SEARCH

SEARCH BY CITATION

Keywords:

  • fat oxidation;
  • mitochondrial oxidative capacity;
  • insulin sensitivity;
  • SIRT1

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Research Methods and Procedures
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Appendix 1. Gene primer and probe sequences

Objective: Alternate day fasting may extend lifespan in rodents and is feasible for short periods in nonobese humans. The aim of this study was to examine the effects of 3 weeks of alternate day fasting on glucose tolerance and skeletal muscle expression of genes involved in fatty acid transport/oxidation, mitochondrial biogenesis, and stress response.

Research Methods and Procedures: Glucose and insulin responses to a standard meal were tested in nonobese subjects (eight men and eight women; BMI, 20 to 30 kg/m2) at baseline and after 22 days of alternate day fasting (36 hour fast). Muscle biopsies were obtained from a subset of subjects (n = 11) at baseline and on day 21 (12-hour fast).

Results: Glucose response to a meal was slightly impaired in women after 3 weeks of treatment (p < 0.01), but insulin response was unchanged. However, men had no change in glucose response and a significant reduction in insulin response (p < 0.03). There were no significant changes in the expression of genes involved in mitochondrial biogenesis or fatty acid transport/oxidation, although a trend toward increased CPT1 expression was observed (p < 0.08). SIRT1 mRNA expression was increased after alternate day fasting (p = 0.01).

Discussion: Alternate day fasting may adversely affect glucose tolerance in nonobese women but not in nonobese men. The gene expression results indicate that fatty acid oxidation and mitochondrial biogenesis are unaffected by alternate day fasting. However, the increased expression in SIRT1 suggests that alternate day fasting may improve stress resistance, a commonly observed feature of calorie-restricted rodents.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Research Methods and Procedures
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Appendix 1. Gene primer and probe sequences

Prolonged calorie restriction (CR)1 increases maximal lifespan in a variety of lower species including rodents, flies, worms, and yeast (1). Indeed, rodents restricted by 55% to 65% of voluntary food intake increased maximum lifespan by 35% to 65% (2). Other commonly observed features of calorie-restricted rodents are lower fasting glucose and insulin concentrations, improved insulin sensitivity, lower core body temperature, and reduced insulin-like growth factor I compared with control animals (3). Prolonged calorie restriction in rodents also alters the expression pattern of skeletal muscle genes involved in stimulating oxidative phosphorylation, fat oxidation, and stress resistance and reducing oxidative damage (4). This has been shown in a number of other tissues, including liver, brain, and adipose (5,6). Recent microarray results in mouse liver show that prolonged fasting (24 to 48 hours) mimics many of the gene expression changes observed during prolonged CR (7).

Alternate day fasting in rodents has been proposed as an alternative model to prolonged CR for increasing lifespan (8,9). Goodrick et al. (8) found that alternate day fasting increased median and maximal lifespan in C57Bl/6 mice when it was introduced at 1.5 and 6 months of age and increased maximal, but not median, lifespan in A/J mice. Recently, Anson et al. (9) re-sparked interest in this area by showing that mice fed every other day consumed the same total energy as ad libitum—fed animals and had similar body weights, but had greater resistance to endotoxic stress and reduced glucose and insulin concentrations, suggesting improved insulin sensitivity (9).

The mechanism/s through which CR increases lifespan are not fully understood. One proposed mechanism is that CR increases mitochondrial efficiency and reduces the production of reactive oxygen species. For example, prolonged CR delays the onset of age-related declines in mitochondrial size, number, and function in rodent skeletal muscle (10). Elderly human subjects and subjects with type 2 diabetes have reduced expression of genes involved in energy metabolism and mitochondrial protein synthesis (11) and reduced mitochondrial size and function (12). However, the effects of CR on mitochondrial function in humans are unclear. In obese subjects, citrate synthase and β-hydroxy acyl-CoA dehydrogenase (β-HAD) activities were unchanged by 8 weeks of CR (13). However, in another study of obese subjects, succinate dehydrogenase activity was increased after 20% weight loss when subjects were measured in a weight stable state (14). Another mechanism through which CR may extend lifespan is by increasing stress resistance. In rodents, CR increases the expression of Sir2, the mammalian homolog of SIRT1 (15). Sir2 is a histone deacetylase, and its proposed functions include stimulation of FOXO family of Forkhead transcription factors and prevention of the initiation of apoptosis in response to stress (15,16).

