SEARCH

SEARCH BY CITATION

Keywords:

  • myelodysplastic syndrome;
  • mastocytosis;
  • bone marrow;
  • C-KIT;
  • mutation

Abstract

  1. Top of page
  2. Abstract
  3. Patients and methods
  4. Results
  5. Discussion
  6. References

The proto-oncogene C-KIT encodes a tyrosine kinase receptor that is expressed on mast cells and haematopoietic stem cells and can show somatic mutations in patients with mastocytosis. Only scattered information is available about mutations in C-KIT in patients with other myeloid neoplasms. Moreover, the prevalence of mutations in C-KIT in bone marrow specimens of individuals with systemic mastocytosis is largely unknown. Using sequence analysis, we have screened cDNAs of the C-KIT domain encompassing codon 510–626 and codon 763–858 in bone marrow (BM) mononuclear cells (MNCs) of patients with myelodysplastic syndromes (n = 28) and patients with systemic mastocytosis (n = 12) for the presence of mutations. Furthermore, restriction fragment length polymorphism analysis was applied for identification of the C-KIT 2468A[RIGHTWARDS ARROW]T and the C-KIT 1700T[RIGHTWARDS ARROW]G mutation, as well as the C-KIT 1642A[RIGHTWARDS ARROW]C polymorphism. All 11 patients with systemic indolent mastocytosis tested positive for C-KIT 2468A[RIGHTWARDS ARROW]T. In contrast, no mutation was identified in the case of aggressive mastocytosis. Among patients with myelodysplastic syndromes, no patient showed a somatic mutation in C-KIT. The allele frequency for C-KIT 1642A[RIGHTWARDS ARROW]C among the entire patient population was 0·038 and was 0·125 among age- and sex-matched healthy controls. Our data demonstrate that myelodysplastic syndromes without histological or cytological evidence of mastocytosis do not exhibit somatic mutations in exons 10, 11, 12, 16, 17 and 18 of C-KIT. In contrast, BM MNCs of patients with systemic indolent mastocytosis were all positive for C-KIT 2468A[RIGHTWARDS ARROW]T and negative for additional mutations in these exons. The C-KIT 1642A[RIGHTWARDS ARROW]C polymorphism is not associated with myelodysplastic syndrome or systemic mastocytosis.

The human C-KIT proto-oncogene encodes a receptor tyrosine kinase (KIT) that is expressed on mast cells, immature haematopoietic progenitor cells, melanocytes and germ cells. The entire coding region has a length of 2·928 bp with a deduced amino acid sequence of 976 amino acid residues (Yarden et al, 1987). The KIT receptor is a member of the tyrosine kinase receptor family, subtype III (Ullrich & Schlessinger, 1990), which includes receptor tyrosine kinases sharing structural similarities. These include an extracellular ligand binding domain with five immunoglobulin-like repeats, a hydrophobic membrane spanning region and an intracellular cytoplasmic tail that contains a tyrosine kinase catalytic domain (Yarden et al, 1987). Furthermore, a juxtamembrane region exists that separates the transmembrane domain from the cytoplasmic domain and which is conserved among members of the same subclass of tyrosine kinase receptors. Within the KIT receptor, the structural domains are located between the amino acid residues of codon 1 and codon 520 (extracellular region), between codon 521 and codon 543 (transmembrane region), and between codon 544 and codon 976 (cytoplasmic region). The latter contains the tyrosine kinase enzymatic domain (Yarden et al, 1987).

Activation of KIT by its ligand (mast cell growth factor, also termed kit ligand or stem cell factor) plays a central role in differentiation and proliferation of mast cells and haematopoietic progenitor cells (Witte, 1990; Valent et al, 1992; Costa et al, 1996). Interestingly, two heterozygous point mutations (C-KIT 2468A[RIGHTWARDS ARROW]T [Asp816Val], and C-KIT 1700T[RIGHTWARDS ARROW]G [Val560Gly] respectively) that are located within the tyrosine kinase enzymatic domain have been identified in the human mast cell leukaemia cell line HMC-1 (Furitsu et al, 1993). Notably, C-KIT 2468A[RIGHTWARDS ARROW]T results in ligand-independent and constitutive activation of the KIT receptor, ultimately leading to autonomous proliferation of mast cells.

Besides C-KIT 2468A[RIGHTWARDS ARROW]T of the human cell line HMC-1, a corresponding mutation has been identified in the murine mastocytoma cell line P-815 (Tsujimura et al, 1994) and the rat tumour mast cell line RBL-2H3 (Tsujimura et al, 1995). Furthermore, mutations have been identified in canine (Ma et al, 1999) and murine mastocytomas (Tsujimura et al, 1996), suggesting a causal role of somatic C-KIT mutations in proliferation of mast cells.

Because mutations in C-KIT can result in ligand-independent clonal cell growth, the question arose whether or not disorders affecting mast cells and/or pluripotent haematopoietic progenitor cells are associated with C-KIT mutations. Nagata et al (1995) were the first to report on the presence of C-KIT 2468A[RIGHTWARDS ARROW]T in peripheral blood mononuclear cells (MNCs) of a patient with myelofibrosis and in three patients with myelodysplastic syndrome and associated mastocytosis. Several investigators have screened samples of patients with stem cell disorders and/or mastocytosis for somatic mutations in C-KIT using single-strand conformation polymorphism (SSCP) analysis (Nagata et al, 1995, 1997; Nakata et al, 1995; Kimura et al, 1997). However, it has to be noted that SSCP does not always enable mutation detection. In particular, if polymerase chain reaction (PCR) products longer than 200 bp are analysed, the detection sensitivity decreases (Sheffield et al, 1993). Therefore, it is possible that mutations exist in C-KIT transcripts that could not have been identified by SSCP analysis in previous studies.

Apart from somatic mutations associated with proliferation of mast cells, five polymorphisms exist in C-KIT. These include C-KIT 1642A[RIGHTWARDS ARROW]C (Nagata et al, 1996), C-KIT 1659A[RIGHTWARDS ARROW]G (Gari et al, 1999), C-KIT 2415C[RIGHTWARDS ARROW]T (Bowen et al, 1993; Nagata et al, 1995), C-KIT 2607G[RIGHTWARDS ARROW]C (Nagata et al, 1995) and C-KIT 3169G[RIGHTWARDS ARROW]A (Bowen et al, 1993) respectively. One of these polymorphisms (C-KIT 1642A[RIGHTWARDS ARROW]C) results in the substitution of a leucine for a methionine residue at codon 541 (Met541Leu) (Nagata et al, 1996). Because this mutation did not result in disease manifestation in a two-generation family, this polymorphism is assumed not to be associated with haematological disorders (Nagata et al, 1996).

Systemic mastocytosis is a disease characterized by abnormal growth and accumulation of mast cells in the skin, bone marrow and/or visceral organs (Lennert & Parwaresch, 1979; Horny et al, 1985; Travis et al, 1988; Horan & Austen, 1991; Metcalfe, 1991; Valent, 1996). At diagnosis, patients frequently show an associated haematological disorder such as a myelodysplastic syndrome or a myeloproliferative disorder (Parwaresch et al, 1985; Metcalfe, 1991; Valent, 1996). These cases of mastocytosis presenting with other haematological disorders can be associated with a mutated C-KIT transcript (Boissan et al, 2000). Moreover, patients with systemic mastocytosis may develop haematological abnormalities that may resemble the picture of a myeloproliferative or myelodysplastic disorder (Horny et al, 1985; Lawrence et al, 1991).

Scattered information is available about the association of somatic C-KIT mutations with myelodysplastic syndromes without concomitant bone marrow mastocytosis (Nagata et al, 1995). Therefore, we examined C-KIT cDNA sequences of patients with a myelodysplastic syndrome not associated with mastocytosis in a prospective study. Furthermore, patients with proven systemic mastocytosis were enrolled to characterize the prevalence of mutations in C-KIT in bone marrow specimens with systemic mastocytosis. To allow for accurate mutation detection, we have used a direct nucleotide sequencing protocol to screen for novel mutations in the mutation hot spots surrounding codon 816 as well as codon 560 of C-KIT, and restriction fragment length polymorphism (RFLP) analysis for detection of C-KIT 2468A[RIGHTWARDS ARROW]T, C-KIT 1700T[RIGHTWARDS ARROW]G and the C-KIT 1642A[RIGHTWARDS ARROW]C polymorphism.

Patients and methods

  1. Top of page
  2. Abstract
  3. Patients and methods
  4. Results
  5. Discussion
  6. References

Study design A prospective case–control study was conducted at the University Hospital of Vienna between January 1996 and January 2000. Bone marrow biopsies and aspirates of patients suspected of myelodysplastic syndrome, as well as patients with evidence of systemic mastocytosis, were collected with the informed consent of the patients. Disease classification was performed using standard haematological, histological and immunohistochemical techniques according to FAB criteria (Bennet et al, 1985) and published criteria to diagnose mastocytosis (Lennert & Parwaresch, 1979; Parwaresch et al, 1985; Metcalfe, 1991; Valent, 1996).

Patients A total of 40 cases (19 women, 21 men, mean age: 60·3 ± 18·2 years) with myelodysplastic syndrome without histological or cytological evidence of mastocytosis [n = 28; refractory anaemia (RA), n = 9; RA with ringed sideroblasts (RARS), n = 7; refractory anaemia with excess of blasts (RAEB), n = 10; RAEB in transformation (RAEB-T), n = 1; chronic myelomonocytic leukaemia, n = 1; Table I] or systemic mastocytosis [systemic indolent mastocytosis without an associated secondary haematological disorder (n = 11) and one case of systemic aggressive mastocytosis without urticaria pigmentosa-like skin lesions, Table II] were included in the present study.

Table I.  Characteristics of patients with myelodysplastic syndromes.
PatientAge (years) SexDuration of disease (years) FAB% of blasts in BM smears% of mast cells in BM smears% of mast cells in BM biopsies
  1. BM, bone marrow; a.d., investigation at diagnosis.

1·1.272Female1·2RA30Sporadic
1·1.362Femalea.d.CMML300
1·1.457Female0·5RA400
1·1.587Femalea.d.RA300
1·1.677Male0·5RA< 100
1·1.770Male3·0RARS< 100
1·1.869Male3·0RA100
1·1.979Malea.d.RAEB1400
1·1.1053Male1·5RA300
1·1.1144Malea.d.RAEB1500
1·1.1269Femalea.d.RAEB700
1·1.1372Female1·3RA300
1·1.1476Malea.d.RA100
1·1.1765Male0·7RARS200
1·1.1877Femalea.d.RARS100
1·1.1963Female0·8RAEB600
1·1.2086Malea.d.RARS300
1·1.2157Male0·9RAEB-T2500
1·1.2265Female0·6RAEB1200
1·1.2379Malea.d.RARS100
1·1.2471Malea.d.RAEB1000
1·1.2561Malea.d.RARS1Sporadic0
1·1.2681Femalea.d.RAEB500
1·1.2778Femalea.d.RAEB5Sporadic0
1·1.2823Femalea.d.RA100
1·1.2979Malea.d.RARS< 100
1·1.3076Malea.d.RAEB700
1·1.3171Femalea.d.RAEB1100
Table II.  Characteristics of patients with systemic mastocytosis.
Patient Age SexDuration of disease (years)Extent of disease (years)% of mast cells in BM smears% of mast cells in BM biopsies
  • *

    This patient had systemic aggressive mastocytosis. All other patients had systemic indolent mastocytosis.

  •   BM, bone marrow; UP, urticaria pigmentosa; a.d., investigation at diagnosis.

146Femalea.d.UP (16), BM120
252Female4·0UP (16), BM2·565
336Malea.d.UP (26), BM< 115
450Femalea.d.UP (29), gastrointestinal, BM15
557Male0·08UP (13), BM< 120
671Malea.d.UP (10), BM< 12
739Male5·0UP (19), BM< 170
922Femalea.d.UP (a.d.), BM< 13
1038Male1·0UP (10), BM< 15–10
12*21Malea.d.No UP, spleen, BM< 15
1327Femalea.d.UP (14), BM230
1·148Female0·06UP, spleen, BM2·570

Control population DNA samples from 390 healthy individuals were available. The presence of the C-KIT 1642A[RIGHTWARDS ARROW]C polymorphism was analysed among 40 subjects who were matched for age and sex (19 women, 21 men, mean age: 59·9 ± 17·5 years) with the patient population.

Isolation of total RNA and cDNA synthesis Bone marrow (BM) MNCs of the patients were isolated using density gradient centrifugation. Cell aliquots of 1 × 107 were lysed by addition of 1·6 ml of RNAzol B (Biotecx, Houston, TX, USA). Total RNA was extracted from BM MNCs and cells of the human mast cell leukaemia cell line HMC-1, which served as a positive control, according to standard procedures (Sambrook et al, 1989). cDNA synthesis was performed with 1 μg of total RNA in a 20 μl reaction volume using random hexamer primers (Amersham Pharmacia Biotech, Uppsala, Sweden). After cDNA synthesis, the samples were diluted to 100 μl with TE buffer.

Polymerase chain reaction (PCR) amplification and sequencing of C-KIT cDNA For PCR analysis of the cDNA sequence (Yarden et al, 1987) spanning nucleotide position 1549–1898 (codon 510 through codon 626 of exon 10, 11 and 12; primer system C-KIT 3/4) and position 2309–2596 (codon 763 through codon 858 of exon 16, 17 and 18; primer system C-KIT 1/2) (Yarden et al, 1987) of C-KIT, a cycle sequencing protocol was applied (Thermo Sequenase cycle sequencing kit, Amersham, Cleveland, OH, USA). The position of the PCR primers and their nucleotide sequences are shown in Table III.

Table III.  Positions and nucleotide sequences of primers used for PCR analyses.
PCR systemCode of primerOligonucleotide sequence 5′-3′ NucleotideExon positionLength of amplicon (bp)
  1. Nucleotide positions are shown according to the C-KIT cDNA accession no. X06182 (Yarden et al, 1987).

C-KIT 1/2C-KIT 1CCCTAGACTTAGAAGACTTGCTGA2309–233216287
C-KIT 2AAAAATCCCATAGGACCAGACGTC2572–259518 
C-KIT 3/4C-KIT 3GGTAACAACAAAGAGCAAATCCATCC1549–15749–10350
C-KIT 4TTGAGCATCTTTACAGCGACAGTCAT1873–189812 
C-KIT 6 MM/7C-KIT 6 MMTGTAAATATTTGTAGGTCAGACTCA1643–166710106
C-KIT 7AGCAAATCCATCCCCAC1562–157810 

The PCR reactions included 3 μl of cDNA in a 50 μl reaction volume containing 10 mmol/l Tris-HCl (pH 8·3), 50 mmol/l KCl, 0·1% Triton X-100, 50 pmol of each primer, 1·5 mmol/l MgCl2, 200 μmol/l of each dNTP and 1·25 units of AmpliTaq DNA Polymerase (PE Biosystems, Foster City, CA, USA). The thermal cycling conditions were denaturation at 94°C (1 min), annealing at 55°C (2 min) and extension at 72°C (1 min), preceded by an initial denaturation step at 94°C for 6 min and followed by a terminal extension of 10 min at 72°C. All PCR amplifications were performed with the thermal cycler 480 (PE Biosystems). The PCR amplification products were analysed on 6% polyacrylamide gels (Novex, San Diego, CA, USA) and were stained with SYBR Green I (Molecular Probes, Eugene, OR, USA).

To degrade primers and nucleotides for direct sequence analysis of the PCR fragments, 2 μl of PCR product was incubated with 5 units of exonuclease I and 5 units of shrimp alkaline phosphatase in a 20 μl reaction volume at 37°C (1 h), as described (Werle et al, 1994). The enzymes were inactivated for 15 min at 72°C. Purified PCR product (7 μl) was used for cycle sequencing according to the manufacturer's instructions.

Sensitivity of the sequencing protocol for detection of somatic C-KIT mutations The sensitivity of the sequencing protocol in detecting MNCs expressing a mutant C-KIT within MNCs expressing wild-type C-KIT was determined in two independent experiments. Total RNA of the human mast cell leukaemia cell line HMC-1 (100% mast cells heterozygous for C-KIT 2468A[RIGHTWARDS ARROW]T and heterozygous for C-KIT 1700T[RIGHTWARDS ARROW]G) was mixed with different proportions of total RNA isolated from MNCs of a healthy individual (negative for mutations in C-KIT). The mixture of total RNA was subjected to cDNA synthesis and direct nucleotide sequence analysis as described above. The final concentrations for the heterozygous mast cells of HMC-1 among negative MNCs were 5%, 2·5%, 1%, 0·5%, 0·25%, 0·1%, 0·075%, 0·05% and 0·0025% respectively.

Restriction fragment length polymorphism analysis of C-KIT 2468A[RIGHTWARDS ARROW]T and C-KIT 1700T[RIGHTWARDS ARROW]G The presence of C-KIT 2468A[RIGHTWARDS ARROW]T in BM MNCs of the patients was also investigated by RFLP analysis of a 287 bp reverse transcription (RT)-PCR product obtained with the primer system C-KIT 1/2 (Table III). Using the restriction enzyme Hinf I, the wild-type sequence is cut into two fragments of 171 bp and 116 bp respectively. In contrast, in the presence of the mutation an additional Hinf I recognition site is created, resulting in cleavage of the 287 bp product into fragments of 157 bp, 116 bp and 14 bp (Nagata et al, 1995). The digests were analysed using electrophoresis through 6% polyacrylamide gels (Novex) followed by SYBR Green I staining (Molecular Probes).

The presence of C-KIT 1700T[RIGHTWARDS ARROW]G was investigated with the restriction endonuclease Hph I in a 350 bp PCR product that had been amplified with the primer system C-KIT 3/4 (Table III). In the presence of the mutation, the amplicon is cut into fragments of 163 bp and 187 bp, while the wild-type sequence remains uncleaved. Electrophoretic separation of the PCR fragments was performed as described above for C-KIT 2468A[RIGHTWARDS ARROW]T.

Sensitivity of restriction fragment length polymorphism analysis for detection of somatic C-KIT mutations The sensitivity of the RFLPs for detection of C-KIT 2468A[RIGHTWARDS ARROW]T and C-KIT 1700T[RIGHTWARDS ARROW]G was determined in two independent experiments using the same cDNAs that had been synthesized from different proportions of total RNA of the mast cell leukaemia cell line HMC-1 and total RNA of MNCs of a healthy subject, as mentioned, for sequence analysis. The cDNAs were amplified with the primer systems C-KIT 1/2 and C-KIT 3/4 (Table III) followed by restriction enzyme cleavage and gel electrophoresis as reported above.

Restriction fragment length polymorphism analysis of the C-KIT 1642A[RIGHTWARDS ARROW]C polymorphism in patients and controls The presence of the C-KIT 1642A[RIGHTWARDS ARROW]C polymorphism was investigated in patients and healthy age- and sex-matched control individuals using cDNA (patients) or genomic DNA (controls) for PCR analysis. The primer system used for the PCR amplifications was C-KIT 6 MM/7 located within exon 10 (for nucleotide sequences see Table III) which produced a PCR fragment of 106 bp. To allow for detection of the mutation by RFLP analysis, a restriction site for the enzyme Dde I was introduced within the sequence of the primer C-KIT 6 MM (mismatch at nucleotide position 22 of the primer, cytosine instead of adenine; Table III). In the presence of the mutation, the 106 bp amplicon is cut into fragments of 81 bp and 25 bp, while the wild-type sequence remains uncleaved. The digested PCR products were analysed by electrophoresis through 6% polyacrylamide gels (Novex) followed by SYBR Green I staining (Molecular Probes).

Statistical methods Continuous data are presented as mean (± SD) and categorical data as percentages. The allele frequencies and genotype frequencies among patients and healthy subjects were compared by Chi-square test.

Results

  1. Top of page
  2. Abstract
  3. Patients and methods
  4. Results
  5. Discussion
  6. References

Sequencing of C-KIT cDNA in myelodysplastic syndromes without mastocytosis and cases of systemic mastocytosis without myelodysplastic syndrome

Sequencing of the C-KIT coding region spanning nucleotides position 1549–1898 and nucleotides 2309–2596 revealed the presence of C-KIT 2468A[RIGHTWARDS ARROW]T in BM MNCs from 4 out of 11 patients (36·4%) with systemic indolent mastocytosis. In contrast, no mutation was detectable in the case of aggressive mastocytosis. All cDNAs of the patients with a myelodysplastic syndrome tested negative.

Apart from the somatic C-KIT 2468A[RIGHTWARDS ARROW]T mutation, a silent polymorphism (C-KIT 1659A[RIGHTWARDS ARROW]G) located in exon 10 was identified in five patients (one case of systemic indolent mastocytosis and four cases of myelodysplastic syndrome). Furthermore, three patients showed the C-KIT 1642A[RIGHTWARDS ARROW]C polymorphism that leads to the substitution of a leucine for a methionine residue at codon 541.

Sensitivity of sequence analysis for detection of mutations in C-KIT

Evaluation of the sensitivity of the sequencing protocol revealed a detection limit of 0·5% for identification of the heterozygous C-KIT 2468A[RIGHTWARDS ARROW]T mutation and the heterozygous C-KIT 1700T[RIGHTWARDS ARROW]G transversion.

Restriction fragment length polymorphism analysis of C-KIT 2468A[RIGHTWARDS ARROW]T and C-KIT 1700T[RIGHTWARDS ARROW]G in myelodysplastic syndromes without mastocytosis and cases of systemic mastocytosis without myelodysplastic syndrome

Investigation of the RT-PCR products by RFLP analysis clearly demonstrated the exclusive presence of C-KIT 2468A[RIGHTWARDS ARROW]T in all BM MNC samples of patients with systemic indolent mastocytosis (Fig 1), while this mutation was not detected in the patient with aggressive mastocytosis and patients with a myelodysplastic syndrome. Furthermore, none of the patients showed the C[RIGHTWARDS ARROW]T transversion at nucleotide position 1700 of C-KIT.

image

Figure 1. Identification of C-KIT 2468A[RIGHTWARDS ARROW]T in bone marrow mononuclear cells of all cases with systemic indolent mastocytosis. The presence of C-KIT 2468A[RIGHTWARDS ARROW]T was investigated using restriction fragment length polymorphism analysis of a 287 bp reverse transcriptase polymerase chain reaction product that had been amplified with the primer system C-KIT 1/2. The arrow indicates the 157 bp fragment generated by Hinf I restriction enzyme cleavage in the presence of C-KIT 2468A[RIGHTWARDS ARROW]T. The patients are shown in lanes 2 through 12. Lane 13 is the human mast cell leukaemia cell line HMC-1 (positive control), lane 14 contains a healthy individual (negative control) and lane 15 is the reagent (no cDNA) control. The Msp I-digested plasmid pBR322 served as a molecular weight marker (lane 1 and 16).

Download figure to PowerPoint

Sensitivity of restriction fragment length polymorphism analysis for detection of mutations in C-KIT

The sensitivites of the RFLPs for detection of C-KIT 2468A[RIGHTWARDS ARROW]T and C-KIT 1700T[RIGHTWARDS ARROW]G were 0·05% and 0·1% respectively.

Frequency of the C-KIT 1642A[RIGHTWARDS ARROW]C polymorphism in myelodysplastic syndromes without mastocytosis, cases of systemic mastocytosis without myelodysplastic syndrome and healthy controls

The allele frequency of the C-KIT 1642A[RIGHTWARDS ARROW]C polymorphism among the entire patient population was 0·038 and the allele frequency of healthy age- and sex-matched control individuals was 0·125 (P = 0·018). There were three heterozygotes (7·5%) in the patient group (one case of RAEB-T and two cases of RARS) and 10 heterozygotes (25%) in the control population (P = 0·011).

In the subgroup of 12 patients with systemic mastocytosis, the allele frequency was 0·0 and 0·125 (P = 0·064) among the matched control individuals (heterozygotes: 0% versus 25%, P = 0·046).

For the 28 patients with a myelodysplastic syndrome, the allele frequency was 0·054 and 0·125 (P = 0·106) for 28 healthy subjects (heterozygotes: 10·7% versus 25%, P = 0·081).

Discussion

  1. Top of page
  2. Abstract
  3. Patients and methods
  4. Results
  5. Discussion
  6. References

In the present study, BM MNCs of patients with a myelodysplastic syndrome did not show mutations in the C-KIT coding region spanning nucleotides 1549–1898 and nucleotides 2309–2596 that included the exons 10, 11, 12, 16, 17 and 18 respectively. In contrast, all MNC samples obtained from patients with systemic indolent mastocytosis were positive for C-KIT 2468A[RIGHTWARDS ARROW]T. In the single case of aggressive mastocytosis, no mutation was detectable. Furthermore, the allele frequency for the C-KIT 1642A[RIGHTWARDS ARROW]C polymorphism was no higher among patients than among healthy age- and sex-matched control subjects.

Systemic mastocytosis frequently presents with an associated haematological disorder such as a myelodysplastic syndrome and can be related to activating mutations in C-KIT (Boissan et al, 2000). In contrast, only limited information is available about somatic mutations in C-KIT in BM MNCs of patients with myelodysplastic syndromes without concomitant mastocytosis. We have therefore screened cDNA samples of 28 cases of myelodysplastic syndrome for C-KIT mutations and evaluated BM sections for the presence of mast cell infiltrates. No evidence of an associated mastocytosis was found. Thus, our patient population consisted of individuals with myelodysplastic syndromes not associated with mastocytosis. In this context it is worth noting that Nagata et al (1995) have investigated the peripheral blood MNCs of four cases with mastocytosis and concomitant myelodysplastic syndrome (including two patients with RA and two patients with CMML) and identified the C-KIT 2468A[RIGHTWARDS ARROW]T mutation in three patients while one case of CMML tested negative. Moreover, Worobec et al (1998a) detected this mutation in peripheral blood MNCs of three cases of myelodysplastic syndrome (including two patients with RA and one patient with CMML) and two cases of unclassifiable myelodysplastic syndrome. However, in contrast to our patients, all the patients in these two studies (Nagata et al, 1995; Worobec et al, 1998a) had evidence of diffuse mast cell lesions in the BM. In contrast, the patient with CMML that was negative for C-KIT 2468A[RIGHTWARDS ARROW]T did not show BM mastocytosis (Nagata et al, 1995), which is in line with our observations. These latter data suggest that myelodysplastic syndromes without evidence of concomitant proliferation of BM mast cells are negative for the C-KIT 2468A[RIGHTWARDS ARROW]T mutation. In contrast, myelodysplastic syndromes with BM mastocytosis can show the C-KIT 2468A[RIGHTWARDS ARROW]T mutation. Finally, Bowen et al (1993) reported the absence of mutations in several regions of C-KIT in peripheral blood MNCs of patients with myelodysplastic syndromes. However, this observation has to be interpreted with caution because the authors investigated genomic DNA samples that do not enable the sensitive analysis of somatic mutations in C-KIT.

Using a direct sequencing protocol that enables the detection of a single cell expressing the heterozygous C-KIT 2468A[RIGHTWARDS ARROW]T mutation among 200 cells expressing the wild-type C-KIT, we identified the C-KIT 2468A[RIGHTWARDS ARROW]T transversion in BM MNCs of 36·4% of patients with systemic indolent mastocytosis. In contrast, application of a RFLP method that included SYBR Green as a sensitive fluorescence stain (detection sensitivity of our protocol: one cell expressing the C-KIT 2468A[RIGHTWARDS ARROW]T mutation among 2000 cells expressing the wild-type sequence) allowed for identification of C-KIT 2468A[RIGHTWARDS ARROW]T in all BM MNC samples of patients with systemic indolent mastocytosis. Moreover, inclusion of [α-32P]-dCTP into the PCR reaction prior to RFLP analysis and autoradiography revealed a detection sensitivity similar to SYBR Green (data not shown). In this context, Akin et al (2000) reported a detection limit of only 4% (one cell expressing the C-KIT 2468A[RIGHTWARDS ARROW]T mutation among 25 cells expressing the wild-type sequence) in sorted myelomonocytic cells, as well as T and B lymphocytes, using ethidium bromide staining for detection of C-KIT 2468A[RIGHTWARDS ARROW]T. Based on these data it appears probable that SYBR Green is superior to ethidium bromide staining and should be used for sensitive mutation detection by RFLP analysis.

While mutation analysis in patients with myelodysplastic syndromes has been limited to a few cases, individuals with systemic indolent mastocytosis have been more intensively studied. To date, peripheral blood MNCs (Nagata et al, 1995; Afonja et al, 1998; Beghini et al, 1998; Worobec et al, 1998a, 1998b) or lesional skin (Büttner et al, 1998; Reinacher-Schick et al, 1998; Longley et al, 1999) have been investigated in the great majority of studies, while almost no information is available about the prevalence of a mutated C-KIT transcript in the BM MNCs of these patients. Interestingly, C-KIT 2468A[RIGHTWARDS ARROW]T was present in 100% of BM MNC samples of our patients with systemic indolent mastocytosis. In contrast, in peripheral blood MNCs this mutation was only found in 17·1% (Worobec et al, 1998a) and was not detectable in a further case of adult systemic indolent mastocytosis (Worobec et al, 1998b). In this context, it is notable that one of our 11 patients initially tested negative but was clearly positive for C-KIT 2468A[RIGHTWARDS ARROW]T in four of five additional RFLP analyses using further aliquots of the same cDNA preparation. It is therefore possible that RFLP analysis of peripheral blood MNCs using five cDNA aliquots per patient may increase detection sensitivity. Nevertheless, the fact that 10 of our 11 patients (91%) with systemic indolent mastocytosis were positive for C-KIT 2468A[RIGHTWARDS ARROW]T in a single cDNA aliquot suggests that BM MNCs more frequently bear cells expressing the C-KIT 2468A[RIGHTWARDS ARROW]T mutation and, thus, should be investigated at diagnosis to establish or exclude clonality in patients with suspected systemic mastocytosis.

In the present study, we have also investigated a total of six cDNAs (six aliquots of the same cDNA preparation) synthesized from the BM MNCs of a case of aggressive mastocytosis who did not test positive for C-KIT 2468A[RIGHTWARDS ARROW]T, corresponding to the observation by Worobec et al (1998a), or C-KIT 2480A[RIGHTWARDS ARROW]G (Asp820Gly) (Pignon et al, 1997). In contrast, Longley et al (1996) reported detection of the C-KIT 2468A[RIGHTWARDS ARROW]T mutation in cutaneous and splenic mast cells of another patient with aggressive mastocytosis. The results of these authors combined with our findings suggest heterogeneity of the C-KIT message in aggressive mastocytosis.

In addition to systemic indolent mastocytosis and myelodysplastic syndromes with concomitant BM mastocytosis, the C-KIT 2468A[RIGHTWARDS ARROW]T mutation has been detected in several cases of mastocytosis associated with other haematological disorders (Boissan et al, 2000). These cases comprised two patients with myelofibrosis (Nagata et al, 1995; Worobec et al, 1998a), one case of acute myeloid leukaemia M4 (Sperr et al, 1998), one case of unclassifiable myeloproliferative syndrome (Worobec et al, 1998a) and one case of polycythaemia vera (Worobec et al, 1998a). Alternatively, cases with proven BM mastocytosis showing an associated haematological disorder can also have mutations other than C-KIT 2468A[RIGHTWARDS ARROW]T, as has been described by Beghini et al (1998).

Apart from haematological diseases showing BM mastocytosis, some haematological disorders not involving the mast cell lineage can be associated with other mutations in C-KIT. These cases included two patients with primary myelofibrosis and one case of chronic myelogenous leukaemia showing the C-KIT 154G[RIGHTWARDS ARROW]A mutation (Asp52Asn) (Kimura et al, 1997). Furthermore, Gari et al (1999) reported three in frame deletions plus insertion mutations in exon 8 of C-KIT in three out of seven patients with acute myeloid leukaemia associated with inv(16) and in one of two cases with t(8;21). In this study, one of the patients with inv(16) testing negative for an in frame deletion plus insertion mutation showed a C-KIT 1588G[RIGHTWARDS ARROW]A mutation replacing a valine with an isoleucine (Val530Ile) residue (Gari et al, 1999). However, the authors did not report the presence or absence of BM mastocytosis, which is also the case in another study that reported on the detection of a mutation in codon 816 of C-KIT in a patient with acute myeloid leukaemia M2 (Asp816Tyr) (Beghini et al, 2000). Interestingly, in the latter study the C-KIT 2468A[RIGHTWARDS ARROW]T mutation was also detected among three patients suffering from acute myeloid leukaemia M2 with t(8;21) and in two patients with acute myeloid leukaemia M4Eo with inv(16) (Beghini et al, 2000).

We have also investigated the prevalence of the C-KIT 1642A[RIGHTWARDS ARROW]C polymorphism (Met541Leu) in our patients as well as healthy age- and sex-matched control subjects because it was unknown whether or not this polymorphism is more frequently present in individuals with haematological disorders. Although some authors reported detection of this polymorphism (Nagata et al, 1996; Gari et al, 1999), the true prevalence has not been the subject of previous investigations. In our patient population, the allele frequency for C-KIT 1642A[RIGHTWARDS ARROW]C was 0·038 and 0·125 for healthy controls. Among 28 individuals with a myelodysplastic syndrome, the frequency was 0·054 versus 0·125 of healthy control individuals. Furthermore, all patients with systemic mastocytosis tested negative for C-KIT 1642A[RIGHTWARDS ARROW]C. The C-KIT 1642A[RIGHTWARDS ARROW]C mutation is located in the transmembrane domain of C-KIT and showed an allele frequency of 0·09 in 64 anonymous blood donors (Nagata et al, 1996), which corresponds to the frequency among our control population. Based on our observation that the polymorphism is not more prevalent among patients than among healthy controls and the case of Nagata et al (1996) showing that C-KIT 1642A[RIGHTWARDS ARROW]C does not result in disease in a two-generation family, this polymorphism is probably not associated with haematological disease manifestation.

In summary, our data demonstrate that myelodysplastic syndromes without concomitant mastocytosis do not exhibit the C-KIT 2468A[RIGHTWARDS ARROW]T mutation and do not show other mutations in exons 10, 11, 12, 16, 17 and 18 of C-KIT. In contrast, BM MNCs of patients with systemic indolent mastocytosis are positive for C-KIT 2468A[RIGHTWARDS ARROW]T and do not show additional mutations in the aforementioned exons. We therefore suggest that BM MNCs represent a sensitive source to look for the presence of C-KIT 2468A[RIGHTWARDS ARROW]T or other mutations in patients with suspected systemic indolent mastocytosis.

References

  1. Top of page
  2. Abstract
  3. Patients and methods
  4. Results
  5. Discussion
  6. References
  • Afonja, O., Amorosi, E., Ashman, L., Takeshita, K. (1998) Multilineage involvement and erythropoietin-′independent′ erythroid progenitor cells in a patient with systemic mastocytosis. Annals of Hematology, 77, 183186.
  • Akin, C., Kirshenbaum, A.S., Semere, T., Worobec, A.S., Scott, L.M., Metcalfe, D.D. (2000) Analysis of the surface expression of c-kit and occurence of the c-kit Asp816Val activating mutation in T cells, B cells, and myelomonocytic cells in patients with mastocytosis. Experimental Hematology, 28, 140147.
  • Beghini, A., Larizza, L., Cairoli, R., Morra, E. (1998) C-kit activating mutations and mast cell proliferation in human leukemia (letter). Blood, 92, 701702.
  • Beghini, A., Peterlongo, P., Ripamonti, C.B., Larizza, L. (2000) C-kit mutations in core binding factor leukemias (letter). Blood, 95, 726727.
  • Bennet, J.M., Catovsky, D., Daniel, M.T., Flandrin, G., Galton, D.A.G., Gralnick, H.R., Sultan, C. (1985) Proposed revised criteria for the classification of acute myeloid leukemia: a report of the French-American-British Cooperative Group. Annals of Internal Medicine, 103, 626629.
  • Boissan, M., Feger, F., Guillosson, J.J., Arock, M. (2000) C-Kit and c-kit mutations in mastocytosis and other hematological diseases. Journal of Leukocyte Biology, 67, 135148.
  • Bowen, D.T., Padua, R.A., Burnett, A.K., DeCastro, C.M., Kaufman, R.E. (1993) Two new polymorphisms but no mutations of the KIT gene in patients with myelodysplasia at positions corresponding to human FMS and murine W locus mutational hot spots. Leukemia, 7, 18831885.
  • Büttner, C., Henz, B.M., Welker, P., Sepp, N.T., Grabbe, J. (1998) Identification of activating c-kit mutations in adult-, but not in childhood-onset indolent mastocytosis: a possible explanation for divergent clinical behavior. Journal of Investigative Dermatology, 111, 12271231.
  • Costa, J.J., Demetri, G.D., Harrist, T.J., Dvorak, A.M., Hayes, D.F., Merica, E.A., Menchaca, D.M., Gringeri, A.J., Schwartz, L.B., Galli, S.J. (1996) Recombinant human stem cell factor (kit ligand) promotes human mast cell and melanocyte hyperplasia and functional activation in vivo. Journal of Experimental Medicine, 183, 26812686.
  • Furitsu, T., Tsujimura, T., Tono, T., Ikeda, H., Kitayama, H., Koshimizu, U., Sugahara, H., Butterfield, J.H., Ashman, L.K., Kanayama, Y., Matsuzawa, Y., Kitamura, Y., Kanakura, Y. (1993) Identification of mutations in the coding sequence of the proto-oncogene c-kit in a human mast cell leukemia cell line causing ligand-independent activation of c-kit product. Journal of Clinical Investigation, 92, 17361744.
  • Gari, M., Goodeve, A., Wilson, G., Winship, P., Langabeer, S., Linch, D., Vandenberghe, E., Peake, I., Reilly, J. (1999) C-kit proto-oncogene exon 8 in-frame deletion plus insertion mutations in acute myeloid leukaemia. British Journal of Haematology, 105, 894900.
  • Horan, R.F. & Austen, K.F. (1991) Systemic mastocytosis: retrospective review of a decade's clinical experience at the Brigham and Women's Hospital. Journal of Investigative Dermatology, 96, 5S13S.
  • Horny, H.P., Parwaresch, M.R., Lennert, K. (1985) Bone marrow findings in systemic mastocytosis. Human Pathology, 16, 808814.
  • Kimura, A., Nakata, Y., Katoh, O., Hyodo, H. (1997) c-kit point mutation in patients with myeloproliferative disorders. Leukemia and Lymphoma, 25, 281287.
  • Lawrence, J.B., Friedman, B.S., Travis, W.D., Chinchilli, V.M., Metcalfe, D.D., Gralnick, H.R. (1991) Hematologic manifestation of systemic mast cell disease: a prospective study of laboratory and morphologic features and their relation to prognosis. American Journal of Medicine, 91, 612624.
  • Lennert, K. & Parwaresch, M.R. (1979) Mast cells and mast cell neoplasia: a review. Histopathology, 3, 349365.
  • Longley, B.J., Tyrrell, L., Lu, S.Z., Ma, Y.S., Lanley, K., Ding, T.G., Duffy, T., Jacobs, P., Tang, L.H., Modlin, I. (1996) Somatic c-KIT activating mutation in urticaria pigmentosa and aggressive mastocytosis: establishment of clonality in a human mast cell neoplasm. Nature Genetics, 12, 312314.
  • Longley, Jr, B.J., Metcalfe, D.D., Tharp, M., Wang, X., Tyrrell, L., Lu, S.Z., Heitjan, D., Ma, Y. (1999) Activating and dominant inactivating c-KIT catalytic domain mutations in distinct clinical forms of human mastocytosis. Proceedings of the National Academy of Sciences of the United States of America, 96, 16091614.
  • Ma, Y., Longley, B.J., Wang, X., Blount, J.L., Langley, K., Caughey, G.H. (1999) Clustering of activating mutations in c-KIT's juxtamembrane coding region in canine mast cell neoplasms. Journal of Investigative Dermatology, 112, 165170.
  • Metcalfe, D.D. (1991) Classification and diagnosis of mastocytosis: current status. Journal of Investigative Dermatology, 96, 2S4S.
  • Nagata, H., Worobec, A.S., Oh, C.K., Chowdhury, B.A., Tannenbaum, S., Suzuki, Y., Metcalfe, D.D. (1995) Identification of a point mutation in the catalytic domain of the protooncogene c-kit in peripheral blood mononuclear cells of patients who have mastocytosis with an associated hematologic disorder. Proceedings of the National Academy of Sciences of the United States of America, 92, 1056010564.
  • Nagata, H., Worobec, A.S., Metcalfe, D.D. (1996) Identification of a polymorphism in the transmembrane domain of the protooncogene c-kit in healthy subjects. Experimental and Clinical Immunogenetics, 13, 210214.
  • Nagata, H., Okada, T., Worobec, A.S., Semere, T., Metcalfe, D.D. (1997) C-kit mutation in a population of patients with mastocytosis. International Archives of Allergy and Immunology, 113, 184186.
  • Nakata, Y., Kimura, A., Katoh, O., Kawaishi, K., Hyodo, H., Abe, K., Kuramoto, A., Satow, Y. (1995) C-kit point mutation of extracellular domain in patients with myeloproliferative disorders. British Journal of Haematology, 91, 661663.
  • Parwaresch, M.R., Horny, H.-P., Lennert, K. (1985) Tissue mast cells in health and disease. Pathology Research and Practice, 179, 439461.
  • Pignon, J.M., Giraudier, S., Duquesnoy, P., Jouault, H., Imbert, M., Vainchenker, W., Vernant, J.P., Tulliez, M. (1997) A new c-kit mutation in a case of aggressive mast cell disease. British Journal of Haematology, 96, 374376.
  • Reinacher-Schick, A., Petrasch, S., Longley, B.J., Teschendorf, C., Graeven, U., Schmiegel, W. (1998) C-kit mutation and osteopetrosis-like osteopathy in a patient with systemic mast cell disease. Annals of Hematology, 77, 131134.
  • Sambrook, J., Fritsch, E.F., Maniatis, T. (1989) Molecular cloning. A Laboratory Manual. Cold Spring Harbor Laboratory Press, New York.
  • Sheffield, V.C., Beck, J.S., Kwitek, A.E., Sandstrom, D.W., Stone, E.M. (1993) The sensitivity of single-strand conformation polymorphism analysis for the detection of single base substitutions. Genomics, 16, 325332.
  • Sperr, W.R., Walchshofer, S., Horny, H.P., Födinger, M., Simonitsch, I., Fritsche-Polanz, R., Schwarzinger, I., Tschachler, E., Sillaber, C., Hagen, W., Geissler, K., Chott, A., Lechner, K., Valent, P. (1998) Systemic mastocytosis associated with acute myeloid leukaemia: report of two cases and detection of the c-kit mutation Asp-816 to Val. British Journal of Haematology, 103, 740749.
  • Travis, W.D., Li, C.Y., Yam, L.T., Bergstralh, E.J., Swee, R.G. (1988) Significance of systemic mast cell disease with associated hematologic disorders. Cancer, 62, 965972.
  • Tsujimura, T., Furitsu, T., Morimoto, M., Isozaki, K., Nomura, S., Matsuzawa, Y., Kitamura, Y., Kanakura, Y. (1994) Ligand-independent activation of c-kit receptor tyrosine kinase in a murine mastocytoma cell line P-815 generated by a point mutation. Blood, 83, 26192626.
  • Tsujimura, T., Furitsu, T., Morimoto, M., Kanayama, Y., Nomura, S., Matsuzawa, Y., Kitamura, Y., Kanakura, Y. (1995) Substitution of an aspartic acid results in constitutive activation of c-kit receptor tyrosine kinase in a rat tumor mast cell line RBL-2H3. International Archives of Allergy and Immunology, 106, 377385.
  • Tsujimura, T., Morimoto, M., Hashimoto, K., Moriyama, Y., Kitayama, H., Matsuzawa, Y., Kitamura, Y., Kanakura, Y. (1996) Constitutive activation of c-kit in FMA3 murine mastocytoma cells caused by deletion of seven amino acids at the juxtamembrane domain. Blood, 87, 273283.
  • Ullrich, A. & Schlessinger, J. (1990) Signal transduction by receptors with tyrosine activity. Cell, 61, 203212.
  • Valent, P. (1996) Biology, classification and treatment of human mastocytosis. Wiener Klinische Wochenschrift, 108, 385397.
  • Valent, P., Spanblöchl, E., Sperr, W.R., Sillaber, C., Agis, H., Strobl, H., Zsebo, K.M., Geissler, K., Bettelheim, P., Lechner, K. (1992) Induction of differentiation of human mast cells from bone marrow and peripheral blood mononuclear cells by recombinant human stem cell factor (SCF) / kit ligand (KL) in long term culture. Blood, 80, 22372245.
  • Werle, E., Schneider, C., Renner, M., Völker, M., Fiehn, W. (1994) Convenient single-step, one tube purification of PCR products for direct sequencing. Nucleic Acids Research, 22, 43544355.
  • Witte, O.N. (1990) Steel locus defines new multipotent growth factor. Cell, 63, 56.
  • Worobec, A.S., Semere, T., Nagata, H., Metcalfe, D.D. (1998a) Clinical correlates of the presence of the Asp816Val c-kit mutation in the peripheral blood mononuclear cells of patients with mastocytosis. Cancer, 83, 21202129.
  • Worobec, A.S., Akin, C., Scott, L.M., Metcalfe, D.D. (1998b) Cytogenetic abnormalities and their lack of relationship to the Asp816Val c-kit mutation in the pathogenesis of mastocytosis. Journal of Allergy and Clinical Immunology, 102, 523524.
  • Yarden, Y., Kuang, W.J., Yang-Feng, T., Coussens, L., Munemitsu, S., Dull, T.J., Chen, E., Schlessinger, J., Francke, U., Ullrich, A. (1987) Human proto-oncogene c-kit: a new cell surface receptor tyrosine kinase for an unidentified ligand. EMBO Journal, 6, 33413351.