SEARCH

SEARCH BY CITATION

Keywords:

  • Factor VII;
  • factor VII deficiency;
  • factor VII gene;
  • factor VII mutation;
  • Taiwanese Chinese

Abstract

  1. Top of page
  2. Abstract
  3. Patients and methods
  4. Results
  5. Discussion
  6. Acknowledgment
  7. Note added in proof
  8. References

The genetic defects of four Taiwanese patients with factor VII (FVII) deficiency were studied. FVII activity and antigen levels were < 1 u/dl and 125·7 u/dl (patient I), < 1 u/dl and < 1 u/dl (patient II), 3·4 u/dl and 5·9 u/dl (patient III), and 1·2 u/dl and 30·4 u/dl (patient IV) respectively. The 5′ flanking region, and all exons and junctions were amplified using polymerase chain reaction and sequenced. Patient I was homozygous for a 10824C[RIGHTWARDS ARROW]A transversion with Pro303[RIGHTWARDS ARROW]Thr mutation in exon 8. In patient II, a heterozygous transversion, 9007+1G[RIGHTWARDS ARROW]T at the IVS6, a heterozygous decanucleotide insertion polymorphism at −323 (both mutations present in his father) and a heterozygous deletion, del TC (26–27) in exon 1A (originating from his mother) were identified. Patient III had a homozygous 10961T[RIGHTWARDS ARROW]G transversion with His348[RIGHTWARDS ARROW]Gln mutation in exon 8. Patient IV had a heterozygous 10902T[RIGHTWARDS ARROW]G transversion with Cys329[RIGHTWARDS ARROW]Gly mutation in exon 8 (transmitted to her second son) and a heterozygous decanucleotide insertion polymorphism at −323 (transmitted to her third son). All but one of the FVII gene mutations detected in the four patients have not been previously reported. In conclusion, four novel mutations of the FVII gene in Taiwanese, including two missense mutations in exon 8, one point mutation at the exon 6 splice site and one deletion in exon 1A, were identified.

Coagulation factor VII (FVII) is a vitamin K-dependent glycoprotein with a molecular weight of 53 kDa (Broze & Majerus, 1980). Upon vascular injury or following monocyte activation, tissue factor (TF) is exposed and forms a complex with FVII in a one-to-one stoichiometric reaction (Bach et al, 1986). The activation of FVII is effected by TF, forming activated FVII (FVIIa) (Nakagaki et al, 1991). The TF–FVIIa complex initiates blood coagulation and is capable of activating FIX and FX (Østerud & Rapaport, 1977).

Hereditary FVII deficiency was first reported by Alexander et al (1951). Since then, more than 200 cases have been described in the literature (Ragni et al, 1981; Tamary et al, 1996). FVII deficiency has an estimated prevalence of one per 300 000–500 000 in the general population (Caldwell et al, 1985; Mariani et al, 1998). It is transmitted as an autosomal recessive disorder. The gene has been fully characterized (O'Hara et al, 1987) and is located at the 13q34 chromosome (de Grouchy et al, 1984). The clinical picture is quite variable, consisting of asymptomatic patients as well as patients with severe to very severe bleeding tendencies (Mariani et al, 1998). The relationships between the clinical picture and FVII levels and the associated molecular genetic defects apparently lack consistency (Tuddenham et al, 1995; Cooper et al, 1997; Mariani et al, 1998). Plasma FVII levels vary significantly in the general population (Howard et al, 1994) and are known to be influenced by environmental factors (Scarabin et al, 1996) as well as genetic factors. Three polymorphisms within the factor VII gene are known to affect either the function or its level of expression, i.e. an Arg[RIGHTWARDS ARROW]Gln substitution at residue 353 (Green et al, 1991; Lane et al, 1992), a decanucleotide insertion polymorphism at −323 (Marchetti et al, 1993) and a variable number tandem repeat (VNTR) repeat in intron 7 (O'Hara & Grant et al, 1988; Bernardi et al, 1996). We studied four unrelated Taiwanese Chinese patients with hereditary factor VII deficiency and analysed their molecular genetic defects, which were unique and, thus, have not been reported previously.

