SEARCH

SEARCH BY CITATION

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods and Procedures
  5. Results
  6. Discussion
  7. ACKNOWLEDGMENTS
  8. DISCLOSURE
  9. References
  10. Supporting Information

Enhanced nicotinamide adenine dinucleotide phosphate (NADPH) oxidase activity in the monocytes occurred in metabolic syndrome, hypertension, diabetes and obese patients in adults. However, whether NADPH oxidase is involved in the oxidative stress of overweight adolescents without comorbidities is still unclear. This study aimed to identify whether and how NADPH oxidase plays a crucial role in overweight adolescents. The study was performed in 93 overweight adolescents and 31 normal weight controls. Moreover, 87 overweight adolescents were enrolled in weight-loss program. Demographics characteristics, anthropometrics, composition and clinical characteristics were analyzed. Oxidative stress indexes including the levels of superoxide dismutase (SOD) and malondialdehyde (MDA) in plasma and the expression of NADPH oxidase in the monocytes were examined. Overweight adolescents showed a higher oxidative stress state, as indicated by decreased SOD activity and elevated MDA level (P < 0.01). Furthermore, increased NADPH oxidase activity in the monocytes was accompanied by Rac1 upregulation. A significant positive bivariate correlation was found between Rac1 expression and MDA (r = 0.289). There also was a significant positive bivariate correlation between Rac1 expression and obesity-related indexes including BMI (r = 0.227) and percentage of trunk fat (r = 0.233). Data from weight-loss program reinforced the results. Partial correlation analysis indicated that obesity-induced oxidative stress and Rac1 expression is a consequence of aberrant glucose-lipid metabolism in overweight adolescents. In conclusion, we provided novel data showing that NADPH oxidase in the monocytes was highly activated by enhancing Rac1 expression in Chinese overweight adolescents and Rac1 may act as a link between obesity and oxidative stress in overweight adolescents.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods and Procedures
  5. Results
  6. Discussion
  7. ACKNOWLEDGMENTS
  8. DISCLOSURE
  9. References
  10. Supporting Information

Childhood overweight and obesity have been dramatically increasing in the last two decades in China. The increased prevalence of obesity in adolescents contributes to an increase of earlier onset of obesity-related diseases such as hypertension, type 2 diabetes and atherosclerosis (1,2).

Obesity is a chronic disease characterized by a low grade inflammation level known to induce oxidative stress, which is considered central components of the pathogenesis of obesity-related diseases (3). Oxidative stress may result from increased generation and/or inadequate removal of reactive oxygen species (ROS). Excessive ROS generation causes the damage of proteins, lipids and DNA, furthermore, expands to the cellular dysfunctions. Previous study has been shown that oxidative stress plays a critical role in the pathogenesis of obesity-related diseases including hypertension, hypertriglyceridemia and diabetes in adults. But there were only a limited number of studies of the oxidative damage caused by obesity in childhood as compared with the number of such studies in adults. While evidence still showed that oxidative stress already presented in obese children prior to the appearance of a multi-metabolic syndrome (MMS) and played a key role in pathogenesis of obesity-related diseases (3).

Among the multiple cellular sources of ROS, NADPH oxidase is considered to be the main enzymatic source of ROS in monocytes. Enhanced NADPH oxidase activity in monocytes occurred in metabolic syndrome, hypertension, diabetes and obese patients in adults (4,5,6). However, whether NADPH oxidase is involved in the oxidative stress of overweight adolescents without comorbidities is still unclear.

NADPH oxidase is a multienzyme complex composed of gp91phox, p22phox, p47phox, and rac1 (7,8,9). Previous studies showed that NADPH oxidase was activated by different manners on different stimuli. Significant enhanced expression of p22phox was found in diabetes and metabolic syndrome patients (4,10). Increased expression of gp91phox, p22phox, and p47phox occurred in cardiovascular system in response to the injury in human and animal model (5,6,11).

