• ghrelin;
  • adipokines;
  • weight change


  1. Top of page
  2. Abstract
  3. Introduction
  4. Research Methods and Procedures
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References

Objective: Ghrelin administration can induce fat weight gain and hyperglycemia (potentially through ghrelin-induced hepatic glucose production), but plasma ghrelin is positively associated with whole-body insulin sensitivity (mainly reflecting muscle insulin action) being increased in lean individuals or after diet-induced weight loss and reduced in obesity or after diet-induced weight gain. To investigate potential mechanisms, we measured in vivo effects of sustained ghrelin administration at a non-orexigenic dose on skeletal muscle and liver insulin signaling at the AKT level and adipokine expression changes.

Research Methods and Procedures: Young-adult male rats received 4-day, twice daily subcutaneous ghrelin (200 µg/injection) or saline. We measured skeletal muscle (mixed, gastrocnemius; oxidative, soleus) and liver protein levels of activated [phosphorylated (P)] and total (T) AKT and glycogen synthase kinase (GSK; reflecting AKT-dependent GSK inactivation) and epididymal adipose tissue adipokine mRNA.

Results: Ghrelin increased body weight (+1.4%) and blood glucose (both p < 0.05 vs. saline) but not food intake, plasma insulin, or free fatty acids. Ghrelin, however, enhanced P/T/AKT and P/T/GSK ratios and glucose transporter-4 mRNA in soleus (p < 0.05), but not in gastrocnemius, muscle. In contrast, ghrelin reduced hepatic P/T-AKT and P/T-GSK. No alterations occurred in adiponectin, leptin, or resistin transcripts or plasma adiponectin.

Discussion: Despite moderate weight gain and in the absence of insulin-free fatty acid changes, sustained ghrelin administration enhanced oxidative muscle AKT activation. Reduced liver AKT signaling could potentially contribute to concomitant blood glucose increments. These findings support ghrelin as a novel tissue-specific modulator of lean tissue AKT signaling with insulin-sensitizing effects in skeletal muscle but not in liver in vivo.


  1. Top of page
  2. Abstract
  3. Introduction
  4. Research Methods and Procedures
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References

Ghrelin is a gastric hormone regulating short-term food intake (1, 2). Ghrelin also contributes to adipose tissue (AT)1 metabolism, favoring adipogenesis and body fat accumulation (3, 4). In addition, ghrelin administration can induce hyperglycemia in healthy humans and rodents (5, 6), potentially through enhanced hepatic gluconeogenesis (6, 7, 8), and the above metabolic effects seem to be, at least in part, independent of changes in food intake (3, 5, 6). Plasma ghrelin concentration is, however, reduced after diet-induced weight gain and increased after diet-induced weight loss (9, 10, 11). In addition, plasma ghrelin is inversely related to body fat, being highest in lean and lowest in obese insulin-resistant individuals (12, 13). A direct relationship between ghrelin and whole-body insulin sensitivity (mainly reflecting muscle insulin action) has been described in the general population (14, 15), and relatively higher ghrelin is also associated with higher insulin action within obese patient groups (16). Parallel acute increments of acylated and non-acylated ghrelin lead to acute increments of whole-body glucose disposal under post-absorptive conditions in humans (17), and acylated ghrelin acutely enhances intravenous glucose disposal in lean hyperinsulinemic mice (18).

The mechanism(s) underlying the above associations and effects remain largely undetermined. Recent studies have indicated that ghrelin contributes to the regulation of lean tissue mitochondrial and lipid metabolism. In particular, sustained ghrelin administration was reported to enhance mitochondrial function while reducing triglyceride content in rat mixed skeletal muscle (6), and these changes could contribute to the enhancement of insulin action and insulin-stimulated glucose disposal (19). Differential effects were observed in liver in the same model, with reduced activation of the master lipooxidative metabolic regulator adenosine monophosphate-activated protein kinase and related overexpression of glucogenic molecules (6). Ghrelin could also alter adipokine production (20), and its plasma concentrations are associated with those of metabolically relevant adipokines (21). Reported adipogenic effects of ghrelin could, indeed, be theoretically associated with insulin-sensitizing patterns of adipokine expression (22, 23), but no information is available on potential changes in adipokine transcriptional expression after ghrelin administration. Importantly, potential direct effects of ghrelin on lean tissue insulin signaling have been scarcely investigated, with no data regarding skeletal muscle and no in vivo studies in muscle and liver.