We recently reported the effects of 3 weeks of alternate day fasting on body weight and metabolic rate in nonobese humans (17). The protocol was well tolerated, weight loss was 2.5% of initial body weight, resting metabolic rate was unchanged, and fat oxidation, as measured by the respiratory quotient, was increased. This study was designed to expand our knowledge of the effects of alternate day fasting in nonobese humans on whole body carbohydrate metabolism and skeletal muscle expression of genes involved in energy metabolism and stress response.

Research Methods and Procedures

  1. Top of page
  2. Abstract
  3. Introduction
  4. Research Methods and Procedures
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Appendix 1. Gene primer and probe sequences

Subjects

Sixteen healthy, nonobese (BMI, 20.0 to 30.0 kg/m2) subjects, between 20 and 55 years of age, were recruited. Subjects had different levels of physical activity, with seven being sedentary, three being moderately active (exercise one to two times per week), and six being quite active (exercise three or more times per week). Subjects with type 2 diabetes were excluded. The Institutional Review Board of the Pennington Biomedical Research Center approved the study, and subjects gave their written informed consent.

Study Design

The details of the study design have been described (17), and a brief summary is provided. Subjects fasted from midnight to the subsequent midnight on alternating days for 22 days. On each fasting day, subjects were allowed to consume energy-free beverages, tea, coffee, and sugar-free gum. On each feasting day, subjects were informed that they could eat whatever they wished and that double their usual intake would be required to maintain body weight. Subjects attended the clinical research center on 2 consecutive days at baseline (days −2 and −1) and 2 consecutive days after 3 weeks of alternate day fasting after a feast day (day 21) and after a fast day (day 22). Subjects had, therefore, fasted 12 hours (overnight) on days −2, −1, and 21 and 36 hours on day 22. At each visit, subjects were weighed in a hospital gown, fasting blood was drawn, and resting metabolic rate and respiratory quotient were measured (SensorMedics, Yorba Linda, CA). A test meal (500 kcal, 12.2 grams fat, 80 grams carbohydrate, 17.6 grams protein, Ensure; Abbott Laboratories, Abbott Park, IL) was given on days −1 and 22. Two baseline blood samples were taken at −30 and 0 minutes before the meal and at 30-minute intervals for 90 minutes after the meal. A subset of subjects (n = 11, 6 women and 5 men) had a muscle biopsy of the vastus lateralis on days −2 and 21. Glucose was analyzed using a glucose oxidase electrode (Syncron CX7; Beckman, Brea, CA). Insulin was measured using an immunoassay on the DPC 2000 (Diagnostic Product Corp., Los Angeles, CA). Ghrelin was measured using a radioimmunoassay kit from Linco (St. Charles, MO).

Gene Expression

Vastus lateralis biopsy samples (50–100 mg) were taken after local anesthesia using the Bergstrom technique and were cleaned of blood and connective tissue before being snap frozen in liquid nitrogen and stored at −80 °C until completion of the study. RNA was isolated from ∼30 mg of tissue using the acid phenol method (18) and purified with RNeasy columns (Qiagen, Valencia, CA). Primer and probes (Appendix 1) were designed using Beacon Designer V2.1 (Biorad, Norwalk, CT) and were validated (http:www.ncbi.nlm.nih.govBLAST). The level of gene expression was measured using quantitative reverse transcriptase-polymerase chain reaction (RT-PCR; qPCR) on an Icycler (Biorad, Norwalk, CT). Briefly, 20 ng of RNA was added to 2× Taq-man One-Step RT-PCR Master Mix (Applied Biosystems, Foster City, CA) containing Taqman oligonucleotide probe (1 μm, Biosearch Technologies, Novato, CA), and forward and reverse primers (1 μM) in a 25-μL reaction. Step 1 included a 30-minute reverse transcription stage at 48 °C and 95 °C for 10 minutes and then 40 cycles at 95 °C for 15 seconds and 60 °C for 60 seconds. The cyclic threshold value for every sample was measured in duplicate and was normalized to cyclophillin B.