Apart from the above components, Rac1 is also required for the assembly and activation of NADPH oxidase in the form of the complex (9,12). Rac1-mediated NADPH oxidase activation has been shown to induce oxidative stress and result in organ injury, reperfusion injury during reoxygenation, cardiac hypertrophy and oncogenesis of vascular smooth muscle. However, whether Rac1 is involved in the oxidative stress of overweight adolescents without comorbidities is unclear.

In the present study, we provided novel data showing that NADPH oxidase in the monocytes was highly activated by enhancing Rac1 expression and Rac1 may act as a link between obesity and oxidative stress in Chinese overweight adolescents.

Methods and Procedures

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods and Procedures
  5. Results
  6. Discussion
  7. ACKNOWLEDGMENTS
  8. DISCLOSURE
  9. References
  10. Supporting Information

Subjects

A total of 124 adolescents (59 males and 65 females, aged = 13.6 ± 0.7) from a high school (Beijing 27th High School) in downtown of Beijing volunteered to participate in this study. According to the age- and gender-specific body mass index (BMI) cutoff points defined by the Group of China Obesity Task Force Correspondence, all subjects (BMI: 14.6–34.1 kg/m2) were divided into overweight group (n = 93, BMI: 22.4∼34.1 kg/m2,) and normal weight group (n = 31, BMI: 14.6∼21.9 kg/m2). These subjects were not currently taking any medication or were not previously diagnosed with major metabolic, cardiovascular or any other existing chronic health problem. Detailed family history of diabetes was obtained from all subjects. The staging of puberty was obtained on the basis of breast development in girls and genital development in boys (13). After explaining the study procedures to the participants and their parents, informed written consent was obtained from both participants and their parents. 87 overweight adolescents participated in the weight-loss program for 10 weeks and randomly assigned into four groups: 1) diet (n = 20); 2) exercise (n = 24); 3) diet and exercise (n = 26); and 4) overweight control without intervention (n = 17). All procedures were approved by the Ethics Committee of Beijing Sport University, Ministry of Education.

Study design

This is a prospective investigation on the relationship between obesity feature and NADPH oxidative-induced oxidative stress in overweight adolescents and normal weight controls. The measurement was also done in overweight adolescents before and after 10 weeks of weight-loss program. In particular, to investigate whether and how NADPH oxidase-induced oxidative stress plays a role in overweight adolescents, the demographics characteristics (age, gender), anthropometrics (height, weight, BMI, circumstance of chest and waist), composition (percentage of body fat and trunk fat, body muscle mass (kg)), clinical characteristics (fasting blood glucose (FBG), total cholesterol (TC), triglyceride (TG), high-density lipoprotein-cholesterol (HDL-c), low-density lipoprotein-cholesterol (LDL-c)) and oxidative stress indexes including superoxide dismutase (SOD) and malondialdehyde (MDA) were analyzed in 93 overweight adolescents and 31 normal weight controls. To further confirm the relationship between obesity feature and Rac1 expression, 87 overweight adolescents were enrolled in weight-loss program.

During this period, in the dietary restriction group, subjects with BMI above 95 and 85% were recommended to consume 70% (maximum to 9,920 kJ) and 80% (maximum to 11 083 kJ) of daily standard caloric intake according to the age and corresponding ideal body weight, respectively. The recipe including 15–20% protein, 25–30% unsaturated fatty acid, and 50–60% carbohydrate was provided by a nutritionist. In the exercise intervention group, an exercise plan (four times/week) was performed. A specific aerobic training protocol was designed for this study based on student's age, physical capability and school activities. This aerobic protocol included (i) 10-min warm up; (ii) 40-min of physical activities/exercise games; and (iii) 10-min of cool down. Within the 40-min exercise session, adolescents performed a combination of different types of exercise including jogging, running at a moderate speed, jumping rope, and group activities such as basketball, volleyball, and badminton games. The intensity of physical activity was targeted at about 40–60% of VO2max corresponding to a prescribed heart rate measured by heart rate monitor during exercise session. In the diet and exercise group, a combination of dietary restriction and exercise plan was performed.

