SEARCH

SEARCH BY CITATION

Keywords:

  • myelodysplastic syndromes;
  • mitochondrial DNA mutations;
  • cytochrome c-oxidase genes;
  • apoptosis;
  • iron-laden mitochondria

Abstract

  1. Top of page
  2. Abstract
  3. Patients and methods
  4. Results
  5. Discussion
  6. Acknowledgments
  7. References

Summary.  Mitochondria (mt) play an important role in both apoptosis and haem synthesis. The present study was conducted to determine DNA mutations in mitochondrial encoded cytochrome c-oxidase I and II genes. Bone marrow (BM) biopsy and aspirate, peripheral blood (PB) and buccal smear samples were collected from 20 myelodysplastic syndrome (MDS) patients and 10 age-matched controls. Cytochrome c-oxidase I (CO I) and II (CO II) genes were amplified using polymerase chain reaction and sequenced. CO I mutations were found in 13/20 MDS patients and the CO II gene in 2/10 normal and 12/20 MDS samples, irrespective of MDS subtype. Mutations were substitutional, deletional and insertional. CO I mutations were most common at nucleotide positions 7264 (25%) and 7289 (15%), and CO II mutations were most common at nucleotide positions 7595 (40%) and 7594 (30%), suggesting the presence of potential ‘hot-spots’. Mutations were not found in buccal smears of MDS patients and were significantly higher in MDS samples compared with age-matched controls in all cell fractions (P < 0·05), with bone marrow high-density fraction (BMHDF) showing a higher mutation rate than other fractions (P < 0·05). MDS marrows showed higher levels of apoptosis than normal controls (P < 0·05), and apoptosis in BMHDF was directly related to cytochrome c-oxidase I gene mutations (P < 0·05). Electron microscopy revealed apoptosis affecting all haematopoietic lineages with highly abnormal, iron-laden mitochondria. These results suggest a role for mt-DNA mutations in the excessive apoptosis and resulting cytopenias of MDS patients.

Mitochondria (mt) were once independently living bacteria that have become a permanent part of the eukaryotic cell through an ancient symbiotic contract (Margulis & Schwartz, 1999). They continue to exert some level of autonomy, however, as they maintain 5–10 copies of their own 16 500 base pair circular DNA (mt-DNA), replicate independently of nuclear DNA, and code for 13 subunits of the respiratory chain multienzyme complex, 22 transfer RNAs and 2 ribosomal RNAs (Anderson et al, 1981). As every cell has several mitochondria, and every mitochondrion has multiple copies of mt-DNA, this amounts to thousands of copies of mt-DNA per cell. In addition to coding for 13/80 subunits of the respiratory chain multienzyme complex essential for the electron transport system involved in haem synthesis, a role for mitochondria has also been identified in the initiation of cellular apoptosis (Petit et al, 1995; Green & Reed, 1998; Hunault-Berger et al, 1999). Given the appreciation of their significant role in maintaining cellular homeostasis, it is no surprise that mitochondrial mutations are associated with a number of human diseases. These include both congenital diseases such as Pearson's syndrome (Rotig et al, 1989) characterized by a refractory sideroblastic anaemia and bone marrow dysplasia, as well as acquired ones such as various cancers (colorectal, head and neck, lung and primary bladder cancers) (Habano et al, 1999; Fliss et al, 2000) and acquired idiopathic sideroblastic anaemia (AISA) (Gatterman et al, 1992, 1993, 1996, 1997; Gatterman, 1999; Matthes et al, 2000). Because of the contribution of mitochondria in both haem synthesis and apoptosis, there has been an increasing interest in investigating the role of mt-DNA mutations in myelodysplastic syndromes (MDS) in which iron-laden, swollen and bizarre mitochondria are associated with an acquired anaemia, variable cytopenia and excessive apoptosis of haematopoietic cells (Jacobs, 1986; Gatterman, 1999).

The MDS are a group of clonal, heterogeneous haematopoietic disorders presenting with anaemia, a variable cytopenia and bone marrow dysplasia (Jacobs & Bowen, 1992). Excessive intramedullary apoptosis of haematopoietic cells is postulated to account for the variable cytopenias of MDS (Clark & Lampert, 1990; Mundle et al, 1995; Raza et al, 1995; Shetty et al, 1996). However, the precise mechanism by which haem synthesis is impaired leading to anaemia and accumulation of iron in the mitochondria of erythroid precursors is not clear. Normally, iron is imported into the mitochondria of erythropoietic cells, combines with protoporphyrin IX to form haem and subsequently leaves the mitochondria as haem iron (Jacobs, 1986; Gatterman, 1999). In MDS, utilization of iron is obviously disturbed, so that iron accumulates in the mitochondrial matrix and gives the appearance of ringed sideroblasts (Jacobs, 1986; Jacobs & Bowen, 1992). A possible explanation for this defect is that iron may not be in the right chemical form (Gatterman et al, 1992, 1993, 1997; Matthes et al, 2000). Iron deposits in the sideroblastic mitochondria are in the ferric (Fe3+) state, while only ferrous iron can be used for incorporation into protoporphyrin IX by ferrochelatase (Porra & Jones, 1963). As ferrous iron is not stable under aerobic conditions, it is necessary for erythropoietic cells to have an enzyme system that can maintain a supply of Fe2+ as substrate for ferrochelatase. It was shown that the electrons for the conversion of ferric iron into ferrous iron are provided by the mitochondrial respiratory chains (Flatmark & Romslo, 1975), in particular complexes III (cytochrome b) and IV (cytochrome c-oxidase) (Gatterman, 1999). It has been hypothesized that malfunction of one or of several of the enzyme complexes of the mitochondrial encoded respiratory chain genes may contribute to the inefficient reduction of iron in MDS and that this malfunction could be caused by mutations of nuclear DNA or of mitochondrial DNA, both of which contribute to the assembly of respiratory chain complexes (Jacobs, 1986; Jacobs & Bowen, 1992; Gatterman, 1999). Previous studies have revealed the presence of mt-DNA mutations affecting cytochrome c-oxidase I gene in two patients with AISA (Gatterman et al, 1997), but the other varieties of MDS have not been investigated. The current study was conducted to not only detect mutations in mt-DNA encoded cytochrome c-oxidase I and II genes, but also to explore the relevance of these mutations in the excessive apoptosis of haematopoietic cells in MDS. Our results indicate an unexpectedly high rate of mutations among 16/20 MDS patients examined.

