11β-Hydroxysteroid Dehydrogenase Type 1 mRNA is Increased in Both Visceral and Subcutaneous Adipose Tissue of Obese Patients

Authors


  • The costs of publication of this article were defrayed, in part, by the payment of page charges. This article must, therefore, be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Inserm U626, Faculté de Médecine, 27 Bd Jean Moulin, 13385 Marseille Cedex 5, France. E-mail: Michel.Grino@medecine.univ-mrs.fr

Abstract

Objective: Data from rodents provide evidence for a causal role of 11β-hydroxysteroid dehydrogenase type 1 (11β-HSD-1) in the development of obesity and its complications. In humans, 11β-HSD-1 is increased in subcutaneous adipose tissue (SAT) of obese patients, and higher adipose 11β-HSD-1 was associated with features of the metabolic syndrome. To date, there is no evidence for an increased expression of 11β-HSD-1 in human visceral adipose tissue (VAT), although VAT is the major predictor for insulin resistance and the metabolic syndrome.

Research Methods and Procedures: 11β-HSD-1 and hexose-6-phosphate dehydrogenase (the enzyme responsible for the synthesis of nicotinamide adenine dinucleotide phosphate, the cofactor required for 11β-HSD-1 oxoreductase activity) mRNA levels were measured using real-time quantitative reverse transcriptase-polymerase chain reaction in abdominal SAT and VAT biopsies obtained from 10 normal-weight and 12 obese women. Adiponectin mRNA was used as an internal control.

Results: 11β-HSD-1 mRNA concentrations were significantly increased in both SAT and VAT of obese patients (720% and 450% of controls, respectively; p < 0.05) and correlated with hexose-6-phosphate dehydrogenase mRNA levels. The level of VAT 11β-HSD-1 mRNA correlated with anthropometric parameters: BMI (r = 0.41, p = 0.05), waist circumference (r = 0.44, p = 0.04), abdominal sagittal diameter (r = 0.51, p = 0.02), and percentage fat (r = 0.51, p = 0.02).

Discussion: Our results demonstrate for the first time that 11β-HSD-1 mRNA expression is increased in VAT from obese patients. They strengthen the importance of 11β-HSD-1 in human obesity and its associated complications and suggest the need of clinical studies with specific 11β-HSD-1 inhibitors.

Introduction

11β-Hydroxysteroid dehydrogenase type 1 (11β-HSD-1)1 is a bidirectional enzyme that catalyzes in vivo the conversion of cortisone to cortisol and, as a consequence, plays a pivotal role in determining local active glucocorticoid concentrations (1). Data from rodents provide evidence for a causal role of 11β-HSD-1 in the development of obesity and its complications (2, 3). We and others have reported that 11β-HSD-1 activity and mRNA levels are increased in subcutaneous adipose tissue (AT) (SAT) of obese patients (4, 5). In addition, higher SAT 11β-HSD-1 has been associated with features of the metabolic syndrome (6). However, the importance of 11β-HSD-1 in human obesity remains debated because, although visceral AT (VAT) is the major predictor for insulin resistance and the metabolic syndrome, there is no direct evidence for an increased expression of 11β-HSD-1 in human VAT, and results obtained in SAT cannot be extrapolated to VAT. In addition, Tomlinson et al. (7) have reported that 11β-HSD-1 mRNA levels were comparable between SAT and VAT and did not correlate with BMI. We measured 11β-HSD-1 mRNA levels in paired SAT and VAT biopsies obtained from clinically and biologically well-defined lean or obese women. We also studied the expression of the mRNA coding for hexose-6-phosphate dehydrogenase (H6PDH). Indeed, H6PDH is a rate-limiting enzyme, colocalized with 11β-HSD-1 in the endoplasmic reticulum, that regulates, through the generation of nicotinamide adenine dinucleotide phosphate from NADP+, 11β-HSD-1 oxoreductase activity (8). Finally, measurement of the mRNA coding for adiponectin, an adipokine known to be down-regulated in both SAT and VAT of obese patients (9), was used as an internal control.

Research Methods and Procedures

Subjects

The study was conducted in accordance with the guidelines proposed in The Declaration of Helsinki and approved by the local hospital ethics committee. All patients gave their informed consent. Twenty-two normally cycling women, between 23 and 50 years of age, with no endocrine, cardiovascular, hepatic, or systemic disease were investigated: 10 normal-weight (BMI = 21.1 ± 0.7 kg/m2) and 12 obese (BMI = 37.9 ± 1.5 kg/m2) women. Patients who were taking corticosteroids, oral contraceptives, or psychotropic drugs were excluded. All of the patients were not prepared with any special diet. Percentage body fat was assessed by impedancemetry. Abdominal superficial SAT biopsies were obtained, irrespectively of the menstrual cycle phase, within 1 minute after the beginning of a laparotomy (four controls and three obese patients) or a laparoscopy, between 9 am and 2 pm for both groups, for gastroplasty or for non-infectious, non-tumoral gynecological disease; paired VAT biopsies were obtained 5 to 10 minutes later. Tissues were frozen on dry ice and stored at −70 °C.