At the end of the weight-loss intervention, the anthropometrics (height, weight, BMI, circumstance of chest and waist), composition (percentage of body fat and trunk fat, body muscle mass (kg)), clinical characteristics (FBG, TC, TG, HDL-c, LDL-c), oxidative stress indexes (SOD, MDA) and expression of NADPH oxidase subunits (gp91phox, p22phox, p47phox, Rac1) were obtained.

Anthropometry and measurement of body composition

The baseline measurements included anthropometry (height, body weight, waist circumference, chest circumference) and body composition (% body fat, % trunk fat, and muscle mass). These measurements were repeated after 10-week experimental intervention.

Body weight was measured with a digital scale to the nearest 0.1 kg. BMI was calculated as body weight in kilograms divided the square of height in centimeters. Waist circumference was tested at the level of the natural waist between the ribs and iliac crest at the end of a normal expiration. Chest circumference was measured at the lower margin of the inferior angle of scapula.

Body composition was estimated by dual-energy X-ray absorptiometry (12). DXA measurement was performed by using a total body scanner (lunar DPX-L; LUNAR, Madison, WI), and the percentage of total body fat and trunk fat, and body muscle mass were measured.

Expression of NOX subunits in the monocytes

Blood samples were collected after 10-h overnight fast. The monocytes were isolated as previously described (14). RNA was extracted using Trizol. Real-time PCR was performed using A7500 Real-Time Thermal Cycler (ABI). The following primer sequences were used for real-time PCR: gp91phox forward: CAAGATGCGTGGAAACTACC, reverse: TTGAGAATGGATGCGAAGG; p22phox forward: ATTGT GGCGGGCGTGTT, reverse: CGGCGGTCATGTAC TTCTGTC; p47phox forward: CAGTCATGGGGGACACCTT, reverse: GACAGG TCCTGCCATTTCAC; Rac1 forward: GGTGAATCTGGGCTTATGG, reverse TGGGAGTGTTGGGACAGTGG; GAPDH forward: TGCA CCACCAACTGCTTA GC, reverse: GGCATGGACTGTGGTCA TGAG. The amplification efficiency of each target and endogenous reference gene was comparable. The reaction mixture (20 µl) containing 10 µl SYBR Green Master Mix, 0.2 µmol/l of each primer and 0.05 µl RT product was amplified with 7500 system (ABI). All experiments were repeated three times.

Markers of oxidative stress, glucose-insulin metabolism, and lipids

MDA was measured by thiobarbituric acid method as the evaluation of systemic oxidative stress and SOD activity was calculated with commercial assay kit (Cayman Chemicals, Ann Arbor, MI) as the marker of anti-oxidative ability. The FBG was measured by enzymatic method (Beckman, Albertville, MN) and plasma insulin was tested by chemiluminescence method (Immulite; DPC, Los Angeles, CA). Insulin resistance was estimated with the homeostasis model of insulin resistance (HOMAIR) by the formula from fasting insulin (I0) and fasting glucose (G0) as follows: HOMAIR = (I0 × G0)/22.5 (insulin in µU/ml and glucose in mmol/l) (15). The HOMAIR has been used as a reliable estimate of insulin sensitivity (16). The levels of TC, TG, and HDL-c were measured using a kit from Roche (Basel, Switzerland). LDL-c level was calculated using the Friedewald formula (17).

Statistical analysis

Continuous measurement data were represented as means ± SD. Comparison between normal weight and overweight groups was analyzed by using t-test for independent group comparisons. The numeration data was compared by χ2-test. Spearman correlation coefficients were used to determine bivariate relation for either two parameters. To determine the relations of total and abdominal adiposity with the oxidative stress markers, multiple linear regression analysis was further performed according to the results of linear correlation analysis. Separate regression models were used for each measure of oxidative stress markers and each measure of adiposity (BMI, waist circumference, and % total body fat). The oxidative stress markers were entered as the dependent variable, whereas adiposity was entered as independent variable. Part correlation coefficients (rpart) derived from regression analysis was used to determine the association of adiposity with oxidative stress markers.