In the current study, we tested the hypothesis that chronic, repeated ghrelin administration is associated with tissue-specific changes in insulin signaling, with enhancement in muscle and suppression in liver, in a previously described rat model of peripheral ghrelin administration at a dose not affecting food intake (6). AKT was chosen for analysis because of its pivotal role in the insulin signaling cascade in both muscle and liver (24, 25, 26). In particular, activating AKT phosphorylation leads to increased glucose uptake and disposal in muscle, and direct AKT effects include inactivating phosphorylation of glycogen synthase kinase (GSK), resulting in enhanced glycogen deposition (25) and increased content and translocation to the plasma membrane of glucose transporter (GLUT)-4 (24, 25, 26). Hepatic AKT activation, in turn, plays a key role in suppressing hepatic gluconeogenesis (24, 25, 26). We, therefore, measured muscle and liver total (T) and activated [phosphorylated (P)] AKT and T and inactivated (P) GSK protein levels. Transcriptional expression of GLUT-4 was also determined. Transcript levels of the metabolically active adipokines adiponectin, leptin, and resistin were measured in visceral AT, and plasma adiponectin was further determined to assess involvement of changes in adipokine expression and production in potential changes in insulin signaling.

Research Methods and Procedures

  1. Top of page
  2. Abstract
  3. Introduction
  4. Research Methods and Procedures
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References

Experimental Protocol

After approval was granted by the Institutional Review Committee for Animal Studies of the University of Trieste, 10-week-old male Wistar rats were purchased from Harlan Italy (San Pietro al Natisone, Italy), kept in individual cages in the Animal Facility of the University of Trieste in a controlled environment (t = 22 °C, 12-/12-hour light/dark cycle), and fed a standard commercial chow diet (Harlan 2018, 3.4 kcal/g; Harlan) as previously described (6). The current studies are part of a larger protocol aimed at assessing the effects of ghrelin on muscle and liver energy metabolism (6). Two weeks after arrival, rats were randomly assigned to undergo twice-daily (8 pm and 8 am) subcutaneous injections of rat ghrelin (AnaSpec, San Jose, CA) (n = 8, 200 µg/injection) or vehicle (water, n = 8) for 4 days, with the first injection in the evening (Day 0) and the last injection in the morning (Day 4). The ghrelin dose was chosen to avoid its potential confounding effects on food intake (6). Animals were sacrificed 3.5 hours after the last ghrelin injection, with food withdrawal 2 hours before sacrifice. Time of sacrifice was also selected based on previous results showing that a similar dose and pattern of ghrelin administration (3) resulted in relevant metabolic effects with increase of respiratory quotient by 3 hours after injection, with apparently sustained effect for several hours afterwards (3). After intraperitoneal pentobarbital overdose, gastrocnemius and soleus muscles and epididymal AT were collected, frozen in liquid nitrogen, and stored at −80 °C.

Western Blot

For measurement of activated (P) and T-AKT and of T and inactivated (P) GSK, tissue proteins were extracted from muscles and liver and quantitated as described (6). Forty micrograms of protein were separated on 12% acrylamide gels and transferred to polyvinylidene difluoride membranes (Bio-Rad Laboratories, Hercules, CA) that were blocked and hybridized overnight at 4 °C to rabbit antibodies for Ser473-P-AKT, T-AKT, P-GSK, or T-GSK (Cell Signaling, Beverly, MA). Signals were detected and quantitated as previously described (6). The ratios between individual values for P- and T-AKT (or GSK) were then calculated. Individual results from all experiments were expressed as a percentage of the average value for vehicle-treated animals.

Real-Time Polymerase Chain Reaction (PCR)

Total RNA was isolated from 40 to 60 mg of tissues by the guanidinium method (Tri Reagent; MRC, Inc., Cincinnati, OH). Transcript levels of GLUT-4 were measured by real-time PCR (7900 Sequence Detection System; Applied Biosystems, Foster City, CA) as described in reference (6). Primers and probes for amplification of GLUT-4 and adipokine cDNA were selected using the Primer Express Software (Applied Biosystems) (GenBank accession no. D28561) as follows: GLUT-4, forward primer, GGAGGTGAAACCCAGTACAGAACT; reverse primer, GGTGGCTCTCCCACCATTTT; probe, AATACTTAGGGCCAGATGAGAATGACTGAGGG; adiponectin, forward primer, ACCCCTGGCAGGAAAGGA; reverse primer, CTCCAGCCCTACGCTGAATG; probe, AGCCCGGAGAAGCCGCTTACATGT; leptin, forward primer, GGTCACCGGTTTGGACTTCAT; reverse primer, GCCAGGGTCTGGTCCATCTT; probe, CCGGGCTTCACCCCATTCTGAGTT; and resistin, forward primer, CAGCAAGAAGATCAATCAAGACTTCA; reverse primer, CTGACCAGCAATGTAGGACAGTGT; probe, TCCCTACTGCCAGCTGCAATGA. 28S rRNA was used as a reference gene to normalize against differences in RNA isolation and RNA degradation and in the efficiencies of the reverse transcription and PCR reactions (6). Target and housekeeping genes were amplified separately using aliquots of the same cDNA sample, and quantitation for each of them was achieved using a relative standard curve. GLUT-4 transcript levels were divided by the corresponding 28S signal, and all values were divided by the average of the control group values and multiplied by 100 to express them as percentage of control group values.

