SEARCH

SEARCH BY CITATION

Keywords:

  • thrombopoietin;
  • IL-6;
  • surgery;
  • platelet counts;
  • inflammatory cytokines

Abstract

  1. Top of page
  2. Abstract
  3. Patients and methods
  4. Results
  5. Discussion
  6. References

Thrombopoietin (Tpo), the main regulator of thrombocytopoiesis, is a probable candidate to play a role in the increase in platelet counts that is frequently seen after surgery. In the current study, serial blood samples of patients that underwent major surgery were analysed with respect to Tpo kinetics, platelet turnover and inflammatory cytokines. Platelet Tpo content and plasma Tpo levels rose before platelet counts increased, suggesting that Tpo was indeed responsible for the elevation in platelet counts. In addition, an increase in interleukin 6 (IL-6) levels, but not in IL-11 and tumour necrosis factor alpha levels, was seen before the rise in Tpo concentration. In vitro, IL-6 was shown to enhance Tpo production by the HepG2 liver cell line. Thus, increased Tpo levels after surgery, possibly resulting from enhanced Tpo production under the influence of IL-6 or other inflammatory cytokines, are involved in an enhanced thrombocytopoiesis.

In response to major surgery, reactive thrombocytosis may occur (Pepper & Lindsay, 1960; Robbins & Barnard, 1983; Adams, 1994). Particularly after coronary bypass surgery, reactive thrombocytosis represents a risk factor for thrombotic complications (Schmuziger et al, 1995; Christenson et al, 1996). A maximal rise in platelet count has been observed from d 7 to d 20 post surgery and may encompass a platelet increase of more than 100% (Pepper & Lindsay, 1960; Robbins & Barnard, 1983; Adams, 1994; Schmuziger et al, 1995; Christenson et al, 1996; Cerutti et al, 1999). The exact mechanism leading to the rise in platelet counts is unknown. Thrombopoietin (Tpo) is the main regulator of platelet production (Kaushansky, 1995) and, therefore, is a probable candidate to play a role in the platelet rise. Tpo alone can stimulate both proliferation and differentiation of megakaryocytic cells, which eventually results in the release of platelets in the circulation (Wendling et al, 1994; Choi et al, 1995; Debili et al, 1995a; Kaushansky et al, 1995; Cramer et al, 1997; Gehling et al, 1997; Norol et al, 1998). A potential increase in circulating Tpo after major surgery may arise via different mechanisms. Tpo production might be enhanced or Tpo clearance might be decreased. Alternatively, as we reported previously (Folman et al, 2000), Tpo might be released from activated platelets, which will also result in increased levels of circulating Tpo. Under normal conditions, Tpo is produced constitutively by the liver and, to a lesser extent, by the kidneys and is removed from the circulation by binding to the Tpo receptor, Mpl, which is present on platelets and megakaryocytic progenitors (Debili et al, 1995b; Fielder et al, 1996, 1997; Li et al, 1999). In cases of thrombocytopenia, bone marrow stromal cells have also been reported to produce Tpo (Sungaran et al, 1997; Hirayama et al, 1998).

In the current study, the kinetics of circulating and platelet-associated Tpo and the potential mechanisms underlying Tpo regulation in patients undergoing major surgery were addressed in detail. Serial samples of patients undergoing orthopaedic or cardiac surgery were analysed with respect to platelet count, plasma Tpo concentration and platelet Tpo content. Plasma glycocalicin (GC) concentrations were determined as a measure of platelet turnover. Inflammatory cytokines might play a role in thrombocytopoiesis either directly or indirectly via enhancement of Tpo production. Plasma interleukin 6 (IL-6), IL-11 and tumour necrosis factor alpha (TNFα) were measured as representatives of these cytokines. To investigate whether inflammatory cytokines or other factors could influence Tpo production, a liver cell line, a bone marrow endothelial cell line and primary bone marrow stromal cells were cultured with different cytokines and Tpo production was analysed.

Patients and methods

  1. Top of page
  2. Abstract
  3. Patients and methods
  4. Results
  5. Discussion
  6. References

Patients Upon informed consent, four patients (three women, one man; aged 70 ± 11 years) undergoing hip replacement surgery, three patients undergoing a knee replacement operation (two men, one woman; aged 65 ± 20 years) and nine patients (seven men, two women; aged 65 ± 12 years) undergoing coronary artery bypass graft surgery (CABG) were enrolled in the study. No complications occurred during the operations. Before surgery, patients undergoing CABG were treated with dexamethasone (1 mg/kg b.w.) and the total blood volume was adjusted by infusion of crystalloids. During surgery, CABG patients were connected to extracorporal circulation (ECC).

Blood collection and processing Venous blood anticoagulated with EDTA was obtained from all surgical patients at different time-points before and after surgery. For the CABG patients, blood was drawn on the day before surgery, on the day of surgery before connection to ECC, directly after disconnection and 6 h after disconnection. Thereafter, blood was drawn on every subsequent day for a period of 10 d. The same blood collection strategy was applied for patients undergoing hip or knee replacement surgery, except that blood was drawn before the operation on the day of surgery and 1, 3 and 6 h, respectively, after the operation. Platelets were routinely counted with the Technicon H3 RTX System (Bayer, Tarrytown, NY, USA). Blood was processed within 4 h after collection. Blood was spun at 850 g for 10 min and platelet-rich plasma was collected. After centrifugation for 7 min at 1700 g, plasma was collected and stored at −20°C until use. Platelets were washed once with phosphate-buffered saline (PBS) containing 2% (w/v) bovine serum albumin (BSA) and 5 mmol/l EDTA. Platelets were suspended in 1 ml of PBS and disrupted by freezing at −20°C. Before freezing, the platelet number was counted.

