turbidity (data not shown).

The sensitivities of the LAMP and PCR assays were tested on nine Salmonella serotypes at various cell concentrations. In the LAMP assay, serotypes Blockley, Braenderup, Bredeney, Cerro, Enteritidis, Isangi and Virchow were detected in the 10−6 dilution (2.2–6.3 cells/test tube) but not in the 10−7 dilution (0.2–0.6 cells/test tube) (Table 3). Serotypes Corvallis and Haardt were detected in the 10−5 (15.0–18.5 cells/test tube) but not in the 10−6 dilution (1.5–1.9 cells/test tube). S. enteritidis was evaluated in “spiked” liquid egg where the detection sensitivity was similar to that in broth. In the PCR assay, 10−6 dilutions of serotypes Blockley, Braenderup, Bredeney, Cerro, Enteritidis, Isangi and Virchow, and 10−5 dilutions of serotypes Corvallis and Haardt were negative although positive in the LAMP assay. The sensitivity of the LAMP assay was higher than that of the PCR assay for all serotypes tested in this study. The results of LAMP and PCR assays were not different between detections in liquid egg and enrichment culture.

Table 3.  Sensitivity of LAMP assay for Salmonella
Salmonella serotypeaDilutions of cultures for assay
10−410−510−610−7  
  1. aS. enteritidis was detected in liquid egg but not only culture in TSB. The others were culture in BPW.

BlockleyCells/test tube325.032.53.30.3
 LAMP+++
 PCR++
      
BraenderupCells/test tube255.025.52.60.3
 LAMP+++
 PCR++
      
BredeneyCells/test tube230.023.02.30.2
 LAMP+++
 PCR++
      
CerroCells/test tube357.535.83.60.4
 LAMP+++
 PCR++
      
CorvallisCells/test tube150.015.01.50.2
 LAMP++
 PCR+
      
EnteritidisCells/test tube62562.56.30.6
 LAMP+++
 PCR++
      
Enteritidis (in liquid egg)Cells/test tube28028.02.80.3
 LAMP+++
 PCR++
      
fHaardtCells/test tube185.018.51.90.2
 LAMP++
 PCR+
      
IsangiCells/test tube337.533.83.40.3
 LAMP+++
 PCR++
      
VirchowCells/test tube217.521.82.20.2
 LAMP+++
 PCR++

Fig. 2 shows the results in the LAMP assay by three detection methods of LAMP products in serotype Braenderup. The dilutions of 10−4–10−6 (2.6–255 cells/test tube) showed an increase in fluorescence but not that of 10−7 (0.3 cells/test tube) (Fig. 2(a)). The increases occurred over time. Visible turbidity was detected in the test tube of 10−4–10−6 dilution but not for 10−7 dilution (Fig. 2(b)). Furthermore, the amplicons in the tubes were analyzed by agarose gel electrophoresis. The ladder patterns in 10−4–10−6 dilution confirmed the specific amplification of the target sequence (Fig. 2(c)). However, no band was detected for the 10−7 dilution.

image

Figure 2. The detection of Salmonella Braenderup by fluorescence, turbidity and agarose electrophoresis in LAMP assay using intercalator dye. The dilutions of S. Braenderup culture were tested in triplicate. (a) Detection by fluorescence. Fluorescence of YO-PRO-1 intercalator dye iodide binding to the amplicon is shown as delta Rn. (b) Detection by turbidity. Tube 1: 10−4 dilution; tube 2: 10−5 dilution; tube 3: 10−6 dilution; tube 4: 10−7 dilution; tube 5: negative control. (c). Detection by agarose electrophoresis. Lane 1: 10−4 dilution; lane 2: 10−5 dilution; lane 3: 10−6 dilution; lane 4: 10−7 dilution; lane 5: negative control; lane M: 100 bp ladder size marker (Takara Bio).

Download figure to PowerPoint

4Discussion

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results
  6. 4Discussion
  7. Acknowledgement
  8. References

The specificity of the LAMP assay was as high as that for PCR as shown in Table 3. To confirm the sensitivity of LAMP, various Salmonella serotypes were tested at various concentrations. The detection in dilutions of various Salmonella serotypes was different among serotypes. However, the difference seemed to be due to the concentration of the Salmonella cells. From the results, it is demonstrated that the detection limit of LAMP assay was between 1.9 and 2.2 cells/test tube (Table 3); or, the Salmonella concentration of the sample was 370–434 cells/ml. Detection by LAMP assay was not inhibited by the liquid egg and the sensitivity was very high. In detection of Salmonella by PCR, the reported sensitivity is 3200 cells/ml of egg (16 cells/test tube) [13], 1000–4900 cells/ml of BPW culture (5–24.5 cells/test tube) [14] and 10,000 cells/ml in food culture (50 cells/test tube) [15]. PCR sensitivity shown in this study was similar (Table 3) to those of previous reports although the conditions of PCR assays were individually different. The sensitivity of the real-time PCR assay recently published was 1000 cells/ml (5 cells/test tube) in eggs [16]. Thus, in comparison to these other assays, the LAMP assay is shown to be more sensitive. The reason is that the amplification of the target gene by the LAMP is more rapid and greater in yield than by the other assays. However, a false positive reaction may be seen as in other methods such as PCR. It is possible that a wrong product appears at a similar size to the right product in the PCR assay. The sequence of the product will confirm PCR amplification of the target. To confirm LAMP amplification of the target, the ladder patterns in agarose gel electrophoresis are useful. Furthermore, it may be useful if the amplicons of various size are purified and sequenced. Notomi et al. [9] confirmed the structures of the LAMP amplified products for HBs regions of hepatitis virus B by cloning and sequencing; the sequences of the cloned DNAs perfectly agreed with the expected nucleotide sequences.