Plasma Hormones

Plasma concentrations of adiponectin were measured by enzyme immunoassay (B-Bridge International, Sunnyvale, CA) following the manufacturer's recommendations.

Statistical Analysis

Student's t tests for unpaired data were used to compare variables in the two groups. p Values < 0.05 were considered statistically significant.


  1. Top of page
  2. Abstract
  3. Introduction
  4. Research Methods and Procedures
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References

Body Weight and Plasma Biochemical Profile

Changes in body weight, plasma insulin, free fatty acids (FFAs), and blood glucose were reported previously (6). Ghrelin administration induced weight gain over the 4-day treatment [weight increase over the 4 days of ghrelin or saline (S) administration: ghrelin, +19 ± 1; S, +14 ± 2 grams, p < 0.05]. Total 4-day food intake was, in turn, comparable (ghrelin, 82 ± 3; S, 79 ± 2 grams) (6). Plasma insulin (ghrelin, 9 ± 1.2; S, 7.8 ± 1.3 ng/mL), FFA (ghrelin, 0.35 ± 0.07; S, 0.47 ± 0.09 mEq/L), and growth hormone (ghrelin, 15.9 ± 3.8; S, 14.3 ± 3.9 ng/mL) concentrations were also not different between the two groups, whereas blood glucose moderately but significantly increased (ghrelin, 144 ± 5; S, 109 ± 2 mg/dL, p < 0.05) in ghrelin-treated animals (6).

Muscle AKT Activation and GLUT-4 mRNA

Ghrelin administration induced muscle-specific effects on P-AKT and its downstream targets (Figures 1 and 2). In soleus muscle, ghrelin increased P- but not T-AKT protein levels, resulting in a net increase of their ratio (P-to-T, p < 0.05 vs. control; Figure 1A). Consistent with this effect, P- but not T-GSK was also higher in ghrelin-treated animals (p < 0.05 vs. control; Figure 1B). In contrast, no changes in the P/T-AKT ratio or in P/T-GSK occurred in mixed gastrocnemius muscle (Figure 1). Consistent with muscle-specific effects on AKT-dependent insulin signaling, ghrelin treatment increased GLUT-4 transcript levels in soleus (p < 0.05 vs. control) but not in gastrocnemius muscle (Figure 2).


Figure 1. : Ghrelin effects on the ratio between P- and T-AKT (A) and between P- and T-GSK (B) in gastrocnemius and soleus muscles. The S (saline) group is represented by black bars, and the ghrelin group is represented by white bars. Data are mean ± standard error from eight animals per group. Under each bar are representative bands from two animals per group. * p < 0.05, ghrelin vs. S by Student's t test for unpaired data.

Download figure to PowerPoint


Figure 2. : Ghrelin effects on transcript levels of GLUT-4 in gastrocnemius and soleus muscles. The S (saline) group is represented by black bars, and the ghrelin group is represented by white bars. Data are mean ± standard error from eight animals per group. * p < 0.05, ghrelin vs. S by Student's t test for unpaired data.

Download figure to PowerPoint

Liver AKT Activation

In contrast to skeletal muscle, reduced P/T-AKT and P/T-GSK ratios were observed in ghrelin-treated compared with control animals (p < 0.05; Figure 3), indicating tissue-specific effects of ghrelin administration on AKT-dependent insulin signaling under the current experimental conditions.


Figure 3. : Ghrelin effects on the ratio between P- and T-AKT and between P- and T-GSK in liver. The S (saline) group is represented by black bars, and the ghrelin group is represented by white bars. Data are mean ± standard error from eight animals per group. Under each bar are representative bands from two animals from each group. * p < 0.05, ghrelin vs. S by Student's t test for unpaired data.

Download figure to PowerPoint

The master metabolic regulator peroxisome proliferator-activated receptor-γ-coactivator (PGC) 1α can activate hepatic gluconeogenesis, and its hepatic transcription has been reported to be down-regulated by AKT activation through forkhead transcription factor FOXO1 phosphorylation and nuclear exclusion (27, 28). The same effects are reported in skeletal muscle (29), although available in vivo studies have yielded conflicting results on this issue, with unchanged or reduced PGC-1α expression in the presence of acute increments of AKT phosphorylation (29, 30). We, therefore, measured muscle and liver PGC-1α transcript levels in the current model by real-time PCR using previously reported primers and probes (31). PGC-1α transcriptional expression was markedly enhanced in the liver but not in skeletal muscles (Figure 4), supporting tissue-specific effects of ghrelin on expression levels of this master metabolic regulator.