Tpo and GC enzyme-linked immunosorbent assay (ELISA) Thrombopoietin levels and plasma glycocalicin levels were determined using a sandwich ELISA as previously described (Folman et al, 1997; Porcelijn et al, 1998). In addition, Tpo was measured in the supernatants of platelets disrupted by freezing.

IL-6, IL-11 and TNFα ELISA For measurement of the concentration of IL-6 and TNFα in plasma, the commercially available IL-6 and TNFα ELISA kits (Pelikine kit, CLB, the Netherlands) were used. The Quantikine IL-11 ELISA kit was purchased from R & D systems (Minneapolis, MN, USA).

Albumin concentration As a parameter for the change in plasma water content as a result of the infusion of crystalloids and, thus, of the change in plasma volume, plasma albumin concentration was routinely measured in a colorimetric assay with a Hitachi 747 (Boehringer Mannheim, Mannheim, Germany). In the CABG group, the measurements of platelet counts and plasma Tpo, GC and IL-6 concentrations at the different time-points were corrected for haemodilution by multiplication with the following ratio: concentration of albumin before ECC divided by concentration of albumin at time-point of interest.

Cell culture The HepG2 cell line was grown in Iscove's modified Dulbecco's medium (IMDM) supplemented with 5% (v/v) heat-inactivated fetal calf serum (FCS; Gibco BRL, Breda, The Netherlands), penicillin (100 U/ml), streptomycin (100 μg/ml) and glutamine (300 μg/ml). Before testing, cells were transferred to 12-well tissue-culture plates (Costar, Cambridge, MA, USA) (4 × 105 cells/well) and left to adhere. The previously described human bone marrow endothelial cell line, HBMEC-60 (Rood et al, 2000), was cultured until confluency in fibronectin (CLB)-coated 12-well tissue culture plates (Costar) and was maintained in Medium-199 with 25 mmol/l HEPES buffer (Gibco BRL) supplemented with 10% (v/v) pooled heat-inactivated human serum (CLB), 10% (v/v) heat-inactivated FCS (Gibco BRL), 1 ng/ml basic fibroblast growth factor (bFGF; Boehringer Mannheim), 5 U/ml heparin (Leo Pharmaceutical products, Weesp, The Netherlands), 0·3 mg/ml glutamine (Sigma Chemical, St. Louis, MO, USA), penicillin (100 U/ml), streptomycin (100 U/ml) and geneticin (G418) (Gibco, BRL). Bone marrow (BM) stromal cells were obtained upon informed consent from the sternal aspirate of patients undergoing cardiac surgery. The mononuclear cell fraction was isolated by density centrifugation over Ficoll-Paque (Pharmacia, Uppsala, Sweden; specific gravity 1·077 g/cm3). Cells were plated in 12-well tissue-culture plates (Costar) and grown in medium consisting of 45% IMDM, 45% Roswell Park Memorial Institute (RPMI) medium supplemented with 0·3 mg/ml glutamine and 10% FCS. Upon adherence, the non-adherent cells were removed and the medium was replaced. Thereafter, 50% of the medium was replaced once weekly until a confluent monolayer was obtained. All cells were grown in a humidified incubator at 37°C with 5% CO2.

The influence on Tpo production of the following factors diluted in IMDM supplemented with 0·1% BSA was assessed: IL-1β (10 ng/ml), IL-6 (25 ng/ml) TNFα (10 ng/ml), transforming growth factor beta (TGFβ; 2 ng/ml). Before incubation with the various cytokines, cells were washed free of culture medium. All cultures were performed in triplicate in a final volume of 750 μl. IL-1β was purchased from Preprotech (Rocky Hill, NJ, USA), IL-6 from the CLB, TNFα was from Calbiochem (Bad Soden, Germany) and TGFβ from Strathmann Biotech GmbH. Supernatants of BM stromal cells and HBMEC-60 were concentrated 15-fold by centrifugation for 30 min at 5000 g with a Centricon centrifugal filter device YM30 (Millipore Corporation, Bedford, MA, USA).

RNA isolation and cDNA synthesis Total RNA was isolated with RNAzol (Tel Test, Friendswood, TX, USA) according to the manufacturer's instructions. Approximately 1 μg of RNA was reverse transcribed with 5 units of Moloney murine leukaemia virus (M-MLV) reverse transcriptase (Gibco BRL) in 1× reverse transcription (RT) reaction buffer (Gibco BRL) to which 1·5 μg of random primers (Gibco BRL), 10 mmol/l dithiothreitol (DTT; Gibco BRL), 20 units of RNAsin (Promega, Madison, WI, USA) and 0·5 mmol/l DNTP (Pharmacia-Biotech, Uppsala, Sweden) were added. The cDNA reaction was performed for 1 h at 37°C in a total volume of 20 μl. After an inactivation step of 10 min at 85°C, the mixture was supplemented with 30 μl of distilled water. Of this mixture, a 100-fold dilution was prepared, of which 5 μl was used for polymerase chain reaction (PCR) amplification. For the standard curve, cDNA from a HepG2 culture was prepared. Five 10-fold dilutions were prepared from the (undiluted) reaction mixture.