Patients and methods

  1. Top of page
  2. Abstract
  3. Patients and methods
  4. Results
  5. Discussion
  6. Acknowledgment
  7. Note added in proof
  8. References

Four unrelated patients with hereditary FVII deficiency and seven family members treated at National Taiwan University Hospital since 1973 were studied. Two patients (patients I and II) had severe bleeding tendencies, including recurrent haemarthrosis and hypermenorrhea in patient I, and subdural haematoma 9 d after birth and repeated haemarthrosis throughout childhood in patient II. The remaining two patients (patients III and IV) had mild to moderate bleeding tendencies characterized by easy bruising, tooth extraction bleeding and menorrhagia. Their age at the time of investigation, sex, FVII:C and FVII:antigen (Ag) levels are shown in Table I.

Table I.  Clinical pictures and genetic defects of the factor VII gene in the four patients with congenital factor VII deficiency.
Patient Age*/Sex Codon ExonNucleotide substitutionAmino acid substitution Comments VII:C(u/dl) VII:Ag(u/dl) Clinical picture
  • *

    Age at the time of investigation.

  •   †The normal mean values and ranges of FVII:C and FVII:Ag are 98·6 u/dl (54–134) and 97·5 u/dl (55–155) respectively.

  •   ‡Values in the parentheses indicate plasma levels of respective family members.

I15/Female3038C[RIGHTWARDS ARROW]A (10824)Pro[RIGHTWARDS ARROW]ThrHomozygous From father From mother< 1 (52) (53)125·7 (124) (114)Severe
II6/Male −52IVS6 1a(−323 ins CCTATATCCT) 9007-1G[RIGHTWARDS ARROW]T delTC(26∼27)Splice site FrameshiftCompound heterozygous From father From father From mother< 1 (51) (49)< 1 (68) (54·5)Severe
III43/Male3488T[RIGHTWARDS ARROW]G (10961)His[RIGHTWARDS ARROW]GlnHomozygous To a son3·4 (57)5·9 (66)Mild to moderate
IV35/Female3298T[RIGHTWARDS ARROW]G (10902) (−323 ins CCTATATCCT)Cys[RIGHTWARDS ARROW]GlyHeterozygous To second son To third son1·2 (49) (45)30·4 (79) (55)Mild to moderate

Blood sampling Blood was collected by a standard vacutainer technique using 0·1 mol/l citrate buffer as the anticoagulant. The buffy coat was separated from the blood after centrifugation at 1800 g for 10 min at room temperature. Platelet-poor plasma (PPP) was prepared by centrifuging the supernatant plasma twice at 12 000 g for 10 min at 4°C. All PPP was stored at −70°C and analysed within 2 weeks. The buffy coats were kept at 4°C until DNA extraction (DNA extraction kit, Puregene, Minneapolis, MN, USA) within 24 h. Standard normal pool plasma was prepared from 30 to 40 subjects and stored at −70°C for no longer than 2 months.

FVII coagulant activity and FVII antigen FVII:C was assayed according to a previously described method (Hall et al, 1964) using FVII-deficient plasma and human thromboplastin (Thromborel-S, Behring Institute, Marburg, Germany). FVII:Ag was measured by enzyme immunoassay (Asserachrom FVII:Ag, Diagnostica Stago, Asnieres, France).

Molecular detection of FVII mutation

Polymerase chain reaction amplification Polymerase chain reaction (PCR) primers, based on the sequencing data of the FVII gene (O'Hara et al, 1987) and the derived sequences described by Bernardi et al (1993), Arbini et al (1994) and Chaing et al (1994), the size of amplified fragment and the PCR conditions for the exon amplification are shown in Table II. Most of the exons were amplified separately except for exons 3 and 4, and exons 6 and 7, which were amplified as a single fragment. PCR was carried out in a total volume of 50 μl containing genomic DNA, 0·4 μmol/l each primer, 0·2 mmol/l each deoxyribonucleotide and 1·25 U of Klen Taq ITM DNA polymerase (Ab Peptides, St Louis, MO, USA. The thermal profile for the PCR mixture consisted of 5 min of denaturation at 95°C and 30 cycles of each PCR condition described in Table II, followed by final extension at 72°C for 15 min.