Mitochondrial Oxidative Capacity

Relative amounts of mitochondrial DNA (mtDNA) and nuclear DNA (nDNA) were determined by qPCR as previously described (19) (I. Bogacka and S. R. Smith, personal communication). Briefly, NADH dehydrogenase subunit 1 (ND1) gene was selected for quantification of mtDNA. The PCR product was inserted into plasmid pCRII according to the manufacturer's protocol (Invitrogen, Carlsbad, CA), and a standard curve was generated. The quantification assay was performed in a total volume of 50 μL containing DNA template, 10× buffer A, 25 mM MgCl2, dNTP, AMPErase UNG, and AmpliTaq Gold DNA polymerase. The PCR was initiated for 2 minutes at 50 °C, followed by 10 minutes at 95 °C and 40 cycles of 15 seconds at 95 °C and 1 minute at 60 °C. Nuclear DNA (lipoprotein lipase) was also amplified and cloned to the plasmid as described above, and the ratio of mtDNA to nDNA reflects the number of mitochondria per cell. Approximately 30 to 50 mg of skeletal muscle was weighed, and a 10% wt:vol homogenate was made using a homogenating media containing 0.175 mM KCl and 2.0 mM EDTA (pH = 7.4). Citrate synthase and β-HAD activities were determined spectrophotometrically from the homogenates using previously described methods (20,21). Briefly, citrate synthase activity was measured at 37 °C in 0.1 M Tris-HCl (pH 8.3) assay buffer containing 0.12 mM 5, 5′-dithio-bis (2-nitrobenzoic acid) and 0.6 mM oxaloacetate. After an initial 2-minute absorbance reading taken at 412 nm, the reaction was initiated with the addition of 3.0 mM acetyl-CoA, and the change in absorbance was measured every 10 seconds for 7 minutes. β-HAD activity was measured at 37 °C in assay buffer containing 0.1 M triethanolamine-HCl, 5 mM EDTA, and 0.45 mM NADH (pH 7.0). After an initial 1-minute absorbance reading at 340 nm, the reaction was initiated with the addition of 0.1 mM acetoacetyl-CoA, and the change in absorbance was measured every 10 seconds for 5 minutes.

Statistical Analysis

Data are expressed as means ± SE and were considered significant if p < 0.05 by SPSS (Windows 11.0.1). Differences from baseline were measured by one-way ANOVA, with the initial value as a covariate in the model. Correlations were performed with Pearson's correlation coefficient. Fasting insulin that was below the detection limit of the assay (< 2.0 μU/mL) was assigned a value of 1.0 μU/mL. Insulin was log-transformed for analysis. Area under the curve was calculated (22).

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Research Methods and Procedures
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Appendix 1. Gene primer and probe sequences

Baseline characteristics of subjects are described in Table 1. As previously reported, average weight loss was 2.1 ± 0.3 kg, indicating that subjects could not consume enough calories on feasting days to maintain body weight. A significant time-by-sex interaction was observed in the glucose and insulin response to a meal (p = 0.04). Further analysis revealed that women cleared glucose less efficiently after alternate day fasting (Figure 1A), whereas men had no change in glucose clearance. In support of this, area under the glucose curve was increased in women (419 ± 16 to 483 ± 14, p = 0.006) and was unchanged in men (470 ± 14 to 480 ± 22, p = not significant). The insulin response to a meal was not influenced by alternate day fasting in women but was reduced in men (area under the curve: 207 ± 38 to 130 ± 15, p < 0.03; Figure 1B), suggesting improved insulin sensitivity. Serum ghrelin was suppressed in response to the test meal at baseline and after alternate day fasting (p = 0.01; Figure 1C). However, ghrelin suppression was not significantly influenced by 3 weeks of alternate day fasting.

Table 1. . Baseline characteristics of participants by sex
 MenWomen
  • Data is given as means ± SE.

  • *

    p < 0.01.

N88
Age (y)34 ± 330 ± 1
Weight (kg)80.6 ± 4.459.7 ± 1.7*
BMI (kg/m2)25.2 ± 1.122.6 ± 0.6
Fat (%)22 ± 225 ± 1
Glucose (mM)5.4 ± 0.15.0 ± 0.1*
Insulin (μU/mL)10.5 ± 2.14.9 ± 0.6*
   
image

Figure 1. (A) Glucose, (B) insulin, and (C) ghrelin responses to a liquid mixed meal (500 kcal) at baseline (pre) and after alternate day fasting (post). A significant time (minutes)-by-sex effect was observed in response to the meal for each analyte measured (p < 0.001). *Significance (p < 0.05) between pre- and post-response for a particular time-point. Data are given as means ± SE.