To assess glucose metabolism (fasting glucose, insulin, and HOMAIR) and blood lipids (TC, LDL-c, and TG) as potential intermediary mechanism by which adiposity influences oxidative stress markers, multiple linear regression analyses were performed as described above. Each factor was entered as an independent variable in the model, in addition to adiposity. Using this approach, we determined how the relation between adiposity and oxidative stress was changed by accounting for these factors. Statistically significance was set at P < 0.05. All data were analyzed with the SPSS 17.0 software.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods and Procedures
  5. Results
  6. Discussion
  7. ACKNOWLEDGMENTS
  8. DISCLOSURE
  9. References
  10. Supporting Information

Overweight adolescents displayed the discrepancy in glucose, lipid metabolism, and insulin sensitivity from normal weight adolescents

The demographic characteristics, anthropometrics, composition and clinical characteristics involved in this study are summarized in Table 1. As expected, overweight adolescents displayed significantly higher characteristics in anthropometrics and body composition including BMI, weight, circumference of chest and waist, percentage of body fat and trunk fat, and body muscle mass. No significant difference in demographic characteristics such as age and family history of diabetes was found between two groups.

Table 1.  Demographical characteristics, anthropometrics, composition and clinical characteristics of the subjects involved in this study
inline image

Though the clinical characteristics in all adolescents were within normal limits, overweight adolescents displayed slight differences in glucose and lipid metabolism represented by elevated FBG, TC, and LDL-c levels compared with normal weight adolescents. Moreover, overweight adolescents displayed reduced insulin sensitivity represented by elevated insulin levels and HOMAIR compared with normal weight adolescents.

Oxidative stress occurred in overweight adolescents and positively correlated with obesity

We measured SOD activity and lipid peroxidation (MDA production) in the serum of all participants. As shown in Figure 1a, level of MDA was higher (4.77 ± 1.27 mmol/l vs. 6.08 ± 1.97 mmol/l, P < 0.01), while activity of SOD was lower in overweight adolescents than that in the control group (85.34 ± 9.22 U/ml vs. 80.18 ± 8.66 U/ml, P < 0.01).

image

Figure 1. Oxidative stress occurred in overweight adolescents and correlated with obesity. (a) Serum malondialdehyde (MDA) level and superoxide dismutase (SOD) activity in overweight adolescents (n = 93) and normal weight adolescents (n = 31) were measured. (b) Significant positive bivariate correlation between MDA and BMI (y = 0.487x + 22.377; r = 0.214, P = 0.019), percentage of trunk fat (y = 0.907x + 26.565; r = 0.219, P = 0.020). (c) While significant inverse correlation between SOD and BMI (y = −0.118x + 34.222; r = 0.247, P = 0.014), percentage of trunk fat (y = −0.229x + 49.847; r = 0.248, P = 0.016), was found in all subjects involved in this study. **P < 0.01, P < 0.001.

Download figure to PowerPoint

We next analyzed the relationship between oxidative stress and obesity-related indexes. Significant positive bivariate correlation was found between MDA and BMI (y = 0.487x + 22.377; r = 0.214, P = 0.019) and percentage of trunk fat (y = 0.907x + 26.565; r = 0.219, P = 0.020) (Figure 1b). Whereas, there was a significant inverse correlation between SOD and BMI (y = −0.118x + 34.222; r = 0.247, P = 0.014) and percentage of trunk fat (y = −0.229x + 49.847; r = 0.248, P = 0.016) in all subjects involved in this study (Figure 1c). Furthermore, there was a significant positive bivariate correlation between MDA and other obesity-related indexes such as weight and circumference of chest (data not shown). This demonstrated a relationship between oxidative stress and obesity.