Table II.  Sequences of the PCR primers and PCR conditions used for amplification of the coding regions of the factor VII gene.
ExonPCR Primer (nucleotide number) Sequence 5′− 3′Fragment size (bp) PCR condition
Exon 1A1Aa (−439∼−415)AGGCTCTCTTCAAATAATTACATCC57095°C 56°C 72°C
1Ab (131 ∼ 112)GGGCTGGCTCCTGGATTTGC 45 s 30 s 60 s
Exon 1B1Ba(1085∼1104)CCCTAGCTCACAGCATGGCC19095°C 70°C 72°C
1Bb(1275∼1255)CTTTGCCATGGGAGGGGAAGG 45 s 120 s 20 s
Exon 22a (3710 ∼ 3729)GGCGGTCTCCGAGGCACTGG28795°C 70°C 72°C
2b(3997 ∼ 3980)CCACGCGGCCTGGTTCAC 45 s 120 s 20 s
Exon 3,434a(5820∼5840)GTGAAGGTGCATCTCACGAGG28595°C 56°C 72°C
34b(6105∼6086)CCTCTGCAAATATGGGACCC 45 s 30 s 30 s
Exon 55a(7686 ∼ 7705)GCAGAACACCACTGCTGACC29195°C 70°C 72°C
5b(7977 ∼ 7957)AGTGGGACAGGGACTGGTGTC 45 s 60 s 30 s
Exon 6,76a(8868 ∼ 8889)CTGCATCTTTCTGACTTTTGTT114195°C 59°C 72°C
7b(10009 ∼ 9990)GATGTCTGTCTGTCTGTGGA 45 s 60 s 90 s
Exon 881a(10461 ∼ 10479)AATGGCCACAGCCCATCC74295°C 68°C 72°C
82b(11203 ∼ 11184)GGGATTTGGTGCCAGGACAG 45 s 100 s 60 s

Sequencing of PCR fragments The amplified PCR fragments were gel-purified from low-melt agarose and further purified using the Wizard PCR Prep DNA Purification System (Promega, Madison, WI, USA) before direct DNA sequencing. The purified PCR product was sequenced using the Sequi Therm Excel II DNA sequencing kit (Epicentre, Madison, WI, USA) and the dideoxy chain termination method (Sanger et al, 1977). The sequencing primers, their sequences and the cycle sequencing conditions for each exon of the FVII gene are shown in Table III. Additional sets of internal primers were used for sequencing exon 8 because of its long coding region. The thermal profile was 5 min of denaturation at 95°C and 30 cycles of each sequencing condition described in Table III. All sequences were determined at least twice.

Table III.  Sequences of the sequencing primers and cycle sequencing conditions used for the sequencing of the coding regions of factor VII gene.
ExonSequencing primer (nucleotide number) Sequencing 5′– 3′Cycle sequencing condition
Promoter1Aa (−439∼−415)AGGCTCTCTTCAAATAATTACATCC95°C 66°C 70°C 30 s 30 s 60 s
Exon 1A1Ab (131 ∼ 112)GGGCTGGCTCCTGGATTTGC95°C 70°C 30 s 60 s
Exon 1B1Ba(1085∼1104)CCCTAGCTCACAGCATGGCC95°C 70°C 30 s 60 s
Exon 22a (3710 ∼ 3729)GGCGGTCTCCGAGGCACTGG95°C 70°C 30 s 60 s
Exon 334a(5820∼5840)GTGAAGGTGCATCTCACGAGG95°C 70°C 30 s 60 s
Exon 434F(5909∼5928)TCCTGCCTGCAACCCTTCTC95°C 70°C 30 s 60 s
Exon 55b(7977 ∼ 7957)AGTGGGACAGGGACTGGTGTC95°C 70°C 30 s 60 s
Exon 66a(8868 ∼ 8889)CTGCATCTTTCTGACTTTTGTT95°C 66°C 70°C 30 s 30 s 60 s
Exon 77a(9568 ∼ 9587)AATGTGACTTCCACACCTCC95°C 70°C 30 s 60 s
Exon 881a(10461 ∼ 10479)AATGGCCACAGCCCATCC95°C 70°C
81b(10908 ∼ 10889)CGGCACAGAACATGTACTCC30 s 60 s
82a(10831 ∼ 10850)TGATGACCCAGGACTGCCTG 
82b(11203 ∼ 11184)GGGATTTGGTGCCAGGACAG 

Subcloning and sequencing In the case of a mutation that suggested insertion or deletion, the amplified PCR product was ligated to the pCR®II vector using the TA cloning kit (Invitrogen, Carlsbad, CA, USA) for subcloning and further confirmation. The plasmid was analysed by purification using the S.n.A.p Miniperp Kit (Invitrogen) and sequenced as described above.