TaqMan RT-PCR Tpo primers and a Tpo probe were designed with the Primer Express version 1·0 software (PE Biosystems, Foster City, CT, USA) and the oligo 6·1 software (Wojciech Rychlik, Ph.D., Molecular Biology Insights, Cascade, CO, USA). The following oligonucleotides in 5′ to 3′ orientation were selected: Tpo forward primer, GCTGCCTGCTGTGGACTTTAG; Tpo reverse primer, GGTC ACTGCTCCCAGAATGTC; and Tpo TaqMan probe, TGCC TTGGTCTCCTCCATCTGGGT. The probe was chosen at the exon 4/exon 5 transition and carried a FAM reporter dye at the 5′-end and a TAMRA quencher dye at the 3′-end. The housekeeping gene porphobilinogen deaminase (PBGD) was used as an input control (Mensink et al, 1998).

For amplification, the TaqMan 1000 Reactions Gold with Buffer A kit (PE Biosystems) was used. The reaction was carried out in a closed tube in a total volume of 50 μl, containing 1× TaqMan buffer A, 5 mmol/l MgCl2, 200 μmol/l each DNTP, 300 nmol/l either the Tpo or the PBGD primers, 100 nmol/l probe, 1·25 U of AmpliTaq Gold (PE Biosystems) and 5 μl of cDNA.

The reaction procedure was as follows: 10 min at 95°C followed by 50 cycles of 15 s at 95°C and 1 min at 60°C. Fluorescence data were collected during the annealing/extension phase of every cycle by means of the ABI PRISM 7700 Sequence Detection System, containing a thermal cycler (PE Biosystems). In each experiment, a HepG2 standard curve and a negative control (no cDNA input) was included. All experiments were performed in duplicate. A standard curve was calculated in which the increase in fluorescence (ΔRn) was proportional to the concentration of template in the control. From this standard curve the amount of amplicon in the samples was calculated.

Statistical analysis The software package spss for windows, release 7·5 (SPSS, Chicago, IL, USA) was used for statistical analysis. A P-value < 0·05 was considered significant. The paired-samples t-test was used to compare serial sample values with baseline values. An independent sample t-test was used to assess differences in Tpo secretion in cell cultures.

Results

  1. Top of page
  2. Abstract
  3. Patients and methods
  4. Results
  5. Discussion
  6. References

Patients undergoing knee or hip surgery

In Fig 1A–D, box plots are shown representing platelet counts, plasma Tpo concentration, platelet Tpo content and plasma IL-6 concentration for the patients undergoing knee or hip surgery. One day before surgery, a sample was drawn to establish baseline values. Blood was sampled 1,3 and 6 h after surgery and, thereafter, blood was collected daily up to d 10. The mean value of measurements performed on d 4 and 5, d 6 and 7, and d 8, 9 and 10 are shown. When compared with platelet counts at baseline (day before surgery), platelet counts initially dropped after surgery and started to rise after d 2. Four days after surgery, platelet counts significantly rose above baseline level and continued to rise until the end of the observation period (Fig 1A). The increment in platelet count was preceded by a rise in plasma Tpo concentration (Fig 1B). The Tpo level was significantly increased above baseline on d 1 after surgery, peaked around d 3 and had returned to baseline after 5 d. The amount of Tpo per platelet was significantly increased on d 1 after surgery and decreased again on d 3, despite the presence of an increased circulating Tpo concentration (Fig 1C). The rise in Tpo content per platelet preceded the increase in plasma Tpo concentration. Within hours after surgery, the plasma IL-6 concentration increased (Fig 1D). IL-6 levels were not detectable at baseline in five out of six patients. IL-6 levels were highest around 6 h and then started to drop again. Neither IL-11 nor TNFα could be detected at any tested time point up to d 3 after surgery. During follow-up, no significant change in plasma GC was measured.

image

Figure 1.  (A–D) Box plots representing the serial measurements of various variables in patients undergoing orthopaedic surgery. Shown are baseline values (d −1), 1 h, 3 h and 6 h after surgery, and 1 d, 2 d and 3 d after surgery. Mean values of d 4 and 5, d 6 and 7 and d 8, 9 and 10 are shown because the whole series could not be completed for each patient. Asterisks indicate a significant difference (*P < 0·05; **P < 0·01) compared with baseline value. Circles represent outliers (cases with values between 1·5 and three box lengths). Boxes represent the interquartile range containing 50% of all values. The line across the box indicates the median, whereas the whiskers extend to the highest and the lowest value. No statistical analysis was performed for IL-6 because, at baseline, levels were under the detection limit of the test (10 pg). In the figure, these values were arbitrarily set at 10 pg/ml.

Download figure to PowerPoint

In summary, IL-6 levels peaked within hours after surgery followed by a rise in Tpo concentration. The rise in Tpo concentration was initially reflected by an increase in platelet-associated Tpo which preceded the rise in the circulating Tpo concentration. After the Tpo peak, platelet counts rose above baseline value.