Download figure to PowerPoint

The expression levels of genes involved in fatty acid transport or oxidation (β-HAD, FAT/CD36, PDK4, CPT1, UCP3) were not significantly altered from baseline (Figure 2A), although a trend toward increased expression of CPT1 was observed (p < 0.08). No changes were observed in the expression of genes involved in mitochondrial biogenesis (PGC1α, NRF1, Cyt C; Figure 2B). However, alternate day fasting significantly increased expression of SIRT1 (Figure 2C; p = 0.01), independently of sex. Citrate synthase activity and β-HAD activity were not altered by the intervention (73.8 ± 8.0 vs. 60.2 ± 0.4 μm mol/mg protein/min and 122.1 ± 11.8 vs. 120.5 ± 11.2 μm mol/mg protein/min, respectively). However, a trend toward reduced mtDNA copy number was observed (640 ± 89 vs. 534 ± 64 arbitrary units, p = 0.09). At baseline and after alternate day fasting, β-HAD activity was significantly related to mtDNA copy number (r = 0.846, p = 0.001 and r = 0.805, p = 0.003, respectively), and a strong correlation was observed also between percentage weight loss and the change in mtDNA copy number (r = 0.748, p = 0.008) and the change in β-HAD activity (r = 0.749, p = 0.008).

image

Figure 2. Pre- and post-effects of alternate day fasting on skeletal muscle expression of (A) genes involved in fatty acid uptake and oxidation, (B) genes involved in oxidative phosphorylation, and (C) SIRT1 mRNA gene expression. *p = 0.01.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Research Methods and Procedures
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Appendix 1. Gene primer and probe sequences

Whether prolonged CR increases life span in nonobese humans is unclear. Recently, Fontana et al. (23) compared 18 individuals who had been practicing CR for an average of 6 years to a healthy normal-weight control population. The calorie-restricted group had much lower risk factors for cardiovascular disease (including blood pressure, blood lipids, and carotid artery intramedial thickness). Alternate day fasting is postulated as an alternative method to prolonged CR for increasing lifespan in rodents (9). In nonobese humans, alternate day fasting for 3 weeks was well tolerated and resulted in minor weight losses and increased fat oxidation as measured by indirect calorimetry (23). In this study, we investigated the effects of 3 weeks of alternate day fasting on carbohydrate metabolism and skeletal muscle expression of genes involved in fatty acid transport/oxidation, carbohydrate oxidation, mitochondrial biogenesis, and stress response.

Prolonged (72 hours) fasting elevates the glucose and insulin response to an oral glucose load, indicating the manifestation of insulin resistance (24,25). Furthermore, both an impaired suppression of hepatic glucose production (25) and reduced whole body glucose disposal are observed (26). We observed that serum glucose clearance after a liquid meal worsened in women after alternate day fasting, but glucose response was unchanged in men. Furthermore, the insulin response to the meal was improved in men, suggesting that insulin sensitivity may be increased and not decreased after alternate day fasting. Alternate day fasting in rodents was previously shown to be genotype-specific and possibly differ between males and females (8). Indeed, A/J mice who were introduced to the protocol at 10 months of age actually displayed increased mortality. Thus, it is possible that men and women will respond differently to alternate day fasting and that this type of diet may adversely affect insulin sensitivity in women. However, more stringent measures of insulin sensitivity (such as the hyperinsulinemic glucose clamp) must be performed before definitive conclusions can be drawn.

The effect of alternate day fasting on ghrelin response to a meal was also investigated. Ghrelin, a peptide secreted in the gut, has been implicated in the regulation of feeding behavior and energy balance (27). Meal-related suppression and the nocturnal rise in ghrelin are impaired in obese subjects compared with lean subjects (28,29). In this study, meal-related ghrelin suppression was unchanged after alternate day fasting. Recently, portion size (7.5%, 16%, and 33% of predicted total energy expenditure) was shown to affect the nadir in ghrelin response to a meal, with reductions of 20%, 28%, and 40%, respectively (30). In this study, all subjects were given a 500-kcal liquid meal. Ghrelin was suppressed 17% in women and 12% in men. This suppression was smaller than expected, given that this meal size represented ∼15% to 25% of daily energy requirements. Similar to our findings, however, 72 hours of fasting did not change the 24-hour diurnal rhythm of ghrelin in humans (31). These results call into question the role of ghrelin in initiating hunger drive.

