Nitrogen catabolite repression in Saccharomyces cerevisiae during wine fermentations

Authors

  • Gemma Beltran,

    1. Unitat d'Enologia del Centre de Referència de Tecnologia d'Aliments, Dept. Bioquímica i Biotecnologia, Facultat d'Enologia de Tarragona, Universitat Rovira i Virgili, Ramón y Cajal, 70, 43005 Tarragona, Spain
    Search for more papers by this author
  • Maite Novo,

    1. Unitat d'Enologia del Centre de Referència de Tecnologia d'Aliments, Dept. Bioquímica i Biotecnologia, Facultat d'Enologia de Tarragona, Universitat Rovira i Virgili, Ramón y Cajal, 70, 43005 Tarragona, Spain
    Search for more papers by this author
  • Nicolas Rozès,

    1. Unitat d'Enologia del Centre de Referència de Tecnologia d'Aliments, Dept. Bioquímica i Biotecnologia, Facultat d'Enologia de Tarragona, Universitat Rovira i Virgili, Ramón y Cajal, 70, 43005 Tarragona, Spain
    Search for more papers by this author
  • Albert Mas,

    1. Unitat d'Enologia del Centre de Referència de Tecnologia d'Aliments, Dept. Bioquímica i Biotecnologia, Facultat d'Enologia de Tarragona, Universitat Rovira i Virgili, Ramón y Cajal, 70, 43005 Tarragona, Spain
    Search for more papers by this author
  • José M Guillamón

    Corresponding author
    1. Unitat d'Enologia del Centre de Referència de Tecnologia d'Aliments, Dept. Bioquímica i Biotecnologia, Facultat d'Enologia de Tarragona, Universitat Rovira i Virgili, Ramón y Cajal, 70, 43005 Tarragona, Spain
    Search for more papers by this author

*Corresponding author. Tel.: +34-977-250358/250000; fax: +34-977-250347, E-mail address: jmgn@astor.urv.es

Abstract

We carried out fermentations with several nitrogen sources in different concentrations and studied nitrogen regulation by following the transcriptional profile of the general amino-acid permease (GAP1) and the ammonium permeases (MEP1, MEP2, MEP3). In wine fermentations the cells evolve from a nitrogen-repressed situation at the beginning of the process to a nitrogen-derepressed situation as the nitrogen is consumed. These nitrogen-repressed/derepressed conditions determined the different patterns of ammonium and amino-acid consumption. Arginine and alanine were hardly used under the repressed conditions, while the uptake of branched-chain and aromatic amino acids increased.

1Introduction

A wide variety of nitrogen-containing compounds is present in grape juice. These depend on the variety of grape and the time of harvest. The two main sources of yeast assimilable nitrogen compounds are amino acids and ammonium ions. Ammonium ions make up a large percentage of total assimilable nitrogen (up to 40%), while proline and arginine are the most common nitrogenous compounds in grape juice (30–65% of total amino-acid content) [1]. Saccharomyces cerevisiae is able to use different nitrogen sources for growth but not all nitrogen sources support growth equally well. S. cerevisiae selects nitrogen sources that enable the best growth by a mechanism called Nitrogen Catabolite Repression (NCR) [2,3]. Good nitrogen sources such as glutamine, asparagine or ammonium decrease the level of enzymes required for utilisation of poorer nitrogen sources [4].

Amino acids are transported into the cell by general and specific transport systems. The general high-capacity permeases like GAP1 and AGP1 or the specific proline permease PUT4 are nitrogen-regulated and become down-regulated at the transcriptional as well as the post-translational level, in response to high-quality nitrogen sources like ammonium [5]. However, specific permeases like the histidine permease (HIP1), the lysine permease (LYP1) and the basic-amino-acid permease CAN1 are expressed constitutively [4]. Up to now, only three permeases (Mep1p, Mep2p and Mep3p) have been related with the ammonium uptake [6]. Mep2p displays the highest affinity for NH4+ (Km 1.4–2.1 μM), followed closely by Mep1p (Km 5–10 μM) and finally by Mep3p, whose affinity is much lower (Km 1.4–2.1 mM) [6]. The MEP genes are also subject to nitrogen control. These genes are expressed when low ammonium concentrations are present in the growth medium, but at high concentration of a good nitrogen source (including ammonium) all three MEP genes are repressed. With a poor nitrogen source, MEP2 expression is much higher than MEP1 and MEP3 expression [6].