Patients undergoing CABG

Figure 2A–D shows the box plots for the different variables in patients undergoing CABG. Before surgery, patients received fluid infusion in order to adjust the circulating blood volume. To correct for haemodilution, platelet count, plasma Tpo, IL-6 and GC concentrations were recalculated by means of the albumin concentration. The concentration of the different variables before connection to the ECC (that is, after haemodilution) were taken as the baseline value. A similar response of the different variables upon CABG surgery was seen as in the patients undergoing orthopaedic surgery. The rise in platelet count, which was significantly elevated compared with baseline on d 6/7, was preceded by a peak in plasma Tpo concentration. Platelet counts rose from baseline 163 ± 76 × 109/l to 320 ± 95 × 109/l at the last time-point, d 8/9/10. Similarly, as with the orthopaedic patients, peak Tpo levels were seen at d 3 after CABG surgery. Again, an increase in Tpo per platelet occurred before the peak in plasma Tpo levels. The Tpo concentration per platelet was significantly elevated compared with baseline on d 1–4, with peak levels found around d 2. The IL-6 concentration rose directly after surgery. For four out of eight patients, IL-6 levels were highest 6 h after disconnection from ECC. For one patient, the peak day could not be determined because samples were only collected until 6 h after ECC. For two patients an IL-6 peak was seen at d 2, and for one patient this was seen on d 4. Also in this patient group, IL-11 and TNFα could not be detected and GC concentrations did not significantly change during follow-up.

image

Figure 2.  (A–D) Box plots representing the serial measurements of various variables in patients undergoing CABG. Except for the amount of Tpo per platelet (C), all variables measured in plasma were corrected for haemodilution by amplification with the albumin ratio (concentration of albumin before ECC divided by concentration of albumin at time-point of interest). Shown are baseline values (before connection to ECC), mean values directly after disconnection of the ECC, 6 h after disconnection and 1, 2 and 3 d after surgery. As in Fig 1, mean values of d 4 and 5, d 6 and 7 and d 8, 9 and 10 are shown. Triangles represent extreme values (cases with values over three box lengths). Further definitions are given in the legend for Fig 1.

Download figure to PowerPoint

Cell cultures

To investigate whether stimulation of (potential) Tpo-producing cells with inflammatory cytokines could influence Tpo production, HepG2 cells, BM stromal cells and HBMEC-60 were cultured in the presence or absence of several growth factors. HBMEC-60 did not produce Tpo after 48 h of culture with IL-1β, IL-6, TNFα or TGFβ. After a 15-fold concentration of the supernatants, still no Tpo could be detected. Similarly, no Tpo was detected in either the non-concentrated or concentrated supernatants of BM stromal cells after 48 h of exposure to the cytokines. The HepG2 cell line did produce Tpo (Fig 3A). A significant increment in Tpo concentration was present when cells were cultured for 24 h with IL-6. On average, Tpo production by HepG2 cells increased 1·5-fold in the presence of IL-6. IL-1β, TNFα and TGFβ did not significantly influence the final Tpo concentration. To assess whether the increment in Tpo concentration in the IL-6 cultures resulted from an increased Tpo mRNA production per cell, the Tpo mRNA content was analysed with TaqMan RT-PCR. Figure 3B shows the Tpo mRNA content relative to the expression of PBGD mRNA. No significant difference in Tpo mRNA expression was present in either one of the tested conditions compared with the control.

image

Figure 3.  Tpo production by unstimulated and stimulated HepG2 cells. (A) (upper) Mean and standard deviation of the Tpo concentration in the supernatants of triplicate cultures after 24 h are shown. The cultures stimulated with IL-6 showed a significantly higher Tpo concentration than the control cultures. (B) (upper) Tpo mRNA transcription in the different cultures relative to transcription of the housekeeping gene PBGD which served as an input control. RNA was isolated from triplicate cultures and processed separately. Mean and standard deviation are shown.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Patients and methods
  4. Results
  5. Discussion
  6. References

The current study shows that the reactive increase in platelets that is often seen after major surgery is probably caused by an increment in circulating Tpo, the main regulator of thrombocytopoiesis. The increase in platelet Tpo content suggested that the rise in circulating Tpo is first reflected by enhanced Tpo uptake by platelets. Previously, several in vitro studies have shown that platelets bind and internalize Tpo (Fielder et al, 1996, 1997; Broudy et al, 1997; Li et al, 1999). A change in average Tpo content per platelet in vivo, however, has to our knowledge not been reported before.

It is of note that the Tpo uptake per platelet initially increased, as evidenced by the increased platelet Tpo content, but as circulating Tpo levels increased, the platelet Tpo content decreased again. The cause of this decrease is unknown. Possibly, the total receptor expression diminishes as a result of internalization of the Tpo–Mpl complex and subsequent processing. Alternatively, platelets with a high Tpo content might represent aged platelets that leave the circulation.

In accordance with our findings, an elevation in circulating Tpo upon surgery has been reported by Hobisch-Hagen et al (1998) and Cerutti et al (1999). The former group reported that significantly elevated serum Tpo levels (compared with levels before haemodilution) occurred 3 h after surgery. This early increment might be attributed to the measurement of serum instead of plasma Tpo levels. Previously, we have shown that platelets can release Tpo and that serum levels are, on average, 3·4 times higher than plasma Tpo levels (Folman et al, 1997, 2000). In serum, both Tpo released from platelets and circulating Tpo is measured. Cerutti et al (1999) reported elevated plasma Tpo levels with a peak at d 3, which was associated with a rise in IL-6 concentrations, in patients undergoing hip replacement surgery. In our study, IL-6 levels peaked within hours after surgery and preceded the peak in platelet-associated Tpo.