An additional unique feature of this study is related to detailed morphological examination of mitochondria in bone marrow (BM) biopsy tissue of MDS patients. In the past, electron microscopic (EM) studies could not be performed on BM biopsies because the decalcification process destroys ultrastructural detail (Cohen et al, 1997). A novel decortication technique was used to mechanically tease apart the pieces of bone from the BM biopsy samples prior to embedding the tissue for EM studies (Weiss, 1976). By eliminating the chemical decalcification step, it was possible to examine the morphological details of iron-laden, swollen and bizarrely shaped mitochondria present in both apoptotic and non-apoptotic dysplastic cells of MDS patients. In addition, both stromal and parenchymal MDS cells could be investigated precisely as they exist in vivo with well-preserved geographical relationships. These studies have resulted in the recognition of novel, previously unrecognized ultrastructural details of mitochondria as well as apoptotic stromal and parenchymal cells in MDS bone marrows. To our knowledge, the present study is the first to investigate simultaneously the morphological ultrastructural details of mitochondria in MDS BM biopsies, and to examine mitochondrial DNA for the presence of mutations in cytochrome c-oxidase genes. Both aspects of the study shed new light on the role of mitochondria in the pathology and perhaps aetiology of cytopenias in patients with myelodysplastic syndromes.

Patients and methods

  1. Top of page
  2. Abstract
  3. Patients and methods
  4. Results
  5. Discussion
  6. Acknowledgments
  7. References

The present study was conducted on peripheral blood (PB), bone marrow (BM) aspirates, BM biopsies and buccal smears obtained from 20 patients with a confirmed diagnosis of myelodysplastic syndromes and 10 normal, age-matched controls (mean ages were 64 years for MDS patients and 62 years for controls). The normal control subjects were healthy volunteers. Informed consent was obtained from every individual.

Samples.  PB, BM aspirate, BM biopsy and buccal smear samples were collected and transported on ice to the laboratory. PB (10–15 ml) was collected in tubes containing EDTA as an anticoagulant. BM aspirate (15–20 ml) was aspirated directly into a syringe containing 3 ml of 2% sodium citrate. The low- and high-density mononuclear cell fractions (LDF, HDF) were separated from PB and BM aspirate samples using Ficoll–Hypaque 1077 density gradient solution (Amersham Pharmacia Biotech, Piscataway, NJ, USA). Cells from high- and low-density fractions of PB and BM were used for detection of mitochondrial DNA mutations.

Detection of mitochondrial DNA (mt-DNA) mutations.  The total DNA was extracted from LDF and HDF mononuclear cells and buccal smear cells using the Capture Column Kit from Gentra Systems, Inc. (Minneapolis, MN, USA). The primers for cytochrome c-oxidase I and cytochrome c-oxidase II genes of mitochondria were designed using VECTOR NTI (Infor Max, Inc. Bethesda, MD, USA) software program from the mitochondrial sequence (accession # NC 001807) and synthesized by Integrated DNA Technologies Inc., Coralville, IA, USA. The primer sequences are provided in Table I. The mitochondrial DNA was amplified by the polymerase chain reaction (PCR) using 35 cycles of denaturation (30 s at 94°C), annealing (45 s at 55°C) and extension (1 min at 72°C). The 100 µl PCR reactions contained 10 mmol/l KCl, 20 mmol/l Tris-HCl (pH 8·8), 400 µmol/l of each dNTP, 100 ng of each primer and 5 units of Amplitaq DNA polymerase (Perkin-Elmer Applied Biosystems, Foster City, CA, USA). The amplified PCR products for cytochrome c-oxidase I and cytochrome c-oxidase II genes were visualized using ethidium bromide staining of 2% agarose gels. The amplified PCR products were sequenced using the automated DNA sequencer (MWG Biotech, High point, NC, USA). The sequence comparison was made using BLAST SEARCH program (National Center for Biotechnology Information (NCBI), 2001). The amino acid sequences for cytochrome c-oxidase genes I and II were obtained using MITOMAP (2001).

Table I.  The primers used to detect the mutations in mitochondrial encoded cytochrome c-oxidase I and cytochrome c-oxidase II genes.
Gene namePrimer sequenceSize(bp)Primer binding position
(1) Cyt. c OXIF5′ACTACCCCGATGCATACACCACATG3′3757227
Cyt. c OXIR5′TGCGCTGCATGTGCCATTAAGATAT3′ 7601
(2) Cyt.c OX IIF5′ATGGCACATGCAGCGCAAGTAGG3′4007585
Cyt. c OXIIR5′GCAGGTCGCCTGGTTCTAGGAATAA3′ 7984

Assessment of apoptosis using in situ end labelling (ISEL). Long-core BM biopsies were obtained from every individual and placed in saline. Under aseptic conditions, these biopsies were cut into two segments. One half was placed in Bouins fixative embedded in plastic using glycol methacrylate; 2- to 3-μm thick sections were placed on Alcian blue-coated coverslips for detection of apoptosis by ISEL. The second half was used for electron microscopy (EM) as described below. Assessment of apoptosis was made using the ISEL technique as described by Wijsman et al (1993) and modified for use in plastic-embedded biopsy samples. Briefly, the cells were pretreated with sodium chloride and sodium citrate (SSC) solution at 80°C and 1% pronase (1 mg/ml in 0·15 mol/l phosphate-buffered saline; Calbiochem, La Jolla, CA, USA). The sections were then incubated at 18°C with a mixture of 0·01 mol/l deoxyadenosine, deoxycytidine and deoxyguanosine 5′-triphophates (dATP, dCTP and dGTP) (Promega, Madison, WI, USA); 0·001 mol/l biotinylated uridine 5′-triphosphate(bio-dUTP) (Sigma Chemical Co, St. Louis, MO, USA); and 20 U/ml DNA polymerase I (Promega). Incorporation of bio-dUTP was finally visualized using an avidin–biotin peroxidase conjugate (Vectastatin Elite ABC kit; Vector, Burlingham, CA, USA) and diamino benzidine tetrachloride. Thus, cells labelled positively for ISEL showed brown staining in their nuclei under the light microscope. The controls for these experiments were carried out as described before (Mundle et al, 1995; Raza et al, 1995; Shetty et al, 1996). A subjective quantitative scale was formulated to determine the degree of positivity as follows: negative, low, intermediate and high. Negative or absent indicates that there were less than 15% ISEL-positive cells; low, 1–3+ or 15–30%; intermediate, 4–5+ or 31–75%: and high 6–8+ or greater than 75% ISEL-positive cells.

Ultrastructural studies using electron microscopic studies of decorticated BM biopsy tissue.  The second half of the BM biopsy was processed for ultrastructural studies (Shetty et al, 2000). Briefly, the method involved perfusion of the bone with 3% glutaraldehyde, further immersion for 15 min, and then careful teasing of the BM by decortication. Processing for transmission EM was carried out using standard techniques. After fixation the cells were post fixed in osmium tetroxide, treated with alcohol and propylene oxide, and embedded in Araldite (EM sciences, Washington, PA, USA) at 58°C for 48 h. The biopsies were then processed for semithin and ultrathin sections. Semithin sections were stained with toluidine blue and evaluated by light microscopy. Ultrathin sections were contrasted with uranyl acetate and lead citrate and analysed using transmission electron microscope (TEM) (JEOL 200, Japan).

