SEARCH

SEARCH BY CITATION

Keywords:

  • sideroblastic anaemia;
  • spinocerebellar ataxia;
  • ABC transporters;
  • mitochondrial iron;
  • iron sulphur clusters

Abstract

  1. Top of page
  2. Abstract
  3. Patients and methods
  4. Results
  5. Discussion
  6. Acknowledgments
  7. References

Two brothers with X-linked ataxia (XLA) were found to have hypochromic red cells and increased erythrocyte protoporphyrin despite normal iron stores. The mother was unaffected by ataxia and had normal iron stores but showed evidence of some red cell hypochromia with heavy basophilic stippling that stained positive for iron. Bone marrow biopsy confirmed the presence of ring sideroblasts in one of the brothers. The absence of mutations in the ALAS2 gene and the predominance of zinc over free protoporphyrin led to a search using a combination of DNA and cDNA analysis for the presence of mutations in the ABC7 gene. ABC7 encodes a mitochondrial half-type ATP Binding Cassette transporter involved in iron homeostasis. The published cDNA sequence was used to search databases for the genomic sequence of which 12 exons spanning 23·4 kb were mapped leaving the most 5′ nucleotides unaccounted for. The identified exons and their exon–intron boundaries were amplified from DNA while the most 5′ sequence including the initiation codon was amplified from cDNA of peripheral blood cells. Direct sequencing revealed hemizygosity in the brothers and heterozygosity in the mother for a G[RIGHTWARDS ARROW]C transversion at position 1299 of the published cDNA. This predicts a V411L substitution at the beginning of the last of six putative transmembrane regions of the protein. Restriction enzyme digestion confirmed the presence of this mutation in the three family members but could not detect it in 200 normal alleles. An uncle affected by ataxia also carried this mutation. This study supports the recently hypothesized involvement of the ABC7 gene in XLSA/A and highlights a protein structure region of importance to this syndrome.

The sideroblastic anaemias (SA) comprise a number of different conditions with varied haematological features and clinical outcomes. They are characterized by the presence in erythroblasts of iron-loaded mitochondria visualized by Perl's staining as a perinuclear ring of Prussian blue granules. Ineffective erythropoiesis is a typical associated abnormality and may predominate causing anaemias of varying severity. Some patients require regular blood transfusions for survival while others may have such a need offset only by supplementation of the diet with pyridoxine or thiamine. The red cells show some degree of hypochromia and may contain basophilic, iron-staining inclusions known as Pappenheimer bodies. Iron overload as a result of increased iron absorption, treatment with blood transfusions or inappropriate treatment with iron is an important cause of morbidity and mortality (Bottomley, 1998). When the sideroblastic anaemia is part of a clinical syndrome such as Pearson's syndrome, other aspects of pathology may be the focus of attention for its clinical management (Pearson et al, 1979).

The genetic causes of ringed sideroblasts show various patterns of inheritance indicating heterogeneity. Until recently, mutations in the X-linked, erythroid-specific ALA synthase gene (ALAS2) and large deletions of mitochondrial DNA were the only known molecular causes (reviewed in May & Fitzsimons, 1994). More recently, homozygosity mapping has identified two further loci at 4p16.1 and 1q23.3 involved in thiamine-responsive forms of SA with autosomal recessive inheritance (Borgna-Pignatti et al, 1989; Inoue et al, 1998; Strom et al, 1998; Labay et al, 1999). Somatic mutations in cytochrome oxidase and other mitochondrial genes have been implicated in refractory anaemia with ring sideroblasts, an acquired form of SA (Gatterman et al, 1996; Gatterman, 1999). Autosomal recessive inheritance has been observed in SA unresponsive to thiamine and autosomal dominant inheritance has also been observed (Bottomley, 1998).

In addition, a form of X-linked SA distinct from those caused by abnormalities in ALAS2 has been described. This form of sideroblastic anaemia is rare and is associated with spinocerebellar ataxia (XLSA/A; OMIM number 301310) (Pagon et al, 1985). Haematological analysis of the affected hemizygotes revealed microcytic, hypochromic red cells with raised erythrocyte protoporphyrin levels. Patients presented with a mild anaemia and spinocerebellar ataxia from an early age. The red cells from the obligatory carrier women were affected to a variable extent. Some but not all carriers showed raised protoporphyrin levels and some had ringed