It is known that some components of food inhibit DNA amplification. In this study, detection in liquid egg was evaluated with S. enteritidis because contamination of S. enteritidis in liquid egg is one of the most important public health hazards. The detection of S. enteritidis by LAMP or PCR was not inhibited by liquid egg components.

This study demonstrated that the LAMP assay was effective in detecting Salmonella rapidly and with high sensitivity.

Acknowledgement

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results
  6. 4Discussion
  7. Acknowledgement
  8. References

This study was supported by a grant from the Japan Health Sciences Foundation.

References

  1. Top of page
  2. Abstract
  3. 1Introduction
  4. 2Materials and methods
  5. 3Results
  6. 4Discussion
  7. Acknowledgement
  8. References
  • [1]
    Andrews, W.H., June, G.A., Sherrod, P.A., Hammack, T.S., Amaguana, R.M. FDA Bacteriological Analytical Manual 8th Edn. Salmonella 1998 AOAC International (Chapter 5)
  • [2]
    Hara-Kudo, Y., Kumagai, S., Masuda, T., Goto, K., Ohtsuka, K., Masaki, H., Tanaka, H., Tanno, K., Miyahara, M., Konuma, H. (2001) Detection of Salmonella enteritidis in shell and liquid eggs using enrichment and plating. Int. J. Food Microbiol. 64, 395399.
  • [3]
    Bennett, A.R., MacPhee, S., Betts, R.P. (1996) The isolation and detection of Escherichia coli O157 by use of immunomagnetic separation and immunoassay procedures. Lett. Appl. Microbiol. 22, 237243.
  • [4]
    Chapman, P.A., Ellin, M., Ashton, R. (2001) A comparison of immunomagnetic separation and culture, Reveal™ and VIP™ for the detection of E. coli O157 in enrichment cultures of naturally-contaminated raw beef, lamb and mixed meat products. Lett. Appl. Microbiol. 32, 171175.
  • [5]
    Mullah, B., Livak, K., Andrus, A., Kenney, P. (1998) Efficient synthesis of double dye-labeled oligodeoxyribonucleotide probes and their application in a real time PCR assay. Nucleic Acids Res. 26, 10261031.
  • [6]
    Mori, Y., Nagamine, K., Tomita, N., Notomi, T. (2001) Detection of loop-mediated isothermal amplification reaction by turbidity derived from magnesium pyrophosphate formation. Biochem. Biophys. Res. Commun. 289, 150154.
  • [7]
    Nagamine, K., Watanabe, K., Ohtsuka, K., Hase, T., Notomi, T. (2001) Loop-mediated isothermal amplification reaction using a nondenatured template. Clin. Chem. 47, 17421743.
  • [8]
    Nagamine, K., Kuzuhara, Y., Notomi, T. (2002) Isolation of single-stranded DNA from loop-mediated isothermal amplification products. Biochem. Biophys. Res. Commun. 290, 11951198.
  • [9]
    Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., Hase, T. Loop-mediated isothermal amplification of DNA Nucleic Acids Res. 28 2000 e63
  • [10]
    Ebel, E., Schlosser, W. (2000) Estimating the annual fraction of eggs contaminated with Salmonella enteritidis in the United State. Int. J. Food Microbiol. 61, 5162.
  • [11]
    Chopra, A.K., Peterson, J.W., Chary, P., Prasad, R. (1994) Molecular characterization of an enterotoxin from Salmonella typhimurium. Microb. Pathog. 16, 8598.
  • [12]
    Galan, J.E., Ginocchio, C., Costeas, P. (1992) Molecular and functional characterization of the Salmonella invation gene invA: homology of InvA to members of a new protein family. J. Bacteriol. 56, 43384349.
  • [13]
    Woodward, M.J., Kirwan, S.E.S. (1996) Detection of Salmonella enteritidis in eggs by the polymerase chain reaction. Vet. Rec. 138, 411413.
  • [14]
    Bennett, A.R., Greenwood, D., Tennant, C., Banks, J.G., Betts, R.P. (1998) Rapid and definitive detection of Salmonella in foods by PCR. Lett. Appl. Microbiol. 26, 437441.
  • [15]
    Bailey, J.S. (1998) Detection of Salmonella cells within 24 to 26 hours in poultry samples with the polymerase chain reaction BAX system. J. Food Prot. 61, 792795.
  • [16]
    Seo, K.H., Valentin-Bon, I.E., Brackett, R.E., Holt, P.S. (2004) Rapid, specific detection of Salmonella enteritidis in pooled eggs by real-time PCR. J. Food Prot. 67, 864869.