In rodents, prolonged CR alters the expression of many genes in skeletal muscle, including increasing the expression of heat shock proteins, uncoupling proteins, and genes involved in mitochondrial biogenesis, fat oxidation, and oxidative damage (4). Recent microarray results in mouse liver suggest that fasting elicits a similar response (7). In humans, several genes involved in fatty acid transport or oxidation (e.g., FAT/CD36, β-HAD, PDK4, CPT1) are substantially up-regulated in response to 24 to 48 hours of fasting (32,33,34). However, in this study, alternate day fasting did not change expression of these genes. This suggests that protein concentration and/or activity was sufficient to cope with the metabolic effects of alternate day fasting. On the other hand, we did observe a trend for increased CPT1 expression, indicating that the duration of the intervention or sample size may have been insufficient. Alternatively, the study design may have masked the true effects of alternate day fasting on fatty acid transport and oxidation. This is because macronutrient content and meal sizes were not controlled on feasting days, and most subjects anecdotally reported binging to a greater extent than usual before their second biopsy, knowing that they were about to enter a longer than usual fasting day. The effects of refeeding after fasting are reported to be highly variable between subjects and with the type of meal consumed (34). For example, UCP3 expression was elevated after fasting and was reduced to basal within 1 hour of refeeding a high carbohydrate meal, but remained elevated after consumption of a high-fat meal (34).

We also hypothesized that mitochondrial biogenesis would be stimulated after alternate day fasting. Possible mechanism/s for this include alterations in energy-sensing pathways in the cell, i.e., increasing the adenosine monophosphate (AMP)/adenosine 5′-triphosphate ratio activating AMP-activated protein kinase (35), or through the hexosamine biosynthesis pathway (36). Indeed, there is some evidence to suggest that AMP-activated protein kinase directly stimulates NRF1 and PGC1α expression (37,38). In this study, alternate day fasting did not change PGC1α, NRF1, or cytochrome C expression. Furthermore, citrate synthase and β-HAD activity were not changed in response to alternate day fasting. Surprisingly, a trend toward reduced mitochondrial copy number was observed. Importantly, the decrease in mitochondrial copy number was proportional to weight loss. This decrease in the number of mitochondria was also reflected through the relationship between weight loss and β-HAD activity. These results suggest that CR may reduce mitochondrial number in nonobese subjects. To our knowledge, the effects of CR on mtDNA copy number have not previously been studied, and the question remains as to whether mtDNA copy number is actually a marker of mitochondrial function. Wang et al. (39) observed an association among copy number, citrate synthase activity, and Vo2max, suggesting that copy number is a surrogate for mitochondrial oxidative capacity. In this study, we also observed that β-HAD activity was strongly related to mtDNA copy number.

Sirt1 has been proposed as a key regulator of many cellular processes. For example, Sirt1 deacetylates key lysine residues of Ku70 preventing the translocation of Bax to the mitochondria, which would otherwise initiate apoptosis (40). Sirt1 also inhibits the forkhead transcription family of genes, altering insulin signaling pathways, promoting resistance to oxidative stress, and reducing apoptosis (16). Sir2 activity is up-regulated in yeast after CR and is required for the increased lifespan effect of CR (41). In rodents, the expression of SIRT1 was recently shown to increase in response to prolonged CR in fat, liver, kidney, and brain tissue (15). Furthermore, 293T human cells treated with rodent CR serum had increased SIRT1 expression. Interestingly, the addition of insulin-like growth factor I and insulin to the CR serum attenuated the increase in SIRT1 expression in these cells (15). Because alternate day fasting is also implicated in increasing lifespan, we studied whether SIRT1 expression would be up-regulated after 3 weeks of treatment. As hypothesized, we observed an increase in SIRT1 expression. We did not test for increased stress resistance in this study, and the rationale for reduced mtDNA number despite increased SIRT1 expression is unclear and requires further study. However, there are many mechanisms of actions of SIRT1, and it is possible that SIRT1 targets may be different between tissues. Furthermore, the alternate day fasting protocol was implemented for only 3 weeks, and thus, long-term outcomes of increased SIRT1 in humans are unknown.

In conclusion, alternate day fasting had minimal effect on insulin sensitivity in nonobese subjects. The gene expression results suggest that fatty acid oxidation may be up-regulated by alternate day fasting, but oxidative phosphorylation was not affected. SIRT1 expression was up-regulated, supporting rodent evidence that alternate day fasting may be an alternative mechanism for prolonged CR to increase lifespan. However, the number of mitochondria per cell may be initially decreased after weight loss in nonobese humans.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Research Methods and Procedures
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Appendix 1. Gene primer and probe sequences

The authors thank the Pennington clinical research staff for assistance in performing this study and Lauren Sparks for designing some of the primer probes sets for gene analysis. This study was supported, in part, by NIH Grant U01AG20478 (L.K.H. and E.R.) and a Pennington divisional grant (L.K.H.).