Analytical Measurements

Fasting glycemia, total and high-density lipoprotein (HDL)-cholesterol, and triglycerides were measured using automatized enzymatic assays (Vitros; Ortho-Clinical Diagnostics, Inc., Rochester, NY); coefficients of variation were 0.60%, 0.77%, and 0.88%, respectively. Circulating insulin and plasminogen activator inhibitor 1 (PAI-1) levels were measured using an immunoradiometric assay (Sanofi-Pasteur Diagnostics, France) or an in-house enzyme-linked immunosorbent assay, respectively; coefficients of variation were 4.0% and 9.8%, respectively.

Reverse Transcriptase-Polymerase Chain Reaction

All of the samples were analyzed simultaneously for a given gene. One microgram of RNA was reverse transcribed and amplified for 40 cycles on an ABI Prism 7000 using the 2× Sybr-green I Master Mix (Applied Biosystems, Foster City, CA). Relative quantification (Δct) was obtained by normalization against the ribosomal 18S (Δct = ct target gene − ct 18S) and expressed as arbitrary units [2−(Δct) × 1011]. Oligonucleotide primers were: 11β-HSD-1, forward, AGTGTCCAGGGTCAATGTATCAATC and reverse, AACTGCCTTCATGGCTGTTTCT; adiponectin, forward, GGGCATCCGGGCCATA and reverse, GTTTCACCGATGTC-TCCCTTAGG; and H6PDH, forward, GTGGACCATTACTTAGGCAAGCA and reverse, CACGGTCTCTTTCATGATGATCTC.

Statistical Analysis

All data were analyzed using the Statview analysis program (Abacus Concepts, Piscataway, NJ). Baseline measurements were analyzed using the unpaired Student's t test. We used the Mann-Whitney U test to compare mRNA expression between lean and obese patients and the paired Wilcoxon test to compare mRNA expression between SAT and VAT. Correlations between anthropometric and biological data and mRNAs measurements were performed using the Spearman test.

Results

Table 1 shows the anthropometric and biochemical characteristics of the subjects. Fasting glycemia and total cholesterol were not statistically different between groups. Fat mass, waist-to-hip ratio, abdominal sagittal diameter, blood pressure (BP), basal insulinemia, circulating concentrations of triglycerides, and PAI-1 were higher in obese than in control subjects, whereas circulating HDL concentrations were lower.

Table 1. . Anthropometric and biochemical characteristics (mean ± SD) of the subjects enrolled in the study
 Lean (n = 10)Obese (n = 12)p
  1. SD, standard deviation; WHR, waist-to-hip ratio; SBP, systolic blood pressure; DBP, diastolic blood pressure; HDL-C, high-density lipoprotein cholesterol; PAI-1, plasminogen activator inhibitor 1.

Age40.5 ± 5.432.6 ± 9.30.04
BMI (kg/m2)21.0 ± 2.237.9 ± 5.2<0.0001
Fat (%)23.3 ± 4.743.0 ± 3.8<0.0001
WHR0.72 ± 0.030.85 ± 0.10.003
Abdominal sagittal diameter (cm)19.2 ± 1.631.6 ± 3.1<0.0001
Waist circumference (cm)70.2 ± 5.0105.1 ± 8.3<0.0001
SBP (mm Hg)110 ± 13134 ± 170.0005
DBP (mm Hg)61 ± 1675 ± 100.0062
Fasting glucose (mM)4.47 ± 0.414.82 ± 0.590.1474
Fasting insulin (mUI/L)6.72 ± 1.559.94 ± 4.360.0399
Insulin/glucose1.51 ± 0.412.25 ± 0.870.0212
Total cholesterol (mM)4.76 ± 0.984.72 ± 0.930.9308
HDL-C (mM)1.56 ± 0.281.18 ± 0.480.0469
Triglycerides (mM)0.79 ± 0.381.56 ± 0.830.0158
PAI-1 (ng/mL)5.6 ± 5.135.2 ± 27.30.0038