Augmented Rac1 expression in the monocytes in overweight adolescents and Rac1 acted as a linker between obesity and oxidative stress

The members of NOX family including NOX1, NOX2, NOX3, NOX4, and NOX5 have been identified in different tissues and cells. Using reverse transcription-PCR, we have found expression of NOX2 (gp91phox) and subunits, such as p22phox, p47phox, and Rac1, but not NOX1, NOX3, NOX4, and NOX5, in the monocytes (data not shown). Therefore, we investigated whether the expression of these subunits increased in overweight adolescents. The results indicated that Rac1, but not gp91phox, p22phox, and p47phox was upregulated in the monocytes in overweight adolescents, as detected by real-time PCR (Figure 2a).

image

Figure 2. Augmented Rac1 expression in the monocytes of overweight adolescents and Rac1 acted as a linker between obesity and oxidative stress. (a) Rac1, but not gp91phox, p22phox, and p47phox, was upregulated in the monocytes of overweight adolescents compared with control group, as shown by real-time PCR. (b) Rac1 is positively correlated with oxidative stress represented by malondialdehyde (MDA). (c) Rac1 is positively correlated with obesity represented by percentage of trunk fat and BMI. NC, normal weight controls; OW, overweight adolescents.

Download figure to PowerPoint

We next analyzed the correlation between expression of Rac1 and oxidative stress. A significant positive bivariate correlation was found between Rac1 level and MDA (y = 0.770x + 4.704; r = 0.289, P = 0.010) (Figure 2b). We also analyzed the correlation between expression of Rac1 and obesity-related indexes by association analysis. A significant positive bivariate correlation appeared between Rac1 level and BMI (y = 1.371x + 22.380; r = 0.227, P = 0.039), and percentage of trunk fat (y = 2.733x + 26.565; r = 0.233, P < 0.001) (Figure 2c).

Weight-loss program for overweight adolescents impaired oxidative stress and Rac1 expression in the monocytes

In order to further assess the relationship between obesity and Rac1 expression and oxidative stress, 87 overweight adolescents were enrolled in this study. 17 overweight adolescents as control did not participate in weight-loss program and 70 overweight adolescents were intervened with diet, aerobic exercise or diet plus exercise for 10 weeks. The demographic characteristics, anthropometrics, composition and clinical characteristics of preintervention and postintervention in overweight adolescents are summarized in Table 2. The intervention for 10 weeks significantly decreased anthropometrics and body composition including BMI, circumference of chest and waist, percentage of body fat and trunk fat, and body muscle mass. Moreover, although activity of SOD was not changed, the MDA level in serum was declined after intervention in overweight adolescents, suggesting that weight-loss intervention impaired oxidative stress, accompanied by decrease of BMI and percentage of trunk fat (Figure 3a). We also measured mRNA abundance of NADPH oxidase. And 11 of 17 overweight adolescent controls and 37 of 70 weight-loss groups participated in Rac1 analysis. Figure 3b showed that Rac1, but not other subunits of NADPH oxidase, was reduced in the monocytes after intervention, as analyzed by real-time PCR, indicating that Rac1 may act as a linker between obesity and oxidative stress.

Table 2.  Demographical characteristics, anthropometrics, composition and clinical characteristics of overweight adolescents involved in weight-loss program
inline image
image

Figure 3. Weight-loss programs for overweight adolescents impaired oxidative stress and Rac1 expression in the monocytes. 87 overweight adolescents participated in the weight-loss program. 17 overweight adolescents were as control without any intervention, and 70 overweight adolescents underwent weight-loss program by diet intervention, exercise or diet plus exercise for 10 weeks. (a) Malondialdehyde (MDA) level and superoxide dismutase (SOD) activity in serum were measured. MDA level decreased in weight-loss group, while no difference occurred in SOD activity between the control and weight-loss group. (b) Decreased Rac1 expression in the monocytes occurred in weight-loss group. *P < 0.01. OW.

Download figure to PowerPoint

Obesity-induced oxidative stress and augmented Rac1 expression was influenced by aberrant glucose-lipid metabolism in overweight adolescents

We further investigated whether aberrant glucose-lipid metabolism or reduced insulin sensitivity caused by obesity were involved in obesity-induced oxidative stress and augmented Rac1 expression. Partial correlation analysis was performed to evaluate the role of glucose-lipid metabolism and insulin sensitivity in obesity -induced oxidative stress and elevated Rac1 expression.