A similar sequence of events (an IL-6 peak followed by an increase in circulating Tpo and platelet counts) was noted in patients with Kawasaki disease and upon induction of endotoxaemia in healthy individuals (Ishiguro et al, 1998; Stohlawetz et al, 1999).

Recently, it was shown that, in healthy individuals who received a bolus injection of recombinant human megakaryocyte growth and development factor (rHu-MGDF), the rise in platelet count, a reflection of enhanced thrombopoiesis, followed a few days after the rise in circulating Tpo (Harker et al, 2000). In line with this observation, we observed a 2–3 d delay before platelet counts started to rise. This suggests that the increased Tpo levels in the surgery patients might indeed have caused the rise in platelet counts.

Although platelet counts decreased immediately after surgery and gradually increased over time, no change in the GC concentration was observed. Previously, GC has been shown to be a marker for platelet turnover and is thought to be enzymatically cleaved from the platelet during destruction (Coller et al, 1984; Steinberg et al, 1987; Beer et al, 1994). It is probable that the follow-up of the patients in this study was too short to detect an increment in GC concentration because the newly produced platelets were still viable at the end of the follow-up. This is in agreement with results from a study in which patients were treated with MGDF (O'Malley et al, 1996). In these patients, GC levels started to rise 3 d after the start of the increase in platelet count.

The exact origin of the increase in circulating Tpo is unknown and might involve several mechanisms. According to the model in which the total platelet and megakaryocyte mass affects the amount of circulating Tpo via receptor-mediated binding (Kuter & Rosenberg, 1995), a decrease in platelet mass might result in increased Tpo levels. In patients undergoing CABG, a decrease in platelet mass was not reflected by a decrease in platelet counts. However, it is plausible that platelets are also consumed in these patients. The absence of a decrease in circulating numbers might result from an enhanced platelet release by the splenic pool or other compartments, thus masking platelet turnover in the periphery.

Another mechanism that might contribute to the Tpo increment is Tpo release by activated platelets. Previously, we and colleagues have shown that Tpo levels are elevated in patients with disseminated intravascular coagulation (Hiyoyama et al, 1997; Kawasugi et al, 1998; Folman et al, 2000) and correlate with markers for thrombin generation (Folman et al, 2000). In those patients, massive platelet activation occurs. Mild induction of endotoxaemia in healthy individuals also leads to an elevation of plasma Tpo levels (Stohlawetz et al, 1999). In analogy, Tpo might also be released by platelets activated upon surgery.

A third mechanism that might be involved is enhanced production of Tpo. To date, no regulation at the mRNA level has been reported for the liver and kidney in response to thrombocytopenia or thrombocytosis (Stoffel et al, 1996). In contrast, Tpo production by BM stromal cells can be induced. In patients with thrombocytopenia as a result of bone marrow aplasia or idiopathic thrombocytopenic purpura, an increased Tpo mRNA concentration in bone marrow was found (Sungaran et al, 1997; Hirayama et al, 1998). It has been reported that platelet α-granular proteins such as platelet-derived growth factor (PDGF), fibroblast growth factor (FGF), platelet factor 4 (PF4), thrombospondin (TSP) and TGFβ could influence the production of Tpo by BM stromal cells (Sakamaki et al, 1999; Sungaran et al, 2000). Apart from these proteins, enhanced Tpo production might be induced under the influence of cytokines and/or growth factors that are involved in the inflammatory reaction upon surgery. Elevated levels of IL-6 and acute-phase reactants such as C-reactive protein in combination with elevated Tpo levels have been reported in patients with thrombocytosis secondary to inflammation or infection (Cerutti et al, 1997; Uppenkamp et al, 1998; Hsu et al, 1999). In two studies in which blood was drawn at one time-point in each patient, Tpo levels correlated with IL-6 levels and acute-phase reactants (Cerutti et al, 1997; Hsu et al, 1999). To assess whether the production of Tpo could be influenced by inflammatory factors, cell lines or cells potentially involved in Tpo production, i.e. HepG2, BMEC and BM stromal cells, were cultured with IL-1β, IL-6, TNFα, TGFβ and compared with unstimulated cells. Tpo production was not seen for the BMEC and the BM stromal cells. In contrast, Sakamaki et al (1999) showed that TGFβ increased the expression of Tpo mRNA. However, Sungaran et al (2000) also found no upregulation but rather a downregulation of Tpo mRNA in BM stromal cells under the influence of TGFβ. Similar to our findings, Wolber & Jelkman (2000) reported no Tpo production by BM fibroblasts either cultured without growth factors or with IL-1β, IL-6 or TNFα.

HepG2 cells did produce Tpo and a significant increase in Tpo was seen upon stimulation of these cells with IL-6. Analysis of the amount of Tpo mRNA expression showed no evidence that the IL-6-related increase in Tpo production resulted from enhanced Tpo mRNA expression. Although an increase in the amount of Tpo mRNA was noted after 24 h, this did not reach statistical significance. Possibly, peak Tpo mRNA levels were present at an earlier time-point. Alternatively, IL-6 might have increased the stability of Tpo mRNA or induced increased Tpo secretion either directly or by enhancement of cell proliferation, thereby increasing the amount of produced Tpo. In agreement with our findings, Wolber & Jelkman (2000) reported a 1·5-fold increase in Tpo protein production. In their study, a significant twofold increase of the Tpo mRNA content was noted using competitive PCR for quantification in both the HepG2 and the Hep3B cell lines after 24 h of culture with IL-6. In contrast, Hino et al (1995) and Yang et al (1997) observed no enhanced protein production.