Despite major advances in characterising the genome of the yeast S. cerevisiae and numerous reports on the transcriptional regulation of individual genes in laboratory strains of this yeast, we have a limited understanding of the expression of genes in yeast during industrial fermentations [7]. Specifically, few data are available about the metabolism of nitrogen and its regulation in winemaking conditions, which are characterised by a high concentration of sugar and ethanol, a low content of assimilable nitrogen, a shortage of oxygen and a low pH. Our main objective in this study is an initial approach to study nitrogen regulation under these conditions. We monitored NCR during fermentations in synthetic grape juice with several nitrogen sources added in different concentrations. We also studied how NCR affects nitrogen uptake and fermentation kinetics.

2Materials and methods

2.1Strain, fermentations and sampling

The commercial wine strain S. cerevisiae QA23 (Lallemand S.A., Canada) was used in this study. Fermentations were carried out in a synthetic grape must (pH 3.3) as described by Riou et al. [8], but with 200 g l−1 of reduced sugars (100 g l−1 glucose and 100 g l−1 fructose) and without anaerobic factors. Only the nitrogen content changed in the different fermentations. The yeast-assimilable nitrogen (YAN) content in the control synthetic grape must (CNC) was 300 mg N l−1: ammoniacal nitrogen (NH4Cl) 120 mg N l−1 and amino acids 180 mg N l−1 (Table 1). The high- nitrogen content (HNC) and low-nitrogen content (LNC) conditions contained 4-fold (1200 mg l−1) and 1/5-fold (60 mg l−1) the YAN of the control must, respectively. The proportions of the different amino acids and ammonium were maintained in the HNC and LNC synthetic musts. Two extra fermentations with low nitrogen content (60 mg N l−1) were also carried out. In these fermentations, the nitrogen content was either amino acids (LNC-aas) or ammonium (LNC-NH4).

Table 1.  Content of amino acids and ammonium expressed as mg l−1 and mg N l−1 (YAN) in control synthetic grape must (CNC)
Amino acidmg l−1mg N l−1
Asp44.204.65
Glu119.6011.39
Ser78.0010.40
Gln499.2047.87
His33.803.05
Gly18.203.40
Thr75.408.87
Arg367.9029.60
Ala145.6022.90
Tyr19.501.51
Cis20.802.41
Val44.205.29
Met31.202.93
Trp174.2011.95
Phe37.703.20
Ile32.503.47
Leu48.105.14
Lys16.901.62
Pro599.30
Total aas1807.00179.66
Ammonia154.28120.00
Total YAN 299.66

Fermentations were done at room temperature (22–28 °C) in laboratory-scale fermenters: 2-litre bottles filled with 1.8 l medium and fitted with closures that enabled the carbon dioxide to escape and the samples to be removed. Fermentations were in semi-anaerobic conditions, since limited aeration was necessary in order to harvest samples for subsequent analysis. The final population inoculated in every flask was 2 × 107 cell ml−1 from dry yeast rehydrated in water at 37 °C.

Fermentations were monitored by the medium density. Residual sugars were determined by enzymatic kits (Roche Applied Science, Mannheim, Germany). Yeast cell biomass was determined by absorbance at 600 nm. Yeasts cells were harvested at different points of the fermentation for analysing mRNA and determining arginase activity. Yeast cells were also analysed before their inoculation in the fermentation media (time 0). The supernatant of these samples was stored at −20 °C for analysis of their nitrogen content.

2.2Analysis of nitrogen content

YAN was analysed by the formol index method [9], and the ammonium content was quantified using an enzymatic method (Roche Applied Science, Germany); both determinations were expressed as mg nitrogen ml−1. Analysis of individual amino and imino acids was determined by o-phthalaldehyde and g-fluorenylmethoxycarbonyl derivatizations, respectively, using the Agilent 1100 Series HPLC. The sample (2 μl) was injected into a 4.6 × 250 mm × 5 μm Hypersil ODS column (Agilent Technologies, Böblingen, Germany). The concentration of each amino acid was calculated using external and internal standards and expressed as mg l−1.