As shown in Table 3, after accounting for the influence of FBG, LDL-c, and TC, the correlation between MDA and trunk fat was reduced from 0.219 to 0.164, 0.179, and 0.180, respectively, and the P value was changed from 0.020 to 0.085, 0.060, and 0.058, respectively. There was no significant influence of insulin and HOMAIR on the relationship between MDA and trunk fat. Similarly, the relationship between MDA and BMI was decreased from 0.214 to 0.141, 0.166, and 0.177, respectively, and the P value was increased from 0.019 to 0.129, 0.073, and 0.056, respectively. There was no significant influence of insulin and HOMAIR on the correlation between MDA and BMI. In addition, the correlation between Rac1 and trunk fat was changed from 0.233 to 0.162, 0.215, and 0.211, respectively, and the P value was enhanced from 0.0419 to 0.163, 0.063, and 0.067, respectively. There was no significant influence of insulin and HOMAIR on the relationship between Rac1 and trunk fat. Moreover, the correlation between Rac1 and BMI was reduced from 0.227 to 0.156, 0.206, and 0.209, respectively, and the P value was elevated from 0.039 to 0.162, 0.063, and 0.06, respectively. There also was no significant influence of insulin and HOMAIR on the relationship between MDA and BMI. These data suggested that aberrant glucose-lipid metabolism, but not reduced insulin sensitivity, influenced obesity-induced oxidative stress and Rac1 expression.

Table 3.  Obesity-induced oxidative stress and augmented Rac1 expression was influenced by aberrant glucose-lipid metabolism in overweight adolescents
inline image

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods and Procedures
  5. Results
  6. Discussion
  7. ACKNOWLEDGMENTS
  8. DISCLOSURE
  9. References
  10. Supporting Information

The primary purpose of the present study was to identify whether and how NADPH oxidase plays a role in overweight adolescents without comorbidities. Here, we provided novel experimental evidences showing that NADPH oxidase in the monocytes was highly activated by enhancing Rac1 expression in Chinese overweight adolescents. Moreover, our findings also suggested that obesity-induced aberrant glucose-lipid metabolism may be among the intermediary mechanisms to oxidative stress and Rac1 expression in overweight adolescents.

The number of overweight and obese adolescents in China has been significantly increasing in the last two decades. It has been clearly demonstrated that the earliest signs of coronary heart disease, such as coronary artery fatty streaks, already presented in childhood and rapidly increased during adolescence particularly in obese adolescents (18,19,20). In recent years, oxidative stress is recognized for its critical role in the pathogenesis of diabetes and atherosclerosis in obese individuals. Most of these studies were performed in adults (4,21), and there was only a limited number of studies of the oxidative damage caused by obesity in childhood. Evidence showed that oxidative stress occurred in obese adolescents before the appearance of a multi-metabolic syndrome (18,22,23). In the present study, we indicate that the oxidative stress occurred in overweight adolescents, presented by decreased SOD activity and elevated MDA. Moreover, we analyzed the correlation between oxidative stress and obesity-related indexes by association analysis. The results showed the significant positive correlation between obesity and oxidative stress. Complied with previous studies, these data suggested that oxidative stress may play a key role in obesity-related disease in adolescents.

NADPH oxidase, the major source of ROS in the monocytes, is a multicomponent protein that is strongly implicated in the development of atherosclerosis. Recent evidences indicated that NADPH oxidase is highly activated in multiple diseases including metabolic syndrome, obese and diabetes (4). Therefore, we investigated whether NADPH oxidase is responsible for obesity-induced oxidative stress. As the data shown, Rac1, one of NADPH oxidase subunits, was upregulated in overweight adolescents. Furthermore, we analyzed the correlation between expression of Rac1 and obesity-related indexes by association analysis. The results showed a significant positive correlation between BMI or trunk fat and Rac1 level, suggesting that Rac1 expression is closely correlated with obesity. In addition, the expression of Rac1 is also correlated with oxidative stress, indicating that Rac1 may be involved in oxidative stress in obesity. Taken together, we suggest that Rac1 may act as a link between obesity and oxidative stress. And to the best of our knowledge, these is the first observation evaluating the effects of obesity on the expression of oxidative stress associated NADPH oxidase in the monocytes in overweight adolescents with normal levels of glucose and lipids.