In addition to Tpo, IL-6, which is a thrombopoietic factor as well as a proinflammatory factor, might also be directly involved in thrombocytopoiesis. Although to a lesser extent than Tpo, IL-6 is able to support megakaryocytopoiesis (Ishibashi et al, 1989). The increase in IL-6 that was seen after surgery might therefore play a direct role in enhancing thrombocytopoiesis. Apart from IL-6 other thrombopoietic factors such as IL-1, IL-3 and IL-12 might contribute. Further studies should be performed to investigate this.

In conclusion, it is probable that the surgery-related increase in platelet counts is caused by increased platelet production under the influence of Tpo and, possibly, to some extent by IL-6 or other cytokines with thrombopoietic activity. Upon surgery, Tpo levels increased, as was demonstrated by an increased Tpo content per platelet followed by an increased level of circulating Tpo. The exact origin of the Tpo elevation is unknown, but possibly multiple mechanisms are involved, i.e. accumulation as a result of diminished uptake, Tpo release by activated platelets and enhanced production under the influence of IL-6. These findings may contribute to the clarification of the mechanisms underlying the finding that aspirin reduces the risk of pulmonary embolism and deep-vein thrombosis after surgery, as was demonstrated again recently in a large multicentre trial (Pulmonary Embolism Prevention (PEP) Trial Collaborative Group, 2000).