Statistical analysis.  The non-parametric Mann–Whitney U and chi-square tests were used for comparison between the two parameters.

Results

  1. Top of page
  2. Abstract
  3. Patients and methods
  4. Results
  5. Discussion
  6. Acknowledgments
  7. References

The study included a total of 20 MDS patients and 10 normal healthy subjects. Among the 20 MDS patients, seven patients had refractory anaemia (RA), four had refractory anaemia with ringed sideroblasts (RARS), five had refractory anaemia with excess blasts (RAEB), two had refractory anaemia with excess blasts in transformation (RAEB-t) and two had chronic myelomonocytic leukaemia (CMMoL).

Mitochondrial DNA mutations in normal subjects and MDS patients

The primers used to amplify cytochrome c-oxidase I and cytochrome c-oxidase II genes (Table I) resulted in 375 and 400 base pair PCR products respectively (Fig 1). The clinical characteristics of MDS patients are presented in Table II.

image

Figure 1. Ethidium bromide-stained agarose gel showing the polymerase chain reaction (PCR) products of mitochondrial encoded genes. Lane 1: DNA molecular weight marker, 100 bp ladder; Lane 2: 375 bp PCR product of cytochrome c-oxidase I gene. Lane 3: 400 bp PCR product of cytochrome c-oxidase II gene.

Download figure to PowerPoint

Table II.  Biological and clinical characteristics of myelodysplastic syndrome (MDS) subjects.
SubjectsAge (years)SexFAB typeCellularityISELKaryotypeMutations in Cyt.c oxidase IMutations in Cyt.c oxidase II
  • *

    N/A, data not available; FAB. French–American–British; ISEL, in situ end labelling.

MDS 150FemaleRAhyper546,XX[18]YesYes
MDS 271MaleRAhyper746,XY[20]YesYes
MDS 347MaleRAhyper446,XY,del (20)(q11.2q13.3)[19]/46,XY[1]NoYes
MDS 471MaleRAhyperN/A46,XY,del (20)(q11.2q13.1)NoNo
MDS 589FemaleRAN/AN/AN/ANoNo
MDS 677MaleRAhyper846,XY[20]YesNo
MDS 764FemaleRAhyper045,XX,−7[19]/46,XX[1]YesYes
MDS 828FemaleRAhyperN/A46,XX[20]YesYes
MDS 935FemaleRARSnormal8N/AYesYes
MDS 1076MaleRARShyper646,XY,del(7)(q22q36)[13]/46,XY[6]/NCA: 47,XY,del(7)(q22q36), +8YesYes
MDS 1162MaleRARSN/A3N/AYesYes
MDS 1265MaleRARSN/AN/AN/ANoYes
MDS 1370MaleRAEBhypo346,XY,del(5)(q15q33)[10]/46,XY[10]NoNo
MDS 1472MaleRAEBhyper447,XY, +8[10]/45,XY,−7[6]/46,XY[4]NoNo
MDS 1570MaleRAEBnormal546,XY[20]YesYes
MDS 1672MaleRAEBhyper146,XY[20]YesNo
MDS 1779MaleRAEB-thypoN/A46,XY[20]YesNo
MDS 1866FemaleRAEB-tN/A045,XX,−4,−5,add(17)(p11.2),mar[3]/45,XX,dup(1)(p21p32), ?del(4)(q21),−5,−6,−7,+12,add(12) (q21),add(17)(p11.2), −18,−19, +21, +2–3mar[16]/46,XX[1]YesYes
MDS 1964FemaleCMMoLhyper046,XX[20]YesNo
MDS 2054MaleCMMoLhyperN/A46,XY[20]NoYes

Normal subjects

The sequence comparison of these genes revealed that no normal sample had any cytochrome c-oxidase I gene mutation (Table III) while 2/10 had cytochrome c-oxidase II mutations (Table III). In the normal subject (N2, Table III), PB LDF showed a deletional point mutation of A from nucleotide position 7622 (Table III) in the cytochrome c-oxidase II gene changing the amino acid sequence from threonine to leucine. BMLDF cells of this normal subject also showed an insertion of C at nucleotide position 7638 which resulted in a change from glutamate to threonine (Table III). In the second normal subject (N7, Table III), PBLDF showed a substitution of A to G in nucleotide position 7768, although this substitution did not change the coding for the amino acid. The same substitution was also found at nucleotide position 7768 in the BMHDF cells obtained from MDS patient #2 (Table III), and once again did not result in an amino acid change.