2.3Determination of arginase activity

Arginine degradation is first catalyzed by arginase yielding ornithine and urea. Arginase activity can be determinated by measuring an increase in the concentration of ornithine by the reaction with ninhydrin, known as the Chinard reaction [10]. This method has been widely used in animal tissues and has been developed in yeast by Carrasco et al. [11].

2.4Real-time quantitative PCR

Total RNA was isolated from yeast samples as described by Sierkstra et al. [12] and resuspended in 50 μl of diethyl pyrocarbonate-treated water. cDNA was synthesised from total RNA using SuperscriptTM II RNase H Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA) in a GenAmp PCR System 2700 (Applied Biosystems, Foster City, CA, USA). The protocol provided by the manufacturer was used.

The PCR primers used in this study are listed in Table 2. The real-time quantitative PCR reaction was performed using SYBR® Green I PCR (Applied Biosystems, USA). For each gene, a standard curve was made with serial 10-fold dilution of yeast genomic DNA, ranging from 4 to 4 × 10−5 ng μl−1. The starting quantity of the studied gene was calculated from the standard curve by interpolation, and normalized with actin gene, as housekeeping gene.

Table 2.  Primers used in this study (supplied by PE Applied Biosystems)
PrimerNucletide sequence (5 to 3)
ACT-FTGGATTCCGGTGATGGTGTT
ACT-RCGGCCAAATCGATTCTCAA
GAP1-FCTGTGGATGCTGCTGCTTCA
GAP1-RCAACACTTGGCAAACCCTTGA
MEP1-FCCTGAGCTCGCGTATGCA
MEP1-RGGCGCCAGCGATAATACTTAA
MEP2-FGGTATCATCGCTGGCCTAGTG
MEP2-RACAACGGCTGACCAGATTGG
MEP3-FGCCGGTGTGGTGGGATT
MEP3-RTTGTGCCGTCCATTCCAAT

In the PCR reaction, the final reaction volume was 25 μl, the final concentration of each primer was 300 nM, together with 1 μl of the cDNA previously synthesized from total RNA (or 5 μl of each DNA serial dilution for standard tubes). All PCR reactions were mixed in 96-well optical plates and cycled in a GeneAmp 5700 Sequence Detection System (Applied Biosystems, USA) under the following conditions: 50 °C for 2 min, 95 °C for 10 min, and 40 cycles at 95 °C for 15 s and at 60 °C for 60 s.

The threshold was positioned to intersect the exponential part of the amplification curve of positive reactions, as recommended by Applied Biosystems. The Ct value is inversely proportional to the log amount of template in the PCR reaction. All samples were analysed in duplicate and the expression values were averaged by the analysis software (Applied Biosystems, USA). The coefficient of variation in all samples analysed was less than 10 %.

3Results

3.1Fermentation kinetics and nitrogen consumption

Fermentations with a low (60 mg l−1; LNC) and a high nitrogen content (1200 mg l−1; HNC) were carried out with the commercial S. cerevisiae strain QA23. As a control, we used the same synthetic media with usual nitrogen content in natural grape musts (300 mg l−1; CNC). Media density and consumption of yeast assimilable nitrogen (YAN) and ammonium were monitored throughout these fermentations (Fig. 1). Fermentations were completed after 96, 120 and 240 h for the CNC, HNC and LNC fermentations, respectively. In the HNC fermentation, yeasts only consumed approximately 30% of the total YAN and 40% of the initial ammonium. Most of the assimilable nitrogen was consumed in the first 24 h of the three fermentations. Biomass production did not show any differences between the HNC and the CNC fermentations (maximum OD600=4.37 and 4.31, respectively) but it was significantly lower in the LNC fermentation (maximum OD600=3.85).

Figure 1.

Must density evolution and nitrogen consumption during control (CNC), high (HNC) and low (LNC) nitrogen content fermentations.

To check the importance of the nitrogen source, we complemented these results with two new fermentations. The synthetic grape must of these fermentations contained the same amount of YAN as in the LNC fermentation (60 mg l−1), but the mixture of ammonium and amino acids was replaced by only ammonium (LNC-NH4) or only amino acids (LNC-aas) (Fig. 2).

Figure 2.

Must density evolution and nitrogen consumption during low nitrogen content fermentations: mixture of ammonia and amino acids (LNC), only ammonia (LNC-NH4) and only amino acids (LNC-aas).