Footnotes
  • 1

    Nonstandard abbreviations: CR, calorie restriction; β-HAD, β-hydroxy acyl-CoA dehydrogenase; RT-PCR, reverse transcriptase-polymerase chain reaction; qPCR, quantitative reverse transcriptase-polymerase chain reaction; mtDNA, mitochondrial DNA; nDNA, nuclear DNA; AMP, adenosine monophosphate.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Research Methods and Procedures
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Appendix 1. Gene primer and probe sequences
  • 1
    Weindruch, R., Walford, R. L. (1982) Dietary restriction in mice beginning at 1 year of age: effect on life-span and spontaneous cancer incidence. Science. 215: 14151418.
  • 2
    Weindruch, R., Walford, R. L., Fligiel, S., Guthrie, D. (1986) The retardation of aging in mice by dietary restriction: longevity, cancer, immunity and lifetime energy intake. J Nutr. 116: 641654.
  • 3
    Roth, G. S., Ingram, D. K., Lane, M. A. (2001) Caloric restriction in primates and relevance to humans. Ann N Y Acad Sci. 305315.
  • 4
    Lee, C. K., Klopp, R. G., Weindruch, R., Prolla, T. A. (1999) Gene expression profile of aging and its retardation by caloric restriction. Science. 13901393.
  • 5
    Higami, Y., Pugh, T. D., Page, G. P., Allison, D. B., Prolla, T. A., Weindruch, R. (2004) Adipose tissue energy metabolism: altered gene expression profile of mice subjected to long-term caloric restriction. FASEB J. 18: 415417.
  • 6
    Weindruch, R., Kayo, T., Lee, C. K., Prolla, T. A. (2002) Gene expression profiling of aging using DNA microarrays. Mech Ageing Dev. 177193.
  • 7
    Bauer, M., Hamm, A. C., Bonaus, M., et al. (2004) Starvation response in mouse liver shows strong correlation with lifespan prolonging processes. Physiol Genom. 17: 230244.
  • 8
    Goodrick, C. L., Ingram, D. K., Reynolds, M. A., Freeman, J. R., Cider, N. (1990) Effects of intermittent feeding upon body weight and lifespan in inbred mice: interaction of genotype and age. Mech Ageing Dev. 55: 6987.
  • 9
    Anson, R. M., Guo, Z., de Cabo, R., et al. (2003) Intermittent fasting dissociates beneficial effects of dietary restriction on glucose metabolism and neuronal resistance to injury from calorie intake. Proc Natl Acad Sci U S A. 100: 62166220.
  • 10
    Bua, E., McKiernan, S. H., Aiken, J. M. (2004) Calorie restriction limits the generation but not the progression of mitochondrial abnormalities in aging skeletal muscle. FASEB J. 18: 582584.
  • 11
    Welle, S., Brooks, A. I., Delehanty, J. M., Needler, N., Thornton, C. A. (2003) Gene expression profile of aging in human muscle. Physiol Genom. 14: 149159.
  • 12
    Petersen, K. F., Befroy, D., Dufour, S., et al. (2003) Mitochondrial dysfunction in the elderly: possible role in insulin resistance. Science. 300: 11401142.
  • 13
    Kempen, K. P., Saris, W. H., Kuipers, H., Glatz, J. F., Van Der Vusse, G. J. (1998) Skeletal muscle metabolic characteristics before and after energy restriction in human obesity: fibre type, enzymatic beta-oxidative capacity and fatty acid-binding protein content. Eur J Clin Invest. 28: 10301037.
  • 14
    Kern, P. A., Simsolo, R. B., Fournier, M. (1999) Effect of weight loss on muscle fiber type, fiber size, capillarity, and succinate dehydrogenase activity in humans. J Clin Endocrinol Metab. 84: 41854190.
  • 15
    Cohen, H. Y., Miller, C., Bitterman, K. J., et al. (2004) Calorie restriction promotes mammalian cell survival by inducing the SIRT1 deacetylase. Science. 305: 390392.
  • 16
    Brunet, A., Sweeney, L. B., Sturgill, J. F., et al. (2004) Stress-dependent regulation of FOXO transcription factors by the SIRT1 deacetylase. Science. 303: 20112015.
  • 17
    Heilbronn, L. K., Smith, S. R., Martin, C. K., Anton, S. D., Ravussin, E. (2005) Alternate-day fasting in nonobese subjects: effects on body weight, composition, and energy metabolism. Am J Clin Nutr. 81: 6973.
  • 18
    Chomczynski, P., Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate- phenol-chloroform extraction. Anal Biochem. 156159.
  • 19
    He, L., Chinnery, P. F., Durham, S. E., et al. (2002) Detection and quantification of mitochondrial DNA deletions in individual cells by real-time PCR. Nucl Acids Res. 30: e68e74.
  • 20
    Srere, P. A. (1969) Citrate synthase. Meth Enzymol. 13: 326.