Southern blot analysis Genomic DNA was digested using a restriction enzyme DraI (Promega, Madison, WI, USA) at 37°C for 12 h. Hybridization probes included three PCR fragments consisting of exon la, exon 3, 4 and exon 6, 7 of the FVII gene, which were labelled using the BrightStarTM Psoralen-Biotin labelling kit (Ambion, Austin, Texas, USA). Prehybridization and hybridization were performed at 55°C in alkaline phosphatase direct hybridization buffer (Amersham, Buckinghamshire, UK). Visualization was performed using the BrightStarTM BioDetectTM kit (Ambion) to detect the DNA biotinylated probe. Three DNA fragments, 6 kb, 3·6 kb and 2·9 kb could be detected in normal samples. A fragment shift indicated the presence of a deletion or insertion.

Results

  1. Top of page
  2. Abstract
  3. Patients and methods
  4. Results
  5. Discussion
  6. Acknowledgment
  7. Note added in proof
  8. References

Informed consent was obtained from each patient and their family members. Direct DNA sequencing in patient I identified a homozygous 10824C[RIGHTWARDS ARROW]A transversion resulting in FVII Pro303[RIGHTWARDS ARROW]Thr substitution in exon 8 of the FVII gene. A similar heterozygous mutation was detected in both of the patient's parents, who are not consanguineous (Table I). A single nucleotide heterozygous transversion at the exon 6 splice site of the FVII gene, i.e. 9007+1G[RIGHTWARDS ARROW]T at IVS6, was identified in patient II after subcloning and sequencing. A similar heterozygous mutation was found in the patient's father (Table I). A heterozygous deletion, i.e. del TC (26–27) at codon −52 in exon 1A, was also found in patient II after subcloning followed by purification and sequencing. The same heterozygous deletion was present in the patient's mother (Table I).

In patient III, a homozygous single nucleotide transversion, at nucleotide 10961T[RIGHTWARDS ARROW]G in exon 8, resulting in FVII His348[RIGHTWARDS ARROW]Gln substitution was identified. The parents of the patient were consanguineous. A similar heterozygous mutation was detected in one of the patient's children (Table I). The Southern blot analysis of FVII gene in patient III showed three DNA fragments as in those observed from normal samples. A heterozygous 10902T[RIGHTWARDS ARROW]G transversion in exon 8 of the FVII gene was detected in patient IV, resulting in the substitution of cysteine with glycine at amino acid 329. A similar heterozygous mutation was observed in her second son (Table I).

A heterozygous decanucleotide insertion, CCTATATCCT, at nucleotide 323 in the promoter region of the FVII gene was verified in patients II and IV after subcloning and sequencing. This insertion was one of the polymorphisms of the FVII gene. A similar heterozygous insertion was detected in the father of patient II and in the third son of patient IV (Table I).

Discussion

  1. Top of page
  2. Abstract
  3. Patients and methods
  4. Results
  5. Discussion
  6. Acknowledgment
  7. Note added in proof
  8. References

In the present study, two patients (patients I and II) with severe bleeding tendencies had FVII:C < u/dl and two patients (patients III and IV) with mild to moderate bleeding tendencies had FVII:C of 3·4 u/dl and 1·2 u/dl respectively. These levels are compatible with those in haemophilia. Nonetheless, FVII:C level is a relatively poor guide to the severity of bleeding in the patients with congenital FVII deficiency (Tuddenham et al, 1995; Cooper et al, 1997; Mariani et al, 1998). FVII deficiency was type 2 (cross-reacting material positive, CRM+) in patient I, type 1 (CRM) in patient II and type 3 (Tuddenham et al, 1995) (CRMRed) in patients III and IV.