The extracellular amino acids were also determined at different points for all the fermentations. Table 3 shows the consumption of the amino acids and ammonium at the end of the CNC and HNC fermentations. The excess nitrogen in HNC fermentation decreased the proportion of uptake of some amino acids (represented by group A) and increased the consumption of others (represented by group C). Group B represented the amino acids that were taken up in similar proportions in both fermentations.

Table 3.  Consumption (expressed as mg l−1 and percentage of the total YAN consumed) of ammonia and amino acids at the end of the control nitrogen content (CNC) and high nitrogen content (HNC) fermentations
 Consumption (mg l−1)Consumption (%)RatioConsumption group
 CNCHNCCNCHNC  
  1. Ratio between HNC and CNC consumption (%) is also indicated. Nitrogen sources are grouped as: A, ratio < 1; B, ratio 1–2; C, ratio >2.

Amino acid
Asp27.1227.431.010.740.73A
Glu94.6418.643.540.500.14A
Ser68.60103.292.562.801.09B
Gln505.34526.4618.8914.250.75A
His32.6584.571.222.291.88B
Gly3.0211.120.110.302.67C
Thr80.74122.883.023.331.10B
Arg328.7111.2012.290.300.02A
Ala103.970.103.890.000.00A
Tyr9.6938.380.361.042.87C
Cis3.0155.340.111.5013.31C
Val31.5299.971.182.712.30C
Met24.1085.080.902.302.56C
Trp87.84184.883.285.001.52B
Phe31.91149.921.194.063.40C
Ile23.83120.880.893.273.67C
Leu43.1187.241.612.361.47B
Lys14.8161.770.551.673.02C
Total1514.611784.3656.6348.300.85 
Ammonia N116.00191.0043.3751.701.19B
Total YAN267.46369.44100.00100.001.00 

3.2Arginase activity

We determined the arginase activity of the yeast cells collected during the various fermentations (Fig. 3). As far as the nitrogen concentration is concerned (Fig. 3(a)), the excess nitrogen in the HNC fermentation prevented the activation of this enzyme (below 0.2 nmol μg protein−1 min−1 throughout the process). On the other hand, in the CNC and LNC fermentations, we detected the activation of this enzyme at the time that the ammonium was completely consumed. This fermentation point also matched with the beginning of the arginine uptake (data not shown).

Figure 3.

Arginase activity throughout (a) CNC, HNC and LNC fermentations and (b) LNC, LNC-NH4 and LNC-aas fermentations. Arginase activity was expressed as: nmol ornithine μg protein−1 min−1.

As far as the nitrogen source is concerned (Fig. 3(b)), the activity of arginase increased in the LNC-aas condition during the first few hours of fermentation. On the other hand, the lack of amino acids in the LNC-NH4 condition kept arginase activity low throughout the fermentation.

3.3GAP1 and MEPs gene expression

We analysed the transcriptional activity of GAP1, MEP1, MEP2 and MEP3 genes during the alcoholic fermentations under several nitrogen concentrations (Fig. 4). We combined the results of GAP1 and MEP2, because the level of expression and type of response were very similar and much higher than for MEP1 and MEP3.

Figure 4.

Relative gene expression of ammonia permeases (MEP1, MEP2, MEP3) and general amino acid permease (GAP1) at time zero (before inoculation) and at several fermentation points in all nitrogen conditions studied. The data were quantified by calculating the ratio between the concentration of the studied genes normalized with the concentration of the housekeeping gene (Actine), and expressed as percentage (the quantity ratio 1 was set as 100%). YAN and ammonia consumption along the fermentations are also indicated.

In the CNC and HNC fermentations, GAP1 and MEP2 were repressed in the first hours after the inoculation in the must-like media. On the other hand, both genes were activated/derepressed in the CNC fermentation when ammonia was depleted, even though the YAN concentration in the media was still high (81.2 mg l−1). In the fermentations with low nitrogen content (LNC), this repression after the inoculation was also observed but it was slower and not so strong as this one detected in the HNC and CNC fermentations. The lowest values of gene expression were detected in the three LNC fermentations from 12 to 18 h after inoculation. Afterwards, the expression level of these genes increased when nitrogen was depleted.