  • 21
    Bass, A., Brdiczka, D., Eyer, P., Hofer, S., Pette, D. (1969) Metabolic differentiation of distinct muscle types at the level of enzymatic organization. Eur J Biochem. 10: 198206.
  • 22
    Wolever, T. M., Jenkins, D. J., Jenkins, A. L., Josse, R. G. (1991) The glycemic index: methodology and clinical implications. Am J Clin Nutr. 54: 846854.
  • 23
    Fontana, L., Meyer, T. E., Klein, S., Holloszy, J. O. (2004) Long-term calorie restriction is highly effective in reducing the risk for atherosclerosis in humans. Proc Natl Acad Sci U S A. 101: 66596663.
  • 24
    Shashkin, P. N., Huang, L. C., Larner, J., Vandenhoff, G. E., Katz, A. (2002) Fasting decreases the content of D-chiroinositol in human skeletal muscle. Int J Exp Diabetes Res. 3: 163169.
  • 25
    Fery, F., D'Attellis, N. P., Balasse, E. O. (1990) Mechanisms of starvation diabetes: a study with double tracer and indirect calorimetry. Am J Physiol. 259: E770E777.
  • 26
    Castillo, C. E., Katz, A., Spencer, M. K., Yan, Z., Nyomba, B. L. (1991) Fasting inhibits insulin-mediated glycolysis and anaplerosis in human skeletal muscle. Am J Physiol. 261: E598E605.
  • 27
    Druce, M. R., Small, C. J., Bloom, S. R. (2004) Minireview: gut peptides regulating satiety. Endocrinology. 145: 26602665.
  • 28
    English, P. J., Ghatei, M. A., Malik, I. A., Bloom, S. R., Wilding, JPH (2002) Food fails to suppress ghrelin levels in obese humans. J Clin Endocrinol Metab. 87: 2984
  • 29
    Yildiz, B. O., Suchard, M. A., Wong, M-L, McCann, S. M., Licinio, J. (2004) Alterations in the dynamics of circulating ghrelin, adiponectin, and leptin in human obesity. Proc Natl Acad Sci U S A. 101: 1043410439.
  • 30
    Callahan, H. S., Cummings, D. E., Pepe, M. S., Breen, P. A., Matthys, C. C., Weigle, D. S. (2004) Postprandial suppression of plasma ghrelin level is proportional to ingested caloric load but does not predict intermeal interval in humans. J Clin Endocrinol Metab. 89: 13191324.
  • 31
    Chan, J. L., Bullen, J., Lee, J. H., Yiannakouris, N., Mantzoros, C. S. (2004) Ghrelin levels are not regulated by recombinant leptin administration and/or three days of fasting in healthy subjects. J Clin Endocrinol Metab. 89: 335343.
  • 32
    Spriet, L. L., Tunstall, R. J., Watt, M. J., Mehan, K. A., Hargreaves, M., Cameron-Smith, D. (2004) Pyruvate dehydrogenase activation and kinase expression in human skeletal muscle during fasting. J Appl Physiol. 96: 20822087.
  • 33
    Samec, S., Seydoux, J., Russell, A. P., Montani, J. P., Dulloo, A. G. (2002) Skeletal muscle heterogeneity in fasting-induced upregulation of genes encoding UCP2, UCP3, PPARgamma and key enzymes of lipid oxidation. Pflugers Arch. 445: 8086.
  • 34
    Pilegaard, H., Saltin, B., Neufer, P. D. (2003) Effect of short-term fasting and refeeding on transcriptional regulation of metabolic genes in human skeletal muscle. Diabetes. 52: 657662.
  • 35
    Hardie, D. G. (2003) Minireview: the AMP-activated protein kinase cascade: the key sensor of cellular energy status. Endocrinology. 144: 51795183.
  • 36
    Obici, S., Rosetti, L. (2003) Minireview: nutrient sensing and the regulation of insulin action and energy balance. Endocrinology. 144: 51725178.
  • 37
    Bergeron, R., Ren, J. M., Cadman, K. S., et al. (2001) Chronic activation of AMP kinase results in NRF-1 activation and mitochondrial biogenesis. Am J Physiol Endocrinol Metab. 281: E1340E1346.
  • 38
    Zong, H., Ren, J. M., Young, L. H., et al. (2002) AMP kinase is required for mitochondrial biogenesis in skeletal muscle in response to chronic energy deprivation. Proc Natl Acad Sci U S A. 99: 1598315987.
  • 39
    Wang, H., Hiatt, W. R., Barstow, T. J., Brass, E. P. (1999) Relationships between muscle mitochondrial DNA content, mitochondrial enzyme activity and oxidative capacity in man: alterations with disease. Eur J Appl Physiol Occup Physiol. 80: 2227.
  • 40
    Cohen, H. Y., Lavu, S., Bitterman, K. J., et al. (2004) Acetylation of the C terminus of Ku70 by CBP and PCAF controls Bax-mediated apoptosis. Mol Cell. 13: 627638.
  • 41
    Lin, S-J, Defossez, P-A, Guarente, L. (2000) Requirement of NAD and SIR2 for life-span extension by calorie restriction in Saccharomyces cerevisiae. Science. 289: 21262128.