Figure 4. : Ghrelin effects on transcript levels of PGC-1α in gastrocnemius and soleus muscles (A) and in the liver (B). The S (saline) group is represented by black bars, and the ghrelin group is represented by white bars. Data are mean ± standard error from eight animals per group. * p < 0.05, ghrelin vs. control by Student's t test for unpaired data.

Download figure to PowerPoint


Ghrelin has been reported to modulate AT metabolism and adipogenesis (3, 4). These processes can involve changes in adipokines that can, in turn, alter whole-body and tissue insulin sensitivity (22, 23). Changes in circulating adiponectin and in epididymal tissue adiponectin, leptin, and resistin mRNA were, therefore, determined. Ghrelin administration had no effect on these parameters (Table 1).

Table 1. . Effects of 4-day, twice-daily S or ghrelin administration on epididymal AT mRNA levels of adiponectin, leptin, and resistin and on adiponectin plasma concentration
  1. S, saline; AT, adipose tissue; AU, arbitrary unit. No statistically significant differences were observed in these variables between the two groups (Student's t test for unpaired data).

AT adiponectin mRNA (AU)100 ± 19132 ± 31
AT leptin mRNA (AU)100 ± 14134 ± 17
AT resistin mRNA (AU)100 ± 21117 ± 21
Plasma adiponectin (µg/ml)4.2 ± 0.24.7 ± 0.4


  1. Top of page
  2. Abstract
  3. Introduction
  4. Research Methods and Procedures
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References

Skeletal Muscle Effects

To our knowledge, the current data provide the first assessment of the effects of ghrelin administration on insulin signaling in skeletal muscle. The study demonstrated that chronic in vivo ghrelin administration enhanced AKT-dependent insulin signaling selectively in oxidative muscle. AKT activation plays a critical role in the regulation of muscle insulin-mediated glucose disposal (24, 25, 26), and increased AKT activity was directly confirmed in oxidative muscle by enhanced GSK phosphorylation. Changes in GLUT-4 mRNA do not imply further changes in post-transcriptional steps of gene expression, but increased GLUT-4 mRNA has been shown to be an excellent marker of its muscle protein content under different conditions of elevated tissue glucose disposal (32, 33). Thus, the current data indicate a novel effect of ghrelin administration to activate muscle AKT-GSK signaling and the potential for tissue glucose utilization under the current conditions.

Group specificity of muscle ghrelin effects is intriguing in that it indicates that ghrelin-induced changes are linked to muscle metabolic characteristics. Changes in type I muscle are consistent with reported activation of AKT in highly oxidative cardiomyocytes in vitro (34), and these changes suggest that ghrelin favors glucose disposal in oxidative muscle groups normally relying on lipid fuel use (31, 35). Lack of effects on insulin signaling in mixed muscle [which uses higher proportions of glucose fuel under basal conditions (31, 35)] was, in turn, previously reported to be associated with increased mitochondrial oxidative capacity and triglyceride depletion (6), and these observations are also consistent with ghrelin effects in favoring alternative fuel use in muscle groups with different metabolic characteristics. Interestingly, the current data do not support a previously reported FOXO1-mediated negative effect of AKT activation on transcriptional expression of PGC-1α (29). This conclusion is, however, consistent with preserved (or enhanced) mitochondrial oxidative capacity in both muscle groups (6) and with another human study, also notably reporting no change of PGC-1α transcript levels in the presence of acute AKT activation during physiological hyperinsulinemia (30). Although further studies are required to elucidate these discrepancies, the overall results suggest that ghrelin administration in vivo can alter potential negative AKT-FOXO1-PGC-1α interactions.

Positive effects on glucose disposal were reported during acute injection of acylated ghrelin in mice (18) although not in humans (17), while combined acylated and desacylated ghrelin increments enhanced glucose disposal in non-obese human subjects (17). Acylated hormone is also notably reported to acutely increase plasma desacylated ghrelin, possibly due to in vivo loss of acyl group or potential direct stimulation of hormone secretion [because total ghrelin increments were higher than those of acylated hormone alone (17)]. The issue is relevant because desacylated hormone represents the large majority of total circulating ghrelin and could be directly involved in its positive association with insulin sensitivity (17). To indirectly assess potential changes in desacylated ghrelin and the extent of these changes under the current experimental conditions, we measured plasma concentrations of desacylated ghrelin at the same interval from last injection in a similar study of 4-day, twice daily acylated ghrelin subcutaneous administration at identical dose (R. Barazzoni and G. Guarnieri, unpublished data) in male rats of the same strain and age after 1 month of high-fat feeding. We importantly documented an approximately 3-fold increase of plasma desacylated ghrelin, thus further supporting its potential involvement in metabolic changes observed under the current conditions of chronic repeated acylated hormone administration.