A summary of the molecular defects (Tuddenham et al, 1995; Cooper et al, 1997; Mariani et al, 1998) and other new mutations (James et al, 1997; Carew et al, 1998; Ozawa et al, 1998; Pinotti et al, 1998; Katsumi et al, 2000; Wulff & Herrmann, 2000) in hereditary factor VII deficiency has been published. All but one of the mutations of the FVII gene detected in our patients (Table I) were novel and have not been reported previously. These include two missense mutations in exon 8, 10824C[RIGHTWARDS ARROW]A (Pro303[RIGHTWARDS ARROW]Thr) and 10902T[RIGHTWARDS ARROW]G (Cys329[RIGHTWARDS ARROW]Gly), one exon 6 splice site mutation, IVS69007+1G[RIGHTWARDS ARROW]T, and one delTC (26–27) in exon 1A. The decanucleotide insertion polymorphism at nucleotide −323, which was found in patients II and IV, has been shown to be associated with lower levels of plasma FVII:C and FVII:Ag in vivo (Sacchi et al, 1996), and reduced promoter activity by 33% in vitro (Pollak et al, 1996). Such polymorphic mutations may complicate the comparison of cases with the same mutation and could favour the laboratory detection of FVII deficiency (Mariani et al, 1998), particularly the heterozygous condition for other mutations, e.g., FVII:C and FVII:Ag were much reduced in patient IV compared with her second son.

The novel C to A transversion at nucleotide 10824 leads to a missense mutation from Pro to Thr at codon 303 in patient I. The Pro 303 is hightly conserved among FVII, FIX, FX, FXI and various other serine proteases. The Pro303Thr mutation would conceivably have a significant impact on the protein structure. A mutation R304Q right next to Pro303 has been reported to cause a conformational change which then affects tissue factor binding (O'Brien et al, 1991). Therefore, it is probable that Pro303Thr mutation may also decrease FVII activation by tissue factor binding. This awaits further investigation. In contrast, a homozygous mutation of Pro343Ser of factor X, equivalent to Pro303Thr in FVII, showed normal levels of factor X antigen but reduced the activity to 4–9% of normal (Harold et al, 1991). The Pro342 in FX was shown to be a highly conserved residue orientated spatially close to both the cleavage site of the zymogen and the active site of the enzyme (Harold et al, 1991). Patient I, who is homozygous for this mutation, had normal antigenic levels of FVII without detectable coagulation activity. Both his parents, who are heterozygous for this mutation, also had low normal or nearly half of the normal mean FVII:C level. However, they had twofold higher levels of FVII:Ag. This suggests that Pro303Thr is a totally dysfunctional protein.

The dinucleotide deletion (TC) of position 26 and 27 caused a frameshift mutation in patient II. Sixteen amino acids after Leu(−53) are altered, followed by a TAA premature termination codon. This mutation should be null, consistent with the undetectable level of FVII:C and FVII:Ag in patient II and the fact that the heterozygous mother has low normal levels of FVII:C and FVII:Ag. As for the G to T change at position 9007+1 of 5′ junction in intron 6, it may disrupt the splicing signal. The intron 6 of FVII is a typical intron, compliant with the ‘GT–AG rule’. This mutation changed the ‘GT–AG’ into ‘TT–AG’. The splicing apparatus may utilize the next GT at 9007+40 as the surrogate signal or may read through and utilize the stop codon at 9007+199 in intron 6, resulting in a protein with extra amino acids or a truncated protein. Patient II's father has both the exon 6 splice site and the decanucleotide insertion mutations located on the same allele, causing slightly lower FVII:C and normal FVII:Ag levels. In this family, this polymorphism in the promoter region did not affect for their phenotypes.

The T to G transversion at nucleotide position 10961 in patient III led to a missense homozygous mutation from His to Gln at codon 348. Southern blot analysis showed normal results as expected, thus small or large deletion mutations in the FVII gene could be ruled out. This mutation was recently reported and was suggested to impair secretion of FVII proteins (Katsumi et al, 2000), which might cause low levels of FVII:C and FVII:Ag, as observed in patient III. The amino acid His348 is conserved among FVII, FIX and FX. In fact, a stretch of seven amino acids from codon 342–348 (GDSGGPH), including Ser344, one of the catalytic triads (Cooper et al, 1997), are completely conserved among human FVII, FIX, FX, mouse FVII, bovine FVII and avian FVII. Whether it may affect the catalytic activity of FVII proteins remains to be investigated. The heterozygous condition in one of patient III's sons caused very little decrease in FVII levels.