References

  1. Top of page
  2. Abstract
  3. Patients and methods
  4. Results
  5. Discussion
  6. References
  • Adams, E. (1994) Postoperative thrombocytosis. Archives of Internal Medicine, 73, 329.
  • Beer, J.H., Buchi, L., Steiner, B. (1994) Glycocalicin: a new assay-the normal plasma levels and its potential usefulness in selected diseases. Blood, 3, 691702.
  • Broudy, V.C., Lin, N.L.S., Abath, D.F., Papayannopoulou, T., Kaushansky, K. (1997) Human platelets display high affinity receptors for thrombopoietin. Blood, 89, 18961904.
  • Cerutti, A., Custodi, P., Duranti, M., Noris, P., Balduini, C.L. (1997) Thrombopoietin levels in patients with primary and reactive thrombocytosis. British Journal of Haematology, 99, 281284.
  • Cerutti, A., Custodi, P., Duranti, M., Cazzola, M., Balduini, C.L. (1999) Circulating thrombopoietin in reactive conditions behaves like an acute phase reactant. Clinical Laboratory and Haematology, 21, 271275.
  • Choi, E.S., Hokom, M., Bartley, T., Li, Y.S., Ohashi, H., Kato, T., Nichol, J.L., Skrine, J., Knudten, A., Chen, J., Hornkohl, A., Grampp, G., Sleeman, L., Cole, S., Trail, G., Hunt, P. (1995) Recombinant human megakaryocyte growth and development factor (rHuMGDF), a ligand for c-mpl, produces functional platelets in vitro. Stem Cells, 12, 317322.
  • Christenson, J.T., Gras, P.A., Grosclaude, A., Simonet, F., Schmuziger, M. (1996) Reactive thrombocytosis following coronary artery bypass surgery: a possible link to a lipid dysfunction. Journal of Cardiovascular Surgery (Torino), 37, 491498.
  • Coller, B.S., Kalomiris, E., Steinberg, M., Scudder, L.E. (1984) Evidence that glycocalicin circulates in normal plasma. Journal of Clinical Investigations, 73, 794799.
  • Cramer, E.M., Norol, F., Guichard, J., Breton-Gorius, J., Vainchenker, W., Masse, J.M., Debili, N. (1997) Ultrastructure of platelet formation by human megakaryocytes cultured with the mpl ligand. Blood, 89, 23362346.
  • Debili, N., Wendling, F., Katz, A., Guichard, J., Breton-Gorius, J., Hunt, P., Vainchenker, W. (1995a) The mpl-ligand or thrombopoietin or megakaryocyte growth and differentiative factor has both direct proliferative and differentiative activities on human megakaryocyte progenitors. Blood, 86, 25162525.
  • Debili, N., Wendling, F., Cosman, D., Titeux, M., Florindo, C., Dusanter-Fourt, I., Schooley, K., Methia, N., Charon, M., Nador, R., Bettaieb, A., Vainchenker, W. (1995b) The Mpl receptor is expressed in the megakaryocytic lineage from late progenitors to platelets. Blood, 85, 391401.
  • Fielder, P.J., Gurney, A.L., Stefanich, E., Marian, M., Moore, M.W., Carver-Moore, K., De Sauvage, F.J. (1996) Regulation of thrombopoietin levels by c-Mpl-mediated binding to platelets. Blood, 87, 21542161.
  • Fielder, P.J., Hass, P., Nagel, M., Stefanich, E., Widmer, R., Bennett, G.L., Keller, G.A., De Sauvage, F.J., Eaton, D. (1997) Human platelets as a model for the binding and degradation of thrombopoietin. Blood, 89, 27822788.
  • Folman, C.C., Dem Borne, A.E.G.KR., Rensink, I.H.J.A.M., Gerritsen, W., Van Der Schoot, C.E., De Haas, M., Aarden, L. (1997) Sensitive measurements of thrombopoietin by a monoclonal antibody based sandwich enzyme-linked immunosorbent assay. Thrombosis and Haemostasis, 78, 12621297.
  • Folman, C.C., Linthorst, G., Van Mourik, J.A., Van Willigen, G., De Jonge, E., Levi, M., De Haas, M., Dem Borne, A.E.G.K. (2000) Platelets release thrombopoietin (Tpo) upon activation: another regulatory loop in thrombocytopoiesis. Thrombosis and Haemostasis, 83, 923930 .
  • Gehling, U.M., Ryder, J.W., Hogan, C.J., Hami, L., McNiece, I., Franklin, W., Williams, S., Helm, K., King, J., Shpall, E.J. (1997) Ex vivo expansion of megakaryocyte progenitors: Effect of various growth factor combinations on CD34+ progenitor cells from bone marrow and G-CSF mobilized peripheral blood. Experimental Hematology, 25, 11251139.
  • Harker, L.A., Roskos, L.K., Marzec, U.M., Carter, R.A., Cherry, J.K., Sundell, B., Cheung, E.N., Terry, D., Sheridan, W. (2000) Effects of megakaryocyte growth and development factor on platelet production, platelet life span, and platelet function in healthy human volunteers. Blood, 95, 25142522.
  • Hino, M., Nishizawa, Y., Tagawa, S., Yamane, T., Morii, H., Tatsumi, N. (1995) Constitutive expression of the thrombopoietin gene in a human hepatoma cell line. Biochemistry and Biophysics Research Communications, 217, 475481.
  • Hirayama, Y., Sakamaki, S., Matsunaga, T., Kuga, T., Kuroda, H., Kusakabe, T., Sasaki, K., Fujikawa, K., Kato, J., Kogawa, K., Koyama, R., Niitsu, Y. (1998) Concentrations of thrombopoietin in bone marrow in normal subjects and in patients with idiopathic thrombocytopenic purpura, aplastic anemia, and essental thrombocythemia correlate with its mRNA expression of bone marrow stromal cells. Blood, 92, 4652.
  • Hiyoyama, K., Wada, H., Shimura, M., Nakasaki, T., Katayama, N., Nishsikawa, M., Shiku, H., Tahara, T., Kato, T. (1997) Increased serum levels of thrombopoietin in patients with thrombotic thrombocytopenic purpura, idiopathic thrombocytopenic purpura, or disseminated intravascular coagulation. Blood Coagulation and Fibrinolysis, 8, 345349.
  • Hobisch-Hagen, P., Schobersberger, W., Luz, G., Innerhofer, P., Jelkmann, W. (1998) Circulating immunoreactive thrombopoietin increases rapidly after normovolemic hemodilution [letter]. Thrombosis and Haemostasis, 80, 718719.
  • Hsu, H.C., Tsai, W.H., Jiang, M.L., Ho, C.H., Hsu, M.L., Ho, C.K., Wang, S.Y. (1999) Circulating levels of thrombopoietic and inflammatory cytokines in patients with clonal and reactive thrombocytosis. Journal of Laboratory and Clinical Medicine, 134, 392397.
  • Ishibashi, T., Kimura, H., Uchida, T., Kariyone, S., Friese, P., Burstein, S.A. (1989) Human interleukin 6 is a direct promoter of maturation of megakaryocytes in vitro. Proceedings of the National Academy of Sciences of the United States of America, 86, 59635957.