Ghrelin-induced muscle effects occurred despite a moderate (<1.5%) increase in body weight (see “Results”) that was unlikely to contribute to enhanced AKT activation because higher body weight is commonly associated with muscle insulin resistance (14, 15, 16, 36). Ghrelin effects were, in turn, independent of significant overall changes in food intake [which were also not observed acutely after the morning ghrelin injection (6)], circulating insulin, FFAs, and growth hormone [consistent with previous reports after chronic ghrelin administration (2)] (6). Also, no effects of ghrelin were observed on relevant AT adipokine transcriptional expression and plasma adiponectin. Thus, the current study supports a role of ghrelin as a novel player in the in vivo regulation of muscle insulin signaling. Enhanced skeletal muscle insulin signaling, in turn, represents a potential basis for the association between total ghrelin and insulin sensitivity in the general population (14, 15, 16) and for changes in insulin action after diet-induced weight modification (9, 10, 11, 36, 37).

The current protocol was not aimed at and does not allow for dissection of potential central and peripheral ghrelin effects on insulin signaling. Several studies indicate the importance of central mechanisms for metabolic effects of ghrelin on adipose metabolism (38, 39). Available reports, however, indicate no effects of central ghrelin on muscle glucose utilization (39), whereas ghrelin receptors have been reported in both skeletal muscle and liver (7, 40). In addition, recent studies have indicated that both acylated and desacylated hormone may have specific receptors in other organs (41). This observation, along with reports of direct ghrelin effects on insulin signaling in cell lines including cardiac myocytes (34), suggests that ghrelin-induced changes in the current study could be, at least in part, direct. Potential involvement of differential receptors for acylated and desacylated hormone should be further investigated.

Liver Effects

In contrast with its effects in muscles, sustained ghrelin administration reduced hepatic AKT-GSK activation, resulting in potential glucogenic effects (24, 25, 26). Hepatic insulin resistance is reported after weight gain, but it should be pointed out that this association occurs after substantially more pronounced weight increments than those observed in this study (42). Reduced insulin signaling occurs under insulin-stimulated rather than basal conditions, and it is not associated with rapid onset of hyperglycemia (36, 42). Ghrelin-induced suppression of AKT activation is, in turn, notably consistent with previous studies in vitro (7) and with acute negative modulation of hepatic insulin action in vivo (18). The above observations suggest that hepatic AKT-GSK changes were, at least in part, directly favored by ghrelin, which appears, therefore, to exert tissue-specific effects on basal lean tissue insulin signaling. The current results further support ghrelin's effects in enhancing PGC-1α transcriptional expression, which can, in turn, be regulated by AKT-dependent FOXO1 phosphorylation and nuclear exclusion (27, 28). Because PGC-1α can directly enhance gluconeogenesis, the data are consistent with the emerging view that AKT and PGC-1α interact to modulate hepatic glucose production in vivo (27), and ghrelin appears to be a novel modulator of this interaction.

Differential changes in AKT signaling in muscle and liver suggest a relevant role of hyperghrelinemia in metabolic adaptation to reduced nutrient availability or therapeutic caloric restriction and weight loss, which are, indeed, notably characterized by the association of enhanced muscle glucose disposal and preserved or enhanced hepatic glucose production (37, 43, 44). In particular, the current data suggest that ghrelin could contribute to metabolic adaptive changes by differentially modulating muscle and liver AKT-GSK signaling (with further modulation of FOXO1-PGC-1α in the liver). Potential changes in glucose production could have accounted for increased circulating glucose despite enhanced muscle AKT activation. Moderate hyperglycemia was, however, not associated with increased circulating insulin. Although in vitro reports have yielded conflicting results with both inhibitory and stimulatory effects (45, 46), in vivo studies, in agreement with the current data, are consistent with the view that ghrelin can inhibit insulin secretion (47, 48).

In the current protocol, we chose twice daily peripheral ghrelin administration at a dose comparable with that used in previous studies in which no effects on food intake were reported (3) in the presence of prolonged and stable effects on energy lipid metabolism. It should, however, be pointed out that steady-state concentrations of plasma ghrelin cannot be assumed, and it is possible that fluctuations in plasma ghrelin occurred, in particular, shortly before and after injections. Approximately 2-fold total ghrelin increments are reported to occur physiologically with circadian changes of secretion patterns (49), and up to 3-fold changes from basal total ghrelin characterize diet-induced weight modification (13, 49), pathological conditions including type 1 diabetic models (50), and advanced renal failure (51). Inter-individual variability of up to 10-fold has been reported in some of the above studies in humans (12, 13, 51). Based on the 3-fold increment of desacylated ghrelin observed in our similar study (R. Barazzoni, G Guarnieri, unpublished data), the current experimental design may result in supraphysiological ghrelin 24-hour fluctuations that are, however, likely to be within the limits of inter-individual variability reported under relevant pathophysiological conditions (12, 13, 51). Potential pathophysiological relevance of these observations is also supported by the common associations between circulating ghrelin and insulin sensitivity (14, 15, 16), which could involve, at least in part, the current novel effects on insulin signaling. Further studies are required to establish potential thresholds and dose-response curves for the current ghrelin effects.