The Cys329 forms a disulphide bond with Cys310 (Banner et al, 1996). Both Cys are strictly conserved among various serine proteases. A mutation of Cys310Phe has been reported (Bernardi et al, 1994) and the molecular modelling of this mutant showed that the loop of Cys310–Cys329 was relaxed considerably. The Cys329Gly mutation detected in patient IV would no doubt disrupt the disulphide bond and has a dramatic effect on the protein structure. However, the overall structure and stability of the protein would probably be conserved by hydrophobic interaction, but function is probably impared, thus causing a type 2 or a type 3 deficiency (Tuddenham et al, 1995). Cys329[RIGHTWARDS ARROW]Gly mutation in one allele plus one normal allele in the patient's second son may result in nearly half of the normal mean level of FVII:C (45 u/dl) and an almost twofold higher level of FVII:Ag (79 u/dl), while the heterozygous decanucleotide insertion polymorphism in the promoter region in the patient's third son may cause normal or slightly decreased levels of FVII:C and FVII:Ag. The overall effect of one mutant allele and one polymorphism allele may result in a type 3 deficiency, as noted in patient IV.

In conclusion, we found four novel mutations of the FVII gene in Taiwanese congenital factor VII-deficient patients. Two missense mutations located in exon 8, one IVS6, 9007+1G[RIGHTWARDS ARROW]T mutation was at the exon 6 splice site, and one delTC (26–27) was located in exon 1A.

Acknowledgment

  1. Top of page
  2. Abstract
  3. Patients and methods
  4. Results
  5. Discussion
  6. Acknowledgment
  7. Note added in proof
  8. References

We are grateful to Miss Mei-Hua Hong for her technical assistance.

Note added in proof

  1. Top of page
  2. Abstract
  3. Patients and methods
  4. Results
  5. Discussion
  6. Acknowledgment
  7. Note added in proof
  8. References

During the preparation for the publication of this article, a similar homozygous Pro303[RIGHTWARDS ARROW]Thr mutation to that found in patient I and a similar heterozygous IVS6+1G[RIGHTWARDS ARROW]T mutation to that found in patient II have been reported (Thrombosis and Haemostasis 2000, 84, 250–257).