Table III.  Cytochrome c-oxidase I and II gene mutations in high- and low-density fractions of peripheral blood and bone marrow.
SubjectsCytochrome c-oxidase – I gene mutationsCytochrome c-oxidase – II gene mutations
Cell fractionMutation typeChange in nt.a.a. change froma.a. change toCell fractionMutation typeChange in nt.a.a. change froma.a. change to
MDS 1BMHDFSubstitutionalC–A 7264 Terminating codonPBLDFSubstitutionalG–C 7595AlanineProline
MDS 2PBLDFInsertionalIns. T 7442SerineSerineBMHDF PBLDF PBLDFSubstitutional Substitutional SubstitutionalA–G 7768 T–A 7806 C–A 7810Methionine Valine LeucineMethionine Aspartate Leucine
MDS 3ALL FNO   BMHDFDeletionalDel A7625SerineLeucine
MDS 4ALL FNO   ALL FNO   
MDS 5ALL FNO   ALL FNO   
MDS 6PBHDFSubstitutionalC–T 7582 t-RNA-AspALL FNO   
MDS 7BMHDFDeletionalDel A 7289LeucineLeucinePBLDFSubstitutionalT–G 7594HistamineGlutamine
PBLDFDeletionalDel A 7289LeucineLeucinePBLDF BMLDF BMLDF BMLDFSubstitutional Insertional Insertional SubstitutionalG–C 7595 Ins. C 7758 Ins. A 7814 C–T 7981Alanine Alanine Alanine AspartateProline Alanine Serine Aspartic acid
MDS 8BMHDFInsertionalIns.G 7464 t-RNA-serPBLDF BMLDF BMHDF BMHDFInsertional Insertional Substitutional SubstitutionalIns.A 7793 Ins.A 7793 T–G 7594 G–C 7595Alanine Alanine Histamine AlanineSerine Serine Glutamine Proline
MDS 9BMHDFSubstitutionalC–A 7264 Terminating codonPBHDF PBHDFSubstitutional SubstitutionalT–G 7594 G–C 7595Histamine AlanineAlanine Histamine
MDS 10PBLDFSubstitutionalA–G 7519 t-RNA-aspPBHDFSubstitutionalC–A 7794AlanineAspartate
BMHDFSubstitutionalG–C 7444SerineThreonine     
BMLDFSubstitutionalC–A 7264 Terminating codon     
MDS 11PBHDFSubstitutionalT–C 7572 t-RNA-aspPBHDFInsertional SubstitutionalIns.G 7623 T–G 7898Threonine TyrosineGlycine Aspartate
MDS 12ALL FNO   PBLDFSubstitutional SubstitutionalT–G 7594 G–C 7595Histamine AlanineGlutamine Proline
MDS 13ALL FNO   ALL FNO   
MDS 14ALL FNO   ALL FNO   
MDS 15BMHDFDeletionalDel C 7264SerineTyrosinePBLDF PBLDF PBLDF PBLDFSubstitutional Substitutional Substitutional SubstitutionalC–T 7650 T–C 7705 C–T 7868 C–T 7891Threonine Tyrosine Leucine HistamineIso-leucine Tyrosine Phenylalanine Histamine
MDS 16BMHDFInsertionalIns. G 7463 t-RNA-serALL FNO   
BMLDFDeletionalDel A 7289LeucineLeucine     
MDS 17BMHDFSubstitutionalC–G 7502 t-RNA-serALL FNO   
MDS 18BMHDFDeletionalDel. A 7289LeucineLeucinePBHDFDeletionalDel A 7622AlanineLeucine
BMLDFInsertionalIns.G 7463 t-RNA-serBMHDF PBLDF PBLDF PBLDFDeletional Deletional Substitutional SubstitutionalDel A 7622 Del A 7622 T–G 7594 G–C 7595Alanine Alanine Histamine AlanineLeucine Leucine Glutamine Proline
MDS 19PBHDFSubstitutionalT–G 7549 t-RNA-aspALL FNO   
MDS 20ALL FNO   BMHDF BMHDF PBLDF PBLDFSubstitutional Substitutional Substitutional SubstitutionalT–G 7594 G–C 7595 T–G 7594 G–C 7595Histamine Alanine Histamine AlanineGlutamine Proline Glutamine Proline

MDS patients

The mitochondrial DNA mutations in MDS subjects described below are specific to the bone marrow and blood cells, as there were no mutations detected in matched buccal smear cells. Sixteen of the 20 MDS cases studied showed mt-DNA mutations, four in cytochrome c-oxidase gene I only, three in cytochrome c-oxidase gene II only, and nine in both genes. Among the 13 cases with cytochrome c-oxidase gene I mutations, two had deletional, two had insertional, seven had substitutional mutations, while two patients (MDS #16 and #18, Table II) had both deletional and insertional mutations. Details of the specific mutations and their consequences in amino acid change are provided in Table III. This rate of mt-DNA mutations was significantly higher than age-matched normal subjects (P < 0·05). Cytochrome c-oxidase I mutations were most frequently seen at nucleotide positions 7264 (25%) and 7289 (15%), and cytochrome c-oxidase II gene mutations were most frequently seen at nucleotide positions 7594 (30%) and 7595 (40%). The BMHDF cells showed a significantly higher percentage (45%) of cytochrome c-oxidase I mutations (Fig 2) than all other cell fractions tested (P < 0·05). The MDS subjects also showed a significantly higher percentage of mutations in the cytochrome c-oxidase II gene (P < 0·05) than their age-matched controls.

image

Figure 2. The percentage distribution of myelodysplastic syndrome (MDS) patients and normal healthy subjects showing the mitochondrial DNA encoded cytochrome c-oxidase I and II gene mutations in low- and high-density cell fractions of peripheral blood and bone marrow.

Download figure to PowerPoint

Types of mt-DNA mutations in cytochrome c-oxidase gene I (Table III)

In cytochrome c-oxidase gene I, there were a total of 18 mutations identified. Of these, nine were substitutions, five were deletions and four were insertions. Among the nine substitutions, three were C–A (np7264). The others were C–G (np7502), A–G (np7519), G–C (np7444), T–G (np7549), T–C (np7572) and C–T (np7582). Four of the five deletions were a missing A at np7289 and the fifth was a deletion of C from np7264. The four insertions were one at T (np 7442), two were an insertion of G at np7463 and one was an insertion of G at np7464. This makes the deletion of A (np 7289) the most common mt-DNA mutation present in 4/18 instances, followed by C–A substitution present in 3/18 instances. The mutations at positions 7582 (MDS #6), 7519 (MDS #10), 7572 (MDS #11) and 7549 (MDS #19) were in the coding regions of t-RNA-aspartate and the mutations at positions 7464 (MDS #8), 7463 (MDS #16 and 18) and 7502 (MDS #17) were in the coding regions of t-RNA serine.

Types of mutations in cytochrome c-oxidase gene II (Table III)

Thirty-four mutations were identified in gene II. Of these, 25 were substitutions, five were insertions and four were deletions. Eight patients had substitution of G–C (np7595), seven had a substitution between T–G (np7594). Four were substitutions of C–T at np7650, 7868, 7891 and 7981. The others were substitution of C–A in two instances, T–C in one, T–G in one, A–G in one and T–A in one. One had insertion of C at np7758, two had insertion of A at np7793, one had insertion of A at np7814 and one had insertion of G at 7623. Among the four deletions, three had a deletion of A from np7622 and one had a deletion of A from np7625. This makes G–C substitutions (present in eight instances), T–G substitutions (present in seven instances), C–T substitutions (present in four instances), and deletion of A (present in four cases) as the four most common types of mt-DNA mutations in gene II.

‘Hot spots’ for mitochondrial DNA mutations in cytochrome c-oxidase gene I and II in MDS

Certain ‘hot spots’ were identified in cytochrome c-oxidase genes I and II that were frequently involved in a mutational event. The most common site of mt-DNA mutation was nucleotide position 7595 in cytochrome c-oxidase gene II where a substitutional change G–C affected a coding region changing the amino acid alanine to proline. This mutation was found in eight MDS patients (40%), three belonging to RA, two to RARS, one RAEB-t and one CMMoL patient. In only two cases was this mutation detected in the BM MNC, both in the HDF (MDS # 8 and 18), while six cases had the mutation in the PB, five of them in the LDF. The second common mutation in cytochrome c-oxidase gene II was a substitutional change in six MDS patients (30%) at nucleotide position 7594 from T–G resulting in a switch in amino acid from histamine to glutamine. These seven patients were the same ones who also had the substitutional mutation at np7595 described above (Table III). Once again, 4/6 patients with this mutation had it in the PB only, one in the BM only and one in both PB and BM. In four (20%) cases, there was a mutation in cytochrome c-oxidase gene I at np 7264, which was substitutional in three (MDS # 1, 9 and 10), and in one (MDS # 15) it was a deletion. The substitutional mutation was from C to A in a terminating codon (Table III) in three MDS patients (MDS # 1, 9 and 10), while in MDS # 15 a deletion of C at np 7264 resulted in an amino acid change from serine to tyrosine. Cytochrome c-oxidase gene I np 7289 was mutated in 15% MDS patients (Table III).