In conclusion, chronic peripheral ghrelin administration to lean rats up-regulates AKT activation in the muscle while reducing it in the liver, independently of changes in adipokine expression. These effects are associated with tissue-specifically altered PGC-1α expression in the liver but not in skeletal muscle. The findings support the concept that ghrelin contributes to the in vivo regulation of lean tissue insulin signaling. Ghrelin's impact on insulin signaling could be involved in muscle metabolic changes associated with diet-induced modification of body weight, and it could contribute to preserving hepatic glucose production in calorie-restricted states.


  1. Top of page
  2. Abstract
  3. Introduction
  4. Research Methods and Procedures
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References

We thank Mariella Sturma, Anna de Santis, and Annamaria Semolic for excellent technical assistance. There was no funding/outside support for this study.

  • 1

    Nonstandard abbreviations: AT, adipose tissue; GSK, glycogen synthase kinase; GLUT, glucose transporter; T, total; P, phosphorylated; PCR, polymerase chain reaction; FFA, free fatty acid; S, saline; PGC, peroxisome proliferator-activated receptor-γ-coactivator; FOXO1, forkhead in rhabdomyosarcoma.


  1. Top of page
  2. Abstract
  3. Introduction
  4. Research Methods and Procedures
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References
  • 1
    Nakazato, M., Murakami, N., Date, Y., et al (2001) A role of ghrelin in the central regulation of feeding. Nature 409: 194198.
  • 2
    Wren, A. M., Small, C. J., Abbott, C. R., et al (2001) Ghrelin causes hyperphagia and obesity in rats. Diabetes 50: 25402547.
  • 3
    Tschop, M., Smiley, D. L., Heiman, ML. (2000) Ghrelin induces adiposity in rodents. Nature 407: 908913.
  • 4
    Thompson, N. M., Gill, D. A., Davies, R., et al (2004) Ghrelin and des-octanoyl ghrelin promote adipogenesis directly in vivo by a mechanism independent of the type 1a growth hormone secretagogue receptor. Endocrinology 145: 234242.
  • 5
    Broglio, F., Gottero, C., Benso, A., et al (2003) Effects of ghrelin on the insulin and glycemic responses to glucose, arginine, or free fatty acids load in humans. J Clin Endocrinol Metab. 88: 42684272.
  • 6
    Barazzoni, R., Bosutti, A., Stebel, M., et al (2005) Ghrelin regulates mitochondrial-lipid metabolism gene expression and fat distribution in liver and skeletal muscle. Am J Physiol Endocrinol Metab. 288: E228E235.
  • 7
    Murata, M., Okimura, Y., Iida, K., et al (2002) Ghrelin modulates the downstream molecules of insulin signaling in hepatoma cells. J Biol Chem. 277: 56675674.
  • 8
    Gauna, C., Delhanty, P. J. D., Hofland, L. J., et al (2005) Ghrelin stimulates, whereas des-octanoyl ghrelin inhibits, glucose output by primary hepatocytes. J Clin Endocrinol Metab. 90: 10551060.
  • 9
    Robertson, M. D., Henderson, R. A., Vist, G. E., Rumsey, RD. (2004) Plasma ghrelin response following a period of acute overfeeding in normal weight men. Int J Obes Relat Metab Disord. 28: 727733.
  • 10
    Cummings, D. E., Weigle, D. S., Frayo, R. S., et al (2002) Plasma ghrelin levels after diet-induced weight loss or gastric by-pass surgery. N Engl J Med. 346: 16231630.
  • 11
    Barazzoni, R., Zanetti, M., Stebel, M., Biolo, G., Cattin, L., Guarnieri, G. (2003) Hyperleptinemia prevents increased plasma ghrelin concentration during short-term moderate caloric restriction in rats. Gastroenterology 124: 11881192.
  • 12
    Tschop, M., Weyer, C., Tataranni, P. A., Devanarayan, V., Ravussin, E., Heiman, ML. (2001) Circulating ghrelin levels are decreased in human obesity. Diabetes 50: 707709.
  • 13
    Shiiya, T., Nakazato, M., Mizuta, M., et al (2002) Plasma ghrelin levels in lean and obese humans and the effect of glucose on ghrelin secretion. J Clin Endocrinol Metab. 87: 240244.
  • 14
    Purnell, J. Q., Weigle, D. S., Breen, P., Cummings, DE. (2003) Ghrelin levels correlate with insulin levels, insulin resistance, and high-density lipoprotein cholesterol, but not with gender, menopausal status, or cortisol levels in humans. J Clin Endocrinol Metab. 88: 57475752.
  • 15
    Poykko, S. M., Kellokoski, E., Horkko, S., Kauma, H., Kesaniemi, Y. A., Ukkola, O. (2003) Low plasma ghrelin is associated with insulin resistance, hypertension, and the prevalence of type 2 diabetes. Diabetes 52: 25462553.
  • 16
    McLaughlin, T., Abbasi, F., Lamendola, C., Frayo, R. S., Cummings, DE. (2004) Plasma ghrelin concentrations are decreased in insulin-resistant obese adults relative to equally obese insulin-sensitive controls. J Clin Endocrinol Metab. 89: 16301635.
  • 17
    Gauna, C., Meyler, F. M., Janssen, JAMJL, et al (2004) Administration of acylated ghrelin reduces insulin sensitivity, whereas the combination of acylated plus unacylated ghrelin strongly improves insulin sensitivity. J Clin Endocrinol Metab. 89: 50355042.
  • 18
    Heijboer, A. C., van den Hoek, A. M., et al (2006) Ghrelin differentially affects hepatic and peripheral insulin sensitivity in mice. Diabetologia 49: 732738.
  • 19
    Barazzoni, R. (2004) Skeletal muscle mitochondrial protein metabolism and function in ageing and type 2 diabetes. Curr Opin Clin Nutr Metab Care 7: 97102.
  • 20
    Giovambattista, A., Piermaria, J., Suescun, M. O., Calandra, R. S., Gaillard, R. C., Spinedi, E. (2006) Direct effect of ghrelin on leptin production by cultured rat white adipocytes. Obesity 14: 1927.
  • 21
    Vendrell, J., Broch, M., Vilarrasa, N., et al (2004) Resistin, adiponectin, ghrelin, leptin, and proinflammatory cytokines: relationships in obesity. Obes Res. 12: 962971.
  • 22
    Lee, K., Villena, J. A., Moon, Y. S., et al (2003) Inhibition of adipogenesis and development of glucose intolerance by soluble preadipocyte factor-1 (Pref-1). J Clin Invest. 111: 453461.
  • 23
    Kim, K. H., Zhao, L., Moon, Y., Kang, C., Sul, HS. (2004) Dominant inhibitory adipocyte-specific secretory factor (ADSF) resistin enhances adipogenesis and improves insulin sensitivity. Proc Natl Acad Sci U S A 101: 67806785.
  • 24
    Kohn, A. D., Takeuchi, F., Roth, RA. (1996) Akt, a pleckstrin homology domain containing kinase, is activated primarily by phosphorylation. J Biol Chem. 271: 2192021926.
  • 25
    Cross, D. A. E., Alessi, D. R., Cohen, P., Andjelkovich, M., Hemmings, BA. (1995) Inhibition of glycogen synthase kinase-3 by insulin mediated by protein kinase B. Nature 378: 785789.
  • 26
    Holman, G. D., Kasuga, M. (1997) From receptor to transporter: insulin signalling to glucose transport. Diabetologia 40: 9911003.
  • 27
    Puigserver, P., Rhee, J., Donovan, J., et al (2003) Insulin-regulated hepatic gluconeogenesis through FOXO1-PGC-1alpha interaction. Nature 423: 550555.
  • 28
    Daitoku, H., Yamagata, K., Matsuzaki, H., Hatta, M., Fukamizu, A. (2003) Regulation of PGC-1 promoter activity by protein kinase B and the forkhead transcription factor FKHR. Diabetes 52: 642649.
  • 29
    Southgate, R. J., Bruce, C. R., Carey, A. L., et al (2005) PGC-1alpha gene expression is down-regulated by Akt- mediated phosphorylation and nuclear exclusion of FoxO1 in insulin-stimulated skeletal muscle. FASEB J. 19: 20722074.
  • 30
    Asmann, Y. W., Stump, C. S., Short, K. R., et al (2006) Skeletal muscle mitochondrial functions, mitochondrial DNA copy numbers, and gene transcript profiles in type 2 diabetic and nondiabetic subjects at equal levels of low or high insulin and euglycemia. Diabetes 55: 33093319.
  • 31
    Barazzoni, R., Zanetti, M., Bosutti, A., et al (2005) Moderate caloric restriction, but not physiological hyperleptinemia per se, enhances mitochondrial oxidative capacity in rat liver and skeletal muscle–tissue-specific impact on tissue triglyceride content and AKT activation. Endocrinology 146: 20982106.
  • 32
    Cheng, J. T., Huang, C. C., Liu, I. M., Tzeng, T. F., Chang, CJ. (2006) Novel mechanism for plasma glucose-lowering action of metformin in streptozotocin-induced diabetic rats. Diabetes 55: 819825.
  • 33
    Short, K. R., Vittone, J. L., Bigelow, M. L., et al (2003) Impact of aerobic exercise training on age-related changes in insulin sensitivity and muscle oxidative capacity. Diabetes 52: 18881896.
  • 34
    Baldanzi, G., Filigheddu, N., Cutrupi, S., et al (2002) Ghrelin and des-acyl ghrelin inhibit cell death in cardiomyocytes and endothelial cells through ERK1/2 and PI 3-kinase/AKT. J Cell Biol. 159: 10291037.
  • 35
    Samec, S., Seydoux, J., Dulloo, AG. (1998) Interorgan signaling between adipose tissue metabolism and skeletal muscle uncoupling protein homologs: is there a role for circulating free fatty acids? Diabetes 47: 16931698.
  • 36
    Standaert, M. L., Sajan, M. P., Miura, A., et al (2004) Insulin-induced activation of atypical protein kinase C, but not protein kinase B, is maintained in diabetic (ob/ob and goto-kakazaki) liver: contrasting insulin signaling patterns in liver versus muscle define phenotypes of type 2 diabetic and high fat-induced insulin-resistant states. J Biol Chem. 279: 2492924934.
  • 37
    Escrivá, F., Rodríguez, C., Cacho, J., Alvarez, C., Portha, B., Pascual-Leone, AM. (1992) Glucose utilization and insulin action in adult rats submitted to prolonged food restriction. Am J Physiol Endocrinol Metab. 263: E1E7.
  • 38
    Tritos, N. A., Kokkinos, A., Lampadariou, E., Alexiou, E., Katsilambros, N., Maratos-Flier, E. (2003) Cerebrospinal fluid ghrelin is negatively associated with body mass index. J Clin Endocrinol Metab. 88: 29432946.
  • 39
    Theander-Carrillo, C., Wiedmer, P., Cettour-Rose, P., et al (2006) Ghrelin action in the brain controls adipocyte metabolism. J Clin Invest. 116: 19831993.
  • 40
    Filigheddu, N., Gnocchi, V. F., Coscia, M., et al (2007) Ghrelin and des-acyl ghrelin promote differentiation and fusion of C2C12 skeletal muscle cells. Mol Biol Cell 18: 986994.
  • 41
    Cassoni, P., Ghe, C., Marrocco, T., Tarabra, E., et al (2004) Expression of ghrelin and biological activity of specific receptors for ghrelin and des-acyl ghrelin in human prostate neoplasms and related cell lines. Eur J Endocrinol. 150: 173184.
  • 42
    Park, S. Y., Cho, Y. R., Kim, H. J., et al (2005) Unraveling the temporal pattern of diet-induced insulin resistance in individual organs and cardiac dysfunction in C57BL/6 mice. Diabetes 54: 35303540.
  • 43
    Grimble, RF. (1998) Fasting in healthy individuals and adaption to undernutrition during chronic disease. Curr Opin Clin Nutr Metab Care 1: 369374.
  • 44
    Hagopian, K., Ramsey, J. J., Weindruch, R. (2003) Caloric restriction increases gluconeogenic and transaminase enzyme activities in mouse liver. Exp Gerontol. 38: 267278.
  • 45
    Lee, H. M., Wang, G., Englander, E. W., Kojima, M., Greeley, G. H., Jr (2002) Ghrelin, a new gastrointestinal endocrine peptide that stimulates insulin secretion: enteric distribution, ontogeny, influence of endocrine, and dietary manipulations. Endocrinology 143: 185190.
  • 46
    Reimer, M. K., Pacini, G., Ahren, B. (2003) Dose-dependent inhibition by ghrelin of insulin secretion in the mouse. Endocrinology 144: 916921.
  • 47
    Broglio, F., Arvat, E., Benso, A., et al (2001) Ghrelin, a natural GH secretagogue produced by the stomach, induces hyperglycemia and reduces insulin secretion in humans. J Clin Endocrinol Metab. 86: 50835086.
  • 48
    Damjanovic, S. S., Lalic, N. M., Pesko, P. M., et al (2006) Acute effects of ghrelin on insulin secretion and glucose disposal rate in gastrectomized patients. J Clin Endocrinol Metab. 91: 25742581.
  • 49
    Murakami, N., Hayashida, T., Kuroiwa, T., et al (2002) Role for central ghrelin in food intake and secretion profile of stomach ghrelin in rats. J Endocrinol. 174: 283288.
  • 50
    Tsubone, T., Masaki, T., Katsuragi, I., et al (2005) Leptin downregulates ghrelin levels in streptozotocin-induced diabetic mice. Am J Physiol Regul Integr Comp Physiol. 289: R1703R1706.
  • 51
    Ayala, E. Rodriguez, Pecoits-Filho, R., Heimburger, O., et al (2004) Associations between plasma ghrelin levels and body composition in end-stage renal disease: a longitudinal study. Nephrol Dial Transplant 19: 421426.