As shown in Figure 1, adiponectin mRNA levels were lower in VAT as compared with SAT in both groups and in SAT and VAT of obese patients as compared with lean controls, demonstrating the validity of the biopsies collection and the analytical procedures. 11β-HSD-1 mRNA levels were not different between SAT and VAT of lean and obese women. In obese patients, 11β-HSD-1 mRNA concentrations were increased in both SAT and VAT as compared with lean women. The levels of VAT 11β-HSD-1 correlating with anthropometric parameters were: BMI (r = 0.41, p = 0.05), waist circumference (r = 0.44, p = 0.04), abdominal sagittal diameter (r = 0.51, p = 0.02), and percentage fat (r = 0.51, p = 0.02). Although there was a significant difference in age between the groups, there was no effect of age per se on 11β-HSD-1 expression (r = 0.29, p = 0.19 and r = 0.21, p = 0.36 in SAT and VAT, respectively). There was a significant correlation between 11β-HSD-1 and H6PDH mRNA levels in both SAT and VAT (r = 0.43, p = 0.049, and r = 0.44, p = 0.042, respectively).

Figure 1.

Expression of adiponectin (upper panel) and 11β-HSD-1 (lower panel) mRNAs (mean ± standard error) in AT biopsies obtained from 10 lean and 12 obese women. (*) p < 0.05

Discussion

Our results demonstrate for the first time that 11β-HSD-1 mRNA expression is increased in VAT in obese patients and correlates with H6PDH mRNA levels. Because it has been demonstrated in H6PDH and 11β-HSD-1 transfected cells that a modulation of H6PDH mRNA induces parallel changes in oxoreductase activity (8), our findings strongly suggest that the conversion of cortisone to cortisol is increased in the AT of obese patients. It should be emphasized that the surgical procedures used were very similar for control or obese patients, thus eliminating possible confounding factor(s) that could explain the differences between groups. In addition, the clear-cut difference that we found could be related to the homogeneity of both groups, with controls with a BMI < 25 kg/m2 and obese subjects with a BMI > 30 kg/m2. Our findings are consistent with recent reports showing that extrahepatic splanchnic tissue, especially VAT, contributes to approximately two-thirds of the total splanchnic cortisol production (10) and that in vivo cortisol regeneration is increased selectively within AT in obesity (11). However, Basu et al. (12) have recently demonstrated that obesity does not alter splanchnic cortisol production indicating that in obese patients, the decreased hepatic 11β-HSD-1 activity (5) is balanced by an increased omental 11β-HSD-1 activity.

The mechanisms of 11β-HSD-1 regulation in humans are still unknown. It is established that cortisol stimulates AT 11β-HSD-1 mRNA (13), suggesting that, in obese patients, increased glucocorticoid signaling subsequent to a chronic stress exposure (14) or to enhanced VAT glucocorticoid receptor concentrations (15) could explain the changes found in our study. It is unlikely that anesthesia and surgical stress are involved in the variations in 11β-HSD-1 that we found between groups and/or fat depots because stimulation of AT 11β-HSD-1 mRNA by cortisol needs at least 24 hours of exposure (13). Interestingly, we have recently reported that, in rats, postnatal overfeeding increases in adulthood VAT 11β-HSD-1 levels together with enhanced basal and stress-induced circulating glucocorticoid and VAT glucocorticoid receptor concentrations and metabolic disturbances comparable with those described in the metabolic syndrome (3). Although it is difficult to extrapolate human pathophysiology from animal studies, it is tempting to suggest that AT 11β-HSD-1 dysregulation found in obese patients may be, at least in part, programmed by environmental factors. Pharmacological modulation of 11β-HSD-1 could be fundamental in the treatment of the metabolic syndrome. Because 11β-HSD-1 inhibition had therapeutic effects in murine models of metabolic syndrome or type 2 diabetes (16), specific inhibitors of 11β-HSD-1 may be useful for the treatment of patients with complicated obesity.

Acknowledgement

This work was supported by grants from the Fondation Recherche Médicale (INE 20040300232) and from the Appel D'Offre de Recherche Clinique, Assistance Publique-Hôpitaux de Marseille. We thank C. Arniaud, G. Bechis, and J-P Rosso (CHU Nord, Marseille) for their help in biochemical measurements. S. B.-C. was supported by grants from Laboratoires Servier (bourse Alfediam-Servier 2003).

Footnotes

  • 1

    Nonstandard abbreviations: 11β-HSD-1, 11β-hydroxysteroid dehydrogenase type 1; AT, adipose tissue; SAT, subcutaneous AT; VAT, visceral AT; H6PDH, hexose-6-phosphate dehydrogenase; HDL, high-density lipoprotein; PAI-1, plasminogen activator inhibitor 1; Δct, relative quantification; BP, blood pressure.

Ancillary