As mentioned above, MEP1 and MEP3 showed a lower level of gene expression than MEP2 (Fig. 4). MEP3 was repressed after the inoculation and this repression was quicker and stronger in the medium with high nitrogen content. The gene expression profile of MEP1 throughout the fermentation registered few changes. However, the highest repression in both genes was detected in the medium with low nitrogen content but without ammonium (LNC-aas).

4Discussion

A commercial wine yeast was inoculated in a synthetic grape must at several concentrations and sources of nitrogen. CNC fermentation could not be considered as nitrogen-limited because biomass and fermentation rate were very similar to those in the HNC fermentation. LNC fermentations were clearly nitrogen-limited, with a lower biomass production and a lower fermentation rate than the CNC fermentation. During the CNC and LNC fermentations, the cells evolved from a nitrogen-repressed situation at the beginning of the process to a nitrogen-derepressed situation as the nitrogen was consumed. Accordingly, the high concentration of nitrogen in the HNC fermentation maintained the nitrogen repression throughout the process. These nitrogen-repressed/derepressed conditions determined the different patterns of amino acid consumption. An NCR condition (as in the HNC fermentation) inhibited the arginine and alanine uptake and led to a lower consumption of glutamic acid, aspartic acid and glutamine. Arginine and alanine must be mainly transported by the general amino acid permease (Gap1p) or by other specific permeases also subjected to NCR. On the other hand, the consumption of branched-chain and aromatic amino acids was higher in the HNC fermentation, which might be explained by a stimulation of their specific permeases. The presence of some amino acids in the medium induced the transcription activity in the genes encoding the branched-chain amino acid permease Bap2p or the tyrosine and tryptophan permease Tat1p in ammonium-grown cells [5,13]. Branched-chain amino acids are the principal precursors of higher alcohols during wine fermentation, significant for the sensory properties of the wine. Therefore, the degree of uptake of these amino acids at the different nitrogen conditions may influence the production of fusel alcohols in the wine [7].

The ammonium uptake was higher in the HNC fermentation than in the CNC fermentation. This higher consumption of ammonium might also influence the production of glycerol [14], which is also an important metabolite in the composition of the wine. Curiously, the repression of the three MEP genes was stronger in the HNC fermentation than in the CNC fermentation. Marini et al. [6] have tried to explain this paradox by two possible hypotheses: either the yeast might possess additional NH4+ transport systems unrelated to the Mep proteins, or NH4+ at a high concentration might be taken up into cells by simple diffusion. Regarding the transcription profile of these genes, our results confirmed the highest transcription activity in MEP2 and its regulation by NCR [6]. The transcription profiles of MEP1 and MEP3 during fermentation did not respond to NCR as clearly as the transcription profile of MEP2 did. The absence of ammonium in the medium (LNC-aas fermentation) caused the strongest repression in MEP1 and MEP3 throughout the fermentation. Therefore, the extracellular ammonium may act as an inducer of the expression of these genes.

Recently, Carrasco et al. [11] have suggested that the argininase activity is a useful marker for the intracellular nitrogen shortage and a good indicator of the availability of nitrogen during wine fermentations. Our results showed that activation coincided with the beginning of arginine uptake. As already mentioned, this time point also coincided with ammonium depletion and GAP1 activation/derepression. That is, arginase activity could be considered as a good marker of the shift from a repressed to a derepressed nitrogen condition during alcoholic fermentation. However, this is only true when this amino acid is present in the medium.

The objective of this study was to apply the basic knowledge about nitrogen regulation to wine fermentation conditions by using a commercial wine yeast strain. The repression of GAP1 and MEP2 genes in the cells, low arginase activity, or inhibition of arginine uptake could be considered as a good NCR markers. Winemakers systematically supplement grape musts with diammonium phosphate to prevent nitrogen-related fermentation problems. Greater knowledge of this system should improve the control of nitrogen availability and addition during wine fermentations. A nitrogen-repressed condition throughout fermentation modifies the uptake of ammonium and amino acid and this different uptake may determine the production of important secondary metabolites. Moreover, a wine with an excess of nitrogen could be detrimental for the microbiological stability during ageing, storage or bottling.

Acknowledgements

This work was supported by grant AGL2000-0205-P4-03 from the Comisión Interministerial de Ciencia y Tecnología, Spain. The authors wish to thank the language service of the Rovira i Virgili University for revising the manuscript.

Ancillary