Previous studies showed that NADPH oxidase was activated by different manners on different stimuli. Significant enhanced expression of p22phox occurred in diabetes and metabolic syndrome patients (4,10), and increased expression of gp91phox, p22phox, and p47phox occurred in cardiovascular system in response to the injury in human and animal model (5,6,11,20). Here, we show increased expression of Rac1, but not gp91phox, p22phox, and p47phox, in overweight adolescents. Importantly, overweight adolescents are in a state prior to the appearance of a multi-metabolic syndrome. The clinical characteristics in all adolescents were within normal limits. Moreover, no significant difference in glucose or lipid level occurred in overweight adolescents. Therefore, upregulation of Rac1, but not gp91phox, p22phox, and p47phox may induce the activation of NADPH oxidase in overweight adolescents, indicating that the activation of NADPH oxidase may differ from those in different disease state.

As for the stimuli for Rac1 activation, it was ambiguous. Though overweight adolescents displayed slight differences in glucose and lipid metabolism and reduced insulin sensitivity, there is no significant difference in glucose, lipid level and insulin resistance in overweight adolescents. Therefore, we evaluated the effect of aberrant glucose-lipid metabolism or reduced insulin sensitivity on obesity-induced oxidative stress and Rac1 upregulation by partial correlation analysis. The data indicated that reduced insulin sensitivity caused by obesity played a little role in obesity-induced oxidative stress and Rac1 expression, while aberrant glucose-lipid metabolism may be related to Rac1-induced oxidative stress. Furthermore, elevated FBG level played a more important role in this process compared with abnormal lipid level.

Total body fatness and abdominal obesity are strongly associated with risk of atherosclerosis diseases and are the better prognostic markers of cardiovascular disease comparing to BMI (24). In the present study, dual X-ray absorptiometry-determined trunk fat percentage was more consistently related to MDA, SOD, and expression of Rac1 than BMI under the influence of glucose and lipids. These data suggested that in overweight adolescents, the degree of adiposity represented by trunk fat might be more important markers than BMI to affect the systemic oxidative stress and its related Rac1 expression.

The present study provided the first information concerning relations between obesity and systemic oxidative stress and expression of Rac1 in the monocytes of healthy overweight adolescents. Our results indicated that Rac1 may act as a link between obesity and oxidative stress. Adiposity-induced oxidative stress and augmented Rac1 expression was influenced by aberrant glucose-lipid metabolism in overweight adolescents. These observations may provide novel insight into the molecular mechanisms underlying the association between overweight and increased risk of atherosclerotic diseases in adolescents.

ACKNOWLEDGMENTS

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods and Procedures
  5. Results
  6. Discussion
  7. ACKNOWLEDGMENTS
  8. DISCLOSURE
  9. References
  10. Supporting Information

This project was funded by National Basic Research Program of China (2012CB 517502), National Social Science foundation, The Ministry of Education of China (BLA060052), National Natural Science foundation of China (81070634, 30801218), National Natural Science Foundation of Beijing (7092090).

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods and Procedures
  5. Results
  6. Discussion
  7. ACKNOWLEDGMENTS
  8. DISCLOSURE
  9. References
  10. Supporting Information

Supporting Information

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods and Procedures
  5. Results
  6. Discussion
  7. ACKNOWLEDGMENTS
  8. DISCLOSURE
  9. References
  10. Supporting Information

Supporting Information

FilenameFormatSizeDescription
oby_2757_sm_oby201263_coi.pdf2241KSupporting info item

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.