References

  1. Top of page
  2. Abstract
  3. Patients and methods
  4. Results
  5. Discussion
  6. Acknowledgment
  7. Note added in proof
  8. References
  • Alexander, B., Goldstein, R., Landwehr, G. & Cook, C.D. (1951) Congenital SPCA deficiency: a hitherto unrecognized coagulation defect with hemorrhage rectified by serum and serum reactions. Journal of Clinical Investigation, 30, 237246.
  • Arbini, A.A., Bodkin, D., Lopaciuk, S. & Bauer, K.A. (1994) Molecular analysis of Polish patients with factor VII deficiency. Blood, 84, 22142220.
  • Bach, R., Gentry, R. & Nemerson, Y. (1986) FVII binding to tissue factor in reconstituted phospholipid vesicles: induction of cooperativity by phosphatidylserine. Biochemistry, 25, 40074020.
  • Banner, D.W., D'Arcy, A., Chene, C., Winkler, F.K., Guha, A., Konisberg, W.H., Nemerson, Y. & Kirchhofer, D. (1996) The crystal structure of the complex of blood coagulation factor VIIa with soluble tissue factor. Nature, 380, 4146.
  • Bernardi, F., Patracchini, P., Gemmati, D., Ferrati, M., Arcieri, P., Papacchini, M., Redaelli, R., Baudo, F., Mariani, G. & Marchetti, G. (1993) Molecular analysis of factor VII deficiency in Italy: a frequent mutation (FVII Lazio) in a repeated intronic region. Human Genetics, 92, 446450.
  • Bernardi, F., Liney, D.L., Patracchini, P., Gemmati, D., Legnani, C., Arcieri, P., Pinotti, M., Redaelli, R., Ballerini, G., Pemberton, S., Wacey, A.I., Mariani, G., Tuddenham, E.G.D. & Marchetti, G. (1994) Molecular defects in CRM+factor VII deficiencies: modelling of missense matations in the catalytic domain of factor VII. British Journal of Haematology, 86, 610618.
  • Bernardi, F., Marchetti, G., Pinotti, M., Arcieri, P., Baroncini, C., Papacchini, M., Zepponi, E., Ursicino, N., Chiarotti, F. & Mariani, G. (1996) Factor VII gene polymorphisms contribute about one third of the factor VII level variation in plasma. Arteriosclerosis Thrombosis and Vascular Biology, 16, 7276.
  • Broze, Jr, G.J. & Majerus, P.W. (1980) Purification and properties of human coagulation factor VII. Journal of Biological Chemistry, 255, 12421247.
  • Caldwell, D.C., Williamson, R.A. & Goldsmith, J.C. (1985) Hereditary coagulopathies in pregnancy. Clinical Obstetrics and Gynecology, 28, 5372.
  • Carew, J.A., Pollak, E.S., High, K.A. & Bauer, K.A. (1998) Severe factor VII: C deficiency due to a mutation disrupting an SpI binding site in the factor VII promoter. Blood, 92, 16391645.
  • Chaing, S., Clarke, B., Sridhara, S., Chu, K., Friedman, P., VanDusen, W., Roberts, H.R., Blajchman, M., Monroe, D.M. & High, K.A. (1994) Severe factor VII deficiency caused by mutations abolishing the cleavage site for activation and altering binding to tissue factor. Blood, 83, 35243535.
  • Cooper, D.N., Millar, D.S., Wacey, A., Banner, D.W. & Tuddenham, E.G.D. (1997) Inherited factor VII deficiency: molecular genetics and pathophysiology. Thrombosis and Haemostasis, 78, 151160.
  • De Grouchy, J., Dautzenberg, M.D., Turleau, C., Béguin, S. & Chavin-Colin, F. (1984) Regional mapping of clotting factors VII and X to 13q34. Expression of factor VII through chromosome 8. Human Genetics, 66, 230233.
  • Green, F., Kelleher, C., Wilkes, H., Temple, A., Meade, T. & Humphries, S. (1991) A common Genetic polymorphism associated with lower coagulation factor VII levels in healthy individuals. Arteriosclerosis and Thrombosis, 11, 540546.
  • Hall, C.A., Rapaport, S.I., Ames, S.B. & DeGroot, J.A. (1964) A clinical and family study of hereditary proconvertin (Factor VII) deficiency. American Journal of Medicine, 37, 172181.
  • Harold, L. & Girolami, J.A. & Fair, D.S. (1991) Molecular defect in coagulation factor XFriuli results from a substituton of serine for proline at position 343. Blood, 77, 317323.
  • Howard, P.R., Bovill, E.G., Pike, J., Church, W.R. & Tracy, R.P. (1994) Factor VII antigen levels in a healthy blood donor population. Thrombosis and Haemostasis, 72, 2127.
  • James, H.L., Anderson, K.D., Nichols, W.L. & Heit, J.A. (1997) Factor VII C329R: a variant with a disrupted disulfide bond in the catalytic domain. Blood Coagulation and Fibrinolysis, 8, 308310.
  • Katsumi, A., Matsushita, T., Yamazaki, T., Sugiura, I., Kojima, T. & Saito, H. (2000) Severe factor VII deficiency caused by a novel mutation His348 to Gln in the catalytic domain. Thrombosis and Haemostasis, 83, 239243.
  • Lane, A., Cruikshank, J.K., Stewart, J., Henderson, A., Humphries, S. & Green, F. (1992) Genetic and environmental determinants of factor VII conagulant activity in different ethnic groups at differing risk of coronary heart disease. Atherosclerosis, 94, 4350.
  • Marchetti, G., Patracchini, P., Papacchini, M., Ferrati, M. & Bernardi, F. (1993) A polymorphism in the 5′ region of coagulation factor VII gene (F7) caused by an inserted decanucleotide. Human Genetics, 90, 575576.
  • Mariani, G., Lo Coco, L., Bernardi, F. & Pinotti, M. (1998) Molecular and clinical aspects of factor VII deficiency. Blood Coagulation and Fibrinolysis, 9, S83S88.
  • Nakagaki, T., Foster, D.C., Berkner, K.L. & Kisiel, W. (1991) Initiation of the extrinsic pathway of blood coagulation: evidence for tissue factor dependent autoactivation of human coagulation factor VII. Biochemistry, 30, 1081910824.
  • O'Brien, D.P., Gale, K.M., Anderson, J.S., McVey, J.H., Miller, G.J., Meade, T.W. & Tuddenham, E.G.D. (1991) Purification and characterization of Factor VII 304-Gln: a variant molecule with reduced activity isolated from a clinically unaffected male. Blood, 78, 132140.
  • O'Hara, P.J. & Grant, F.J. (1988) The human factor VIII gene is polymorphic due to variation in repeat copy number in a minisatellite. Gene, 66, 147158.
  • O'Hara, P.J., Grant, F.J., Haldeman, B.A., Gray, C.L., Insley, M.Y., Hagen, F.S. & Murray, M.J. (1987) Nucleotide sequence of the gene coding for human factor VII, a vitamin K-dependent protein participating in blood coagulation. Proceedings of the National Academy of Sciences of the United States of America, 84, 51585162.
  • Østerud, B. & Rapaport, S.I. (1977) Activation of factor IX by the reaction product of tissue factor and factor VII: additional pathway for initiating blood coagulation. Proceedings of the National Academy of Sciences of the United States of America, 74, 52605264.
  • Ozawa, T., Takikawa, Y., Niiya, K., Sato, S. & Sakuragawa, N. (1998) Factor VII Morioka (FVII L-26P): a homozygous missense mutation in the signal sequence identified in a patient with factor VII deficiency. British Journal of Haematology, 101, 4749.DOI: 10.1046/j.1365-2141.1998.00666.x
  • Pinotti, M., Toso, R., Redaelli, R., Berrettini, M., Marchetti, G. & Bernardi, F. (1998) Molecular mechanisms of FVII deficiency: expression of mutations clustered in the IVS7 donor splice site of factor VII gene. Blood, 92, 16461651.
  • Pollak, E.S., Hung, H.L., Godin, W., Overton, G.C. & High, K.A. (1996) Functional characterization of the human factor VII 5′-flanking region. Journal of Biological Chemistry, 271, 17381747.
  • Ragni, M.V., Lewis, J.H., Spero, J.A. & Hasiba, U. (1981) Factor VII deficiency. American Journal of Hematology, 10, 7988.
  • Sacchi, E., Tagliabue, L., Scoglio, R., Baroncin, C., Coppola, R., Bernardi, F. & Mannucci, P.M. (1996) Plasma factor VII levels are influenced by a polymorphism in the promoter region of the FVII gene. Blood Coagulation and Fibrinolysis, 7, 114117.
  • Sanger, F., Nicklen, S. & Coulsen, A.R. (1977) DNA sequencing with chain terminating inhibitors. Proceedings of the National Academy of Sciences of the United States of America, 74, 54635467.
  • Scarabin, P.Y., Vissac, A.M., Kirzin, J.M., Bourgeat, P., Amiral, J., Agher, R. & Guize, L. (1996) Population correlates of coagulation factor VII. Arteriosclerosis Thrombosis and Vascular Biology, 16, 11701176.
  • Tamary, H., Fromovich, Y., Shalmon, L., Reich, Z., Dym, O., Lanir, N., Brenner, B., Paz, M., Luder, A.S., Blau, O., Korostishevsky, M., Zaizov, R. & Seligsohn, U. (1996) Ala 244 Val is a common, probably ancient mutation causing factor VII deficiency in Moroccan and Iran Jews. Thrombosis and Haemostasis, 76, 283291.
  • Tuddenham, E.G.D., Pemberton, S. & Cooper, D.N. (1995) Inherited factor VII deficiency: genetics and molecular pathology. Thrombosis and Haemostasis, 74, 313321.
  • Wulff, K. & Herrmann, F.H. (2000) Twenty two novel mutations of the factor VII gene in factor VII deficiency. Human Mutation, 15, 489496.