Appendix 1. Gene primer and probe sequences

  1. Top of page
  2. Abstract
  3. Introduction
  4. Research Methods and Procedures
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Appendix 1. Gene primer and probe sequences
GeneSense Primer (5′–3′)Probe (5′-FAM-BHQ1-′3)Antisense Primer (5′–3′)
  1. SIRT1, silent information repressor T1; PDK4, pyruvate dehydrogenase kinase-4; CD36, FAT/CD36 transport protein; CPT1, carnitine palmitoltransferease-1; β-HAD, β-hydroxy acyl-CoA dehydrogenase; UCP3, uncoupling protein 3; Cyt C, Cytochrome c; PGC1α, peroxisome proliferator-activated (PPAR)-gamma coactivator-1; NRF1, nuclear respiratory factor-1; ND1, NADH dehydrogenase subunit 1; LPL, lipoprotein lipase.

Cyclophilin BGCC ATG GAG CGC TTT GGTCC AGG AAT GGC AAG ACC AGC AAG ACCA CAG TCA GCA ATG GTG ATC
SIRT1TACGACGAAGACGACGACGACGCCGCCGCCGCCTCTTCCAAGGTTATCTCGGTACCCAATCG
PDK4GAGAATTATTGACCGCCTCTTTAGACT CCA CTG CAC CAA CGC CTG TGAAAACCAGCCAAAGGAGCATTC
CD36AGT CAC TGC GAC ATG ATT AAT GGTCAG ATG CAG CCT CAT TTC CAC CTT TTGCTG CAA TAC CTG GCT TTT CTC A
CPT1GAG GCC TCA ATG ACC AGA ATGCAG TCT CAG TCC GTC CCT CCC GGGTG GAC TCG CTG GTA CAG GAA
βHADTGG CTT CCC GCC TTG TCCGC CAT ACA GAT CCA CAA AGC GGA ATTG AGC CGG TCC ACT ATC TTC
UCP3CCA TCC AGG AGC GAC AGA AAACA GCG GGA CTA TGG ACG CCT ACACCT CCC TGG CGA TGG TT
Cyt CGCC ATG GAG CGC TTT GGTCC AGG AAT GGC AAG ACC AGC AAG AATC CTT GGC TAT CTG GGA CAT G
PGC1αTCC TCT TCA AGA TCC TGC TAT TACAAG CCA CTA CAG ACA CCG CAC GCACCA CAG TCA GCA ATG GTG ATC
NRF1CGT TGC CCA AGT GAA TTA TTC TGTTG TTC CAC CTC TCC ATC AGC CACCC TGT AAC GTG GCC CAA T
ND1CCC TAA AA CCC GCC ACA TCTCCA TCA CCC TCT ACA TCA CCG CCGAG CGA TGG TGA GAG CTA AGG T
LPLCGA GTC GTC TTT CTC CTG ATG ATACA TTC ACC AGA GGG TCTTC TGG ATT CCA ATG CTT CGA