Mitochondrial DNA mutations in PB versus BM and in mature versus immature cell compartments of individual patients

An interesting observation was the detection of different mitochondrial DNA mutations in the peripheral blood versus bone marrows of the same patient as well as differences in different fractions of cells within the same compartment. These differences are described in detail in Table III, affected both genes and were also present in a normal subject (N #2), as shown in Table III. In MDS #1, for example, there was a substitutional mutation (C–A) detected in the terminating codon of cytochrome c-oxidase gene I at np7264 in BMHDF, while a substitution between G–C was noted at np7595 in PBLDF resulting in an amino acid change from alanine to proline. Table III shows that there were many variations present within the different cell compartments in different patients. Patient MDS #7 showed a deletional mutation in gene I in BMHDF only, and none in BMLDF. In the same patient, PBLDF only showed three different point mutations, one being deletional and two being substitutional, while none were detectable in PBHDF. One explanation for this seeming incongruity is that there are several thousand mitochondria per cell and, given their heteroplasmic transmission during mitosis, not all daughter cells receive the same share of mitochondria. Thus cells which are able to mature more (HDF) than others (LDF) may have different numbers of mitochondria containing mutated DNA. A similar explanation can be given for cells that are able to exit the marrow (PB) versus those that undergo intramedullary apoptosis (BM).

Mitochondrial DNA mutations and the FAB categories

There were eight patients with RA and six of them showed mutations, while all four RARS patients had mt-DNA mutations. Of the six RA cases with mutations, four showed mutations in both genes (MDS # 1, 2, 7 and 8, Table III), one in cytochrome c-oxidase I only (MDS # 6) and one (MDS # 3) in cytochrome c-oxidase gene II only (Table III). All three RARS patients had mt-DNA mutations affecting cytochrome c-oxidase gene I that were substitutional. MDS #9 and 12 had T–G substitution at nucleotide position 7594. Both these mutations were present in a coding region and resulted in an amino acid change from histamine to glutamine. Nucleotide position 7594 appears to be a ‘hot spot’ for substitutional mutations (T–G) in cytochrome c-oxidase gene II as it was affected in four other MDS patients (MDS # 7, 8, 18 and 20), and resulted in each case in an amino acid change from histamine to glutamine (Table III). The mutation appeared to be independent of French–American–British (FAB) subtype as the mutations were seen in two RA (MDS # 7 and 8), two RARS (MDS #9 and 12), one RAEB-t (MDS # 18) and one CMMoL (MDS # 20). On the whole, 30% of MDS patients had mt-DNA mutations at this nucleotide position. Of the four RAEB patients studied, two did not have any evidence of mt-DNA mutations (MDS # 13 and 14), while two had mutations (MDS # 15 and 16). Details regarding the type of mutations and whether these affected a coding region or not and their consequences on amino acid change are described in Table III. There were two RAEB-t patients included in the study, and both showed mt-DNA mutations in cytochrome c-oxidase gene I (MDS # 17 and 18), while one also had a deletional mutation in cytochrome c-oxidase gene II (MDS # 18). Both CMMoL patients (MDS # 19 and 20) showed substitutional mutations, one in cytochrome c-oxidase gene I (MDS # 19) and the other in cytochrome c-oxidase gene II (MDS # 20).

Ultrastructural and apoptosis studies of BM biopsies in MDS and normal subjects

Morphological details of the BM biopsies from normal subjects and MDS patients were evaluated by EM. The ultra structural details were well preserved in normal biopsies. MDS marrow showed an excessive degree of apoptosis in cells belonging to all lineages (Fig 3). However, the apoptosis was predominantly seen in the myeloid and erythroid lineages as reported earlier (Mundle et al, 1995; Raza et al, 1995; Shetty et al, 1996). The stromal cells showed relatively little apoptosis. Mitochondrial morphology is represented graphically in Fig 4. It was well preserved in normal marrow (Fig 4E); however, MDS bone marrow showed grossly abnormal, iron-laden mitochondria in both erythroid (Fig 4A and C) and myeloid (Fig 4B and D) lineages. MDS bone marrow also contained large numbers of apoptotic cells with swollen and grotesquely distorted mitochondria.

image

Figure 3. The myelodysplastic syndrome (MDS) bone marrow showing overall incidence of apoptosis in erythroid, myeloid and megakaryocytic lineages (uranyl acetate and lead citrate, original magnification ×1600).

Download figure to PowerPoint

image

Figure 4. Ultrastructure studies of mitochondria from myelodysplastic syndrome (MDS) patients (A–D) and normal (E) bone marrow. (A) The ringed sideroblast showing the characteristic iron-laden mitochondria (uranyl acetate and lead citrate, original magnification ×8300). (B) The myeloid cell showing abnormal mitochondria (uranyl acetate and lead citrate, original magnification ×6600). (C) Note the dense iron deposits in the mitochondria of a sideroblast (uranyl acetate and lead citrate, original magnification ×33000). (D) Note the swollen cristae and dense deposits in the mitochondria of a myeloid cell (uranyl acetate and lead citrate, original magnification ×33000). (E) A cell depicting a normal mitochondria with well-preserved cristae (uranyl acetate and lead citrate, original magnification ×20000).

Download figure to PowerPoint

Apoptosis studies in MDS and normal subjects using ISEL technique

The degree of apoptosis was measured in plastic-embedded BM biopsies using in situ labelling of fragmented DNA (Fig 5). Apoptosis was seen not only in all the three haematopoietic lineages ( myeloid, erythroid and megakaryocytic) but also in stromal cells. MDS patients had a significantly higher level of apoptosis than normals (P < 0·05). The level of apoptosis was significantly higher in patients with mutations in BM high-density fractions (P < 0·05).

image

Figure 5. High percentage of apoptosis in haematopoietic and stromal cells of myelodysplastic syndrome (MDS) bone marrow using the in situ end labelling (ISEL) technique.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Patients and methods
  4. Results
  5. Discussion
  6. Acknowledgments
  7. References

We report an exceptionally high rate of DNA mutations in the mitochondrial encoded cytochrome c-oxidase I and II genes in 16/20 MDS patients studied. Gatterman et al (1997) described mitochondrial DNA mutations in cytochrome c-oxidase I in acquired idiopathic sideroblastic anaemia, but to our knowledge this is the first report of mt-DNA mutations affecting cytochrome c-oxidase gene II in all subcategories of MDS patients. Several features of this study were unique and are summarized below.

• mt-DNA mutations were only found in the haematopoietic cells of MDS patients and were not found in matched buccal smear samples.

• Mutations were insertional, deletional, substitutional or a combination.

• Cells obtained from the bone marrow high-density fraction were the most likely to contain mt-DNA mutations. These cells represent the more mature fraction of the sample, and have already been shown to contain large numbers of apoptotic cells in MDS patients. Cells containing mt-DNA mutations, albeit with a lesser frequency, were also found in low-density BM fraction and both low- and high-density fractions of peripheral blood compartments.

• mt-DNA mutations present in the bone marrow were not necessarily the same as, or even present, in the peripheral blood and vice versa.

• Both cytochrome c-oxidase gene I (13/20 patients) and cytochrome c-oxidase gene II (12/20 patients) were affected equally, and the majority of mutations were substitutional.

• Certain frequently involved ‘hot spots’ were identified for cytochrome c-oxidase gene I mutations affecting nucleotide positions 7264 (25%) and 7289 (15%), and cytochrome c-oxidase gene II mutations affecting nucleotide positions 7595 (40%) and 7594 (30%). The mutation at np7595 resulted in a substitution of G to C changing the amino acid from alanine to proline, and at np7594, between T to G changing the amino acid from histamine to glutamine. Seven MDS patients had the substitutional mutation at np7595 and six of these same patients also had the substitutional mutation at np7594. Although these mutations were within the primer binding sites, they could not be artefactual because we sequenced both strands to detect these mutations.

• Patients belonging to all FAB categories of MDS were found to have mt-DNA mutations, but they were most consistently present in RARS patients (4/4). No mt-DNA mutation was uniquely related to a specific FAB category.

• There was a significant association between mitochondrial encoded cytochrome c-oxidase gene I mutations in the high-density fraction of mononuclear cells and the level of apoptosis in the BM biopsies (P < 0·05).

• None of the mitochondrial mutations described here are polymorphic as they have not been recorded in the human mitochondrial genome database (MITOMAP, 2001). This does not exclude the presence of unknown polymorphisms.

• Electron microscopic studies conducted on decorticated bone marrow biopsy tissue enabled the first investigation of ultrastructural detail of mitochondria in both apoptotic and non-apoptotic cells belonging to haematopoietic stromal and parenchymal lineages. Normal as well as bizarre, swollen and iron-laden mitochondria were clearly identified.

The first important point is that mt-DNA mutations identified in this study did not represent previously recorded polymorphisms. Rather, they appeared to be acquired mutations which were unique to the haematopoietic cells of MDS patients as they were absent in buccal smears obtained from the same patients. Mutations were more common in cytochrome c-oxidase gene I than in gene II. Of the 18 instances of mt-DNA mutations identified in gene I, there were nine substitutions, the most common being three instances of substitution between C–A. In cytochrome c-oxidase gene II, the most common type of mutations were substitutions present in 25 instances, followed by five insertions. Certain nucleotide positions were frequently affected in gene II and two of these at np7594 and np7595 can definitely be considered as ‘hot spots’ for mt-DNA mutations. These resulted in an amino acid change from alanine to proline when the G–C substitution occurred at np7595, and from histamine to glutamine when the T–G substitution occurred at np7594.

Some of these mutations were only found in cells obtained from either blood or the marrow, but not in both samples of the same patient. Even within a haematopoietic compartment, mutations were frequently present only in a fraction of low- versus high-density cells. At first glance, this appears counter intuitive. However, there are several plausible explanations for this observation. First, this cannot represent a sampling error as no mutations were found in normal cells of the same patients (buccal smears). Furthermore, many of these were recurrent rather than random mutations both across patients and across various samples within the same patients, making it less likely to be a methodological issue. Second, it must be remembered that the polymerase chain reaction (PCR) method used for gene amplification followed by sequencing is likely to detect the most predominant cell population within a given sample. The marrow contains more immature cells than the blood, and if the mt-DNA predominated in the mature cells, then it would only be detectable in the blood and vice versa. The same applies to various fractions of mononuclear cells separated on a density gradient, where the more mature as well as apoptotic cells being heavier sink to the bottom and are recovered in the high-density fraction. Again, if the majority of mutated mitochondria are present in the more mature or dying cells, then only cells obtained from the high-density fraction of blood or marrow will show the presence of the mutation.

Haematopoiesis in patients with myelodysplastic syndromes has repeatedly been shown to be monoclonal (Anan et al, 1995). An important question relates to the biological versus aetiological significance of mt-DNA mutations if they are only present in a fraction of cells, be they mature or immature, in an otherwise monoclonal population. Mutations could not possibly be the cause of the disease if they are absent from a subpopulation of cells which have otherwise descended from the transformed MDS parent cell as it would mean that the transformed MDS parent cell is capable of generating both cells with mutated and wild-type mt-DNA. In other words, the presence of mt-DNA mutations in a subset of cells would represent derivative populations and evolving clones, and thereby reflect the biology and not the aetiology. Given the unique multiplicity of mt-DNA and its peculiar independent replication, however, it is still actually possible for such mutations to be the initiating event despite being manifested in a subset of cells in a monoclonal population. Further studies are needed to understand the role of mitochondrial DNA mutations in clonal selection by using the phenotypically well defined early haematopoietic stem cells.

The increased level of apoptosis observed in MDS subjects in the present study is in agreement with earlier reports (Mundle et al, 1995; Raza et al, 1995; Shetty et al, 1996). Recently, Shetty et al (2000) reported that the highest percentage of apoptotic cells are recovered from the high-density fraction of MDS BM aspirates. The current observation that the highest percentage of mitochondrial encoded cytochrome c-oxidase I gene mutations are present in the high-density fraction of MDS BM aspirates suggests that there may be a relationship between the mt-DNA mutations and the level of apoptosis. However, the hypothesis that the two are related must remain speculative at best. Three main mechanisms have been proposed to implicate the role of mitochondria in apoptosis. The earliest mechanism involved the disruption of the electron transport system (ETS). For instance, gamma irradiation induces apoptosis in thymocytes by disrupting the electron transport chain, probably at the cytochrome b-c1/cytochrome c step (Scalfe, 1966). The consequence of the loss of ETS is a drop in ATP production. Such a drop in ATP production has been noted in apoptosis (Bossy-Wetzel et al, 1998). The second mechanism proposed was the activation of caspases by the cytochrome ‘c’ released from the mitochondria. Cytosolic cytochrome ‘c’ forms an essential part of the vertebrate ‘apoptosome’ which is composed of cytochrome c, Apaf 1 and procaspase-9 (Li et al, 1997). The result is activation of caspase-9, which then processes and activates other caspases to orchestrate the biochemical execution of cells. In addition to cytochrome ‘c’, mitochondria are known to release other pro-apoptotic mediators such as apoptosis-inducing factor (AIF) (Susan et al, 1999). The third mechanism proposed is the increased production of reactive oxygen species by mitochondria during apoptosis (Thress et al, 1999). Recently, Matthes et al (2000) showed an increased apoptosis owing to decreased mitochondrial membrane potential in acquired sideroblastic anaemia. Although it is not known which of these mechanisms predominates in MDS, it is clear that mitochondria constitute one of the key components in the apoptotic process and the defect in complex III and complex IV of respiratory chain might contribute towards an excessive apoptosis.

Another hallmark of the disease is that the bone marrow of MDS patients contain erythroblasts with a perinuclear ring of iron-laden mitochondria as illustrated in Figs 4A and C. Similar observations were made earlier (Cohen et al, 1997). The intramitochondrial iron deposits contain iron in the ferric (Fe3+) state and this ferric iron could be responsible for an increased production of reactive oxygen species via the Fenton reaction (Halliwell & Gutteridge, 1984). However, ferrochelatase, the enzyme that catalyses haem synthesis, is known to use iron in the ferrous form. The electrons needed for the reduction of Fe3+ to Fe2+ are physiologically generated through the electron transport system (Flatmark & Romslo, 1975). Mutations in cytochrome c-oxidase I and II genes might contribute towards the dysregulation of ETS such that the iron can no longer be converted into the right chemical form for haem synthesis. The result is a deposition of the under-utilized iron in the mitochondrial matrix of erythroid progenitors, giving rise to the pathognomonic ringed sideroblasts.

The underlying cause for increased mutations in mitochondrial encoded cytochrome c-oxidase I and II genes remains unknown. However, it has been reported that exogenous factors such as toxins and viral infections can cause mutations in mitochondria. It has also been reported that one of the known human retroviruses, the human immunodeficiency virus (HIV), causes mitochondrial dysfunction by selectively concentrating in mitochondria of infected cells (Somasundaran et al, 1994). Both toxins and viruses (Raza & Preisler, 2000; Reddy et al, 2000) have been proposed as being aetiological agents in the development of myelodysplastic syndromes, and may exert their pathological effects through a disruption of mitochondrial function. Further studies are needed to explore the possible role of mitochondria in the aetiology of MDS.

Acknowledgments

  1. Top of page
  2. Abstract
  3. Patients and methods
  4. Results
  5. Discussion
  6. Acknowledgments
  7. References

This work was supported by a grant from the National Cancer 1nstitute (PO1CA 75606), the Markey Charitable Trust (94–8) and the Dr. Roy Ringo Grant for basic research in MDS. The authors wish to thank Ms. Lakshmi Venugopal and Ms. Sandra Howery for excellent administrative and secretarial assistance. The authors also wish to thank Sana Z. Raza, Zehra Raza, Seema Hussaini, Leena Joshi, William Townsend and Eileen Broderick for technical assistance. We wish to thank Dr David Sidransky, Dr Himla Soodyal and Dr Girish Modi for careful reading of the manuscript and helpful suggestions.

References

  1. Top of page
  2. Abstract
  3. Patients and methods
  4. Results
  5. Discussion
  6. Acknowledgments
  7. References
  • Anan, K., Ito, M., Misawa, M., Ohe, Y., Kai, S., Kohsaki, M. & Hara, H. (1995) Clonal analysis of peripheral blood and haematopoietic colonies in patients with aplastic anaemia and refractory anaemias using the polymorphic short tandem repeat on the human androgen receptor (HUMARA) gene. British Journal of Haematology, 89, 838844.
  • Anderson, S., Banitier, A.T. & Barrell, G.B. (1981) Sequence and organization of the human mitochondrial genome. Nature, 290, 457465.
  • Bossy-Wetzel, E., Newmeyer, D.D. & Green, D.R. (1998) Mitochondrial cytochrome c release in apoptosis occurs upstream of DEVD-specific caspase activation and independently of mitochondrial transmembrane depolarization. European Molecular Biology Journal, 17, 3749.
  • Clark, D.M. & Lampert, I.A. (1990) Apoptosis is a common pathologic finding in myelodysplasia: the correlate of ineffective hematopoiesis. Leukemia and Lymphoma, 2, 415422.
  • Cohen, A.M., Alexandrova, S., Bessler, H., Mittelman, M., Cycowitz, Z. & Djaldetti, M. (1997) Ultrastructural observations on bone marrow cells of 26 patients with myelodysplastic syndromes. Leukemia and Lymphoma, 27, 165172.
  • Flatmark, T. & Romslo, I. (1975) Energy-dependent accumulation of iron by isolated rat liver mitochondria. Requirement of reducing equivalents and evidence for a unidirectional flux of Fe (II) across the inner membrane. Journal of Biological Chemistry, 250, 64336438.
  • Fliss, M.S., Usadel, H., Caballero, O.L., Wu, L., Buta, M.R., Eleff, S.M., Jen, J.D. & Sidransky, D. (2000) Facile detection of mitochondrial DNA mutations in tumors and bodily fluids. Science, 287, 20172019.
  • Gatterman, N. (1999) From sideroblastic anemia to the role of mitochondrial DNA mutations in myelodysplastic syndromes. Leukemia Research, 24, 141151.DOI: 10.1016/S0145-2126(99)00160-5
  • Gatterman, N., Lotz, H., Aul, C. & Schneider, W. (1992) No large deletions of mitochondrial DNA in acquired idiopathic sideroblastic anemia (AISA). American Journal of Hematology, 41, 297300.
  • Gatterman, N., Aul, C. & Schneider, W. (1993) Is acquired idiopathic sideroblastic anemia (AISA) a disorder of mitochondrial DNA? Leukemia, 7, 20692076.
  • Gatterman, N., Retzlaff, S. & Wang, Y.-L. (1996) A heteroplasmic point mutation of mitochondrial tRNA leu(CUN) in non-lymphoid hematopoietic cell lineages from a patient with acquired idiopathic sideroblastic anemia. British Journal of Haematology, 93, 845855.
  • Gatterman, N., Retzlaff, S., Wang, Y.-L., Hofhaus, G., Heinisch, J., Aul, C. & Schneider, W. (1997) Heteroplasmic point mutations of mitochondrial DNA affecting subunit I of cytochrome c-oxidase in two patients with acquired idiopathic sideroblastic anemia. Blood, 90, 49614972.
  • Green, D.R. & Reed, J.C. (1998) Mitochondria and apoptosis. Science, 281, 13091312.
  • Habano, W., Sugai, T., Yoshida, T. & Nakamura, S.I. (1999) Mitochondrial gene mutation but not large scale deletion is a feature of colorectal carcinomas with mitochondrial microsatellite instability. International Journal of Cancer, 83, 625629.DOI: 10.1002/(SICI)1097-0215(19991126)83:5<625::AID-IJC10>3.3.CO;2-E
  • Halliwell, B. & Gutteridge, J.M.C. (1984) Oxygen toxicity, oxygen radicals, transition metals and disease. Biochemistry, 219, 114.
  • Hunault-Berger, M., Gardembas, M., Dobo, I., Fontenay-Roupie, M., Ifrati, N., Bouscary, M. & Zamdecki, M. (1999) Collapse of mitochondrial potential as a marker of early apoptosis in myelodysplastic syndromes. Blood, 94, 466.
  • Jacobs, A. (1986) Primary acquired sideroblastic anaemia. British Journal of Haematology, 64, 415418.
  • Jacobs, A. & Bowen, D.T. (1992) Pathogenesis and evolution of refractory anemia. In: The Myelodysplastic Syndromes (ed. by G.J.Mufti & D.A.G. Galton), p. 33. Churchill Livingstone, Edinburgh.
  • Li, P. & Nijhawan, D. & Budihardjo, I. (1997) Cytochrome c and dATP- dependent formation of Apaf−1/ caspase-9 complex initiates an apoptotic protease cascade. Cell, 91, 479489.
  • Margulis, L. & Schwartz, K.V. (1999) Five Kingdoms. An Illustrated Guide to the Phyla of Life on Earth, 3rd edn. W.H. Freeman, New York, USA.
  • Matthes, T.-W., Meyer, G., Samii, K. & Beri, P. (2000) Increased apoptosis in acquired sideroblastic anaemia. British Journal of Haematology., 111, 843852.
  • MITOMAP (2001) A Human Mitochondrial Genome Database. Center for Molecular Medicine. Emory University, Atlanta, GA, USA. www document URL.http://www.Generalemory.edu/mitomap.html.
  • Mundle, S., Gao, X.Z., Khan, S., Gregory, A., Preisler, H.D. & Raza, A. (1995) Two in situ labelling techinques reveal different patterns of DNA fragmentation during spontaneous apoptosis in vivo and induced apoptosis in vitro. Anticancer Research, 15, 18951904.
  • National Center for Biotechnology Information (NCBI) (2001) BLAST Search Page. www document. URL.http://www.ncbi.nlm. nih.gov/BLAST.html.
  • Petit, P.X., Lecoeur, H., Zorn, E., Dauguet, C., Mignotte, B. & Gougeou, M.L. (1995) Alterations in mitochondrial structure and function are early events of dexamethasone-induced thymocyte apoptosis. Journal of Cell Biology, 130, 157167.
  • Porra, R.J. & Jones, O.T.G. (1963) Studies on ferrochelatase. Biochemical Journal, 87, 181187.
  • Raza, A. & Preisler, H.D. (2000) Viral etiology for myelodysplastic syndromes. Journal of Human Virology, 3, 244.
  • Raza, A., Gezer, S., Mundle, S., Borok, R., Rifkin, S., Iftikhar, A., Shetty, V., Parcharidou, A., Loew, J., Robin, E., Rifkin, S., Alston, D., Hernandez, B., Shah, R., Kaizer, H. & Gregory, S. (1995) Apoptosis in bone marrow biopsy samples involving stromal and hematopoetic cells in 50 patients with myelodysplastic syndromes. Blood, 86, 268276.
  • Reddy, P.L., Bhate, A., Alvi, S., Ahmed, S., Shetty, V., Broady-Robinson, L., Qawi, H. & Raza, A. (2000) Retroviral detection in bone marrow culture supernatants of Myelodysplastic syndromes. Journal of Human Virology, 3, 264.
  • Rotig, A., Colonna, M., Bonnefont, J.P., Blanche, S., Fischer, A., Saudubray, J.M. & Munnich, A. (1989) Mitochondrial DNA deletion in Pearson's marrow/pancreas syndrome. Lancet, 8643, 902903.
  • Scalfe, J.F. (1966) The effect of lethal doses of x-irradiation on the enzymatic activity of mitochondrial cytochrome c. Canadian Journal of Biochemistry, 44, 433448.
  • Shetty, V., Munde, S., Alvi, S., Showel, M., Broady-Robinson, L., Dar, S., Boro Showel, J., Gregory, S., Rifkin, S., Gezer, S., Parcharidou, A., Venugopal, P., Hernandez, B., Klein, M., Alston, D., Robin, E., Dominquez, C. & Raza, A. (1996) Measurement of apoptosis, proliferation and three cytokines in 46 patients with myelodysplastic syndromes. Leukemia Research, 20, 891900.
  • Shetty, V., Hussaini, S., Broady-Robinson, L., Allampallam, K., Mundle, S., Borok, R., Broderick, E., Mazzoran, L., Zorat, F. & Raza, A. (2000) Intramedullary apoptosis of hematopoietic cells in myelodysplastic syndrome patients can be massive: apoptotic cells recovered from high-density fraction of bone marrow aspirates. Blood, 96, 13881392.
  • Somasundaran, M., Zapp, M.L., Beattie, L.K., Pang, L., Byron, K.S., Bassell, G.J., Sullivan, J.L. & Singer, R.H. (1994) Localization of HIV RNA in mitochondria of infected cells: potential role in cytopathogenecity. Journal of Cell Biology., 126, 353360.
  • Susan, S.A., Lorenzo, H.K. & Zamzami, N. (1999) Molecular characterization of mitochondrial apoptosis–inducing factor. Nature, 397, 441445.
  • Thress, K., Kornbluth, S. & Smith, J.J. (1999) Mitochondria at the crossroad of apoptotic cell death. Journal of Bioenergetics and Biomembranes, 31, 321326.
  • Weiss, L. (1976) The hematopoietic microenvironment of the bone marrow: an ultrastructural study of the stroma in rats. Anatomical Research, 186, 161184.
  • Wijsman, J.H., Jonkel, R.R., Keijzer, R., Van De Velde, C.J.H., Cornelisse, C.J.J.H.V. & Dierendonck, J.H.V. (1993) A new method to detect apoptosis in paraffin sections: In situ end-labelling of fragmented DNA. Journal of Histochemistry and Cytochemistry, 41, 712.