  • Ishiguro, A., Ishikita, T., Shimbo, T., Matsubara, K., Baba, K., Hayashi, Y., Naritaka, S., Nakahata, T. (1998) Elevation of serum thrombopoietin precedes thrombocytosis in Kawasaki disease. Thrombosis and Haemostasis, 79, 10961100.
  • Kaushansky, K. (1995) Thrombopoietin: The primary regulator of platelet production. Blood, 86, 419431.
  • Kaushansky, K., Broudy, V.C., Lin, N., Jorgensen, M.J., McCarty, J., Fox, N., Zucker-Franklin, D., Lofton-Day, C. (1995) Thrombopoietin, the Mp1 ligand, is essential for full megakaryocyte development. Proceedings of the National Academy of Sciences of the United States of America, 92, 32343238.
  • Kawasugi, K., Gotoh, M., Gohchi, K., Matuda, J., Kinoshita, T., Miyazaki, H. (1998) Increased endogenous levels of thrombopoietin and interleukin-6 without elevation of interleukin 11 in patients with DIC. (Abstract). Blood, 10, 32a.
  • Kuter, D.J. & Rosenberg, R.D. (1995) The reciprocal relationship of thrombopoietin (c-mpl ligand) to changes in the platelet mass during busulfan-induced thrombocytopenia in the rabbit. Blood, 85, 27202730.
  • Li, J., Xia, Y., Kuter, D.J. (1999) Interaction of thrombopoietin with the platelet c-mpl receptor in plasma: binding, internalization, stability and pharmacokinetics. British Journal of Haematology, 106, 345356.
  • Mensink, E., Van De Locht, A., Schattenberg, A., Linders, E., Schaap, N., Geurts, V.K., De Witte, T. (1998) Quantitation of minimal residual disease in Philadelphia chromosome positive chronic myeloid leukaemia patients using real-time quantitative RT-PCR. British Journal of Haematology, 102, 768774.DOI: 10.1046/j.1365-2141.1998.00823.x
  • Norol, F., Vitrat, N., Cramer, E., Guichard, J., Burstein, S.A., Vainchenker, W., Debili, N. (1998) Effects of cytokines on platelet production from blood and marrow CD34+ cells. Blood, 91, 830843.
  • O'Malley, C.J., Rasko, J.E.J., Basser, R.L., McGrath, K.M., Cebon, J., Grigg, A.P., Hopkins, W., Cohen, B., O'Byrne, J., Green, M.D., Fox, R.M., Berndt, M.C., Begley, C.G. (1996) Administration of pegylated recombinant human megakaryocyte growth and development factor to humans stimulates the production of functional platelets that show no evidence of vivo activation. Blood, 88, 32883298.
  • Pepper, H. & Lindsay, S. (1960) Responses of platelets, eosinophils and total leukocytes, during and following surgical procedures. Gynecological and Obstetric Surgery, 110, 319326.
  • Porcelijn, L., Folman, C.C., Bossers, B., Huiskes, E., Overbeeke, M.A.M., Van Der Schoot, C.E., De Haas, M., Dem Borne, A.E.G.KR. (1998) The diagnostic value of thrombopoietin levels measurements in thrombocytopenia. Thrombosis and Haemostasis, 79, 11011105.
  • Pulmonary Embolism Prevention (PEP) Trial Collaborative Group (2000) Prevention of pulmonary embolism and deep vein thrombosis with low dose aspirin: Pulmonary Embolism Prevention (PEP) trial. Lancet, 355, 12951302.DOI: 10.1016/s0140-6736(00)02110-3
  • Robbins, G. & Barnard, D.L. (1983) Thrombocytosis and microthrombocytosis: a clinical evaluation of 372 cases. Acta Haematologica, 70, 175182.
  • Rood, P.M.L., Von Calafat, J., Dem Borne, A.E.G.K., Gerritsen, W., Van Der Schoot, C.E. (2000) Immortalization of human bone-marrow endothelial cells: characterization of new cell lines. European Journal of Clinical Investigation, 30, 619629.
  • Sakamaki, S., Hirayama, Y., Matsunaga, T., Kuroda, H., Kusakabe, T., Akiyama, T., Konuma, Y., Sasaki, K., Tsuji, N., Okamoto, T., Kobune, M., Kogawa, K., Kato, J., Takimoto, R., Koyama, R., Niitsu, Y. (1999) Transforming growth factor-beta1 (TGF-beta1) induces thrombopoietin from bone marrow stromal cells, which stimulates the expression of TGF-beta receptor on megakaryocytes and, in turn, renders them susceptible to suppression by TGF-beta itself with high specificity. Blood, 94, 19611970.
  • Schmuziger, M., Christenson, J.T., Maurice, J., Simonet, F., Velebit, V. (1995) Reactive thrombocytosis after coronary bypass surgery. An important risk factor. European Journal of Cardiothoracic Surgery, 9, 393397.
  • Steinberg, M.H., Kelton, J.G., Coller, B.S. (1987) Plasma glycocalicin. An aid in the classification of thrombopenic disorders. New England Journal of Medicine, 317, 10371042.
  • Stoffel, R., Wiestner, A., Skoda, R.C. (1996) Thrombopoietin in thrombocytopenic mice: Evidence against regulation at the mRNA level and for a direct regulatory role of platelets. Blood, 87, 567573.
  • Stohlawetz, P., Von Folman, C.C., Dem Borne, A.E.G.K., Pernerstorfer, T., Eichler, H.G., Panzer, S., Jilma, B. (1999) Effects of endotoxemia on thrombopoiesis in men. Thrombosis and Haemostasis, 81, 613617.
  • Sungaran, R., Markovic, B., Chong, B.H. (1997) Localization and regulation of thrombopoietin mRNA expression in human kidney,liver, bone marrow, and spleen using in situ hybridization. Blood, 89, 101107.
  • Sungaran, R., Chisholm, O.T., Markovic, B., Khachigian, L.M., Tanaka, Y., Chong, B.H. (2000) The role of platelet alpha-granular proteins in the regulation of thrombopoietin messenger RNA expression in human bone marrow stromal cells. Blood, 95, 30943101.
  • Uppenkamp, M., Makarova, E., Petrasch, S., Brittinger, G. (1998) Thrombopoietin serum concentration in patients with reactive and myeloproliferative thrombocytosis. Annals of Hematology, 77, 217223.DOI: 10.1007/s002770050446
  • Wendling, F., Maraskovsky, E., Debili, N., Florindo, C., Teepe, M., Titeux, M., Methia, N., Breton-Gorius, J., Cosman, D., Vainchenker, W. (1994) c-Mpl ligand is a humoral regulator of megakaryocytopoiesis. Nature, 369, 571574.
  • Wolber, E.M. & Jelkman, W. (2000) Interleukin-6 increases thrombopoietin production in human hepatoma cells HepG2 and Hep3B. Journal of Interferon and Cytokine Research, 20, 499506.
  • Yang, C., Xia, Y., Kuter, D.J. (1997) The HepG2 cell as a model system for studying thrombopoietin production and regulation. Blood, 90 suppl. 1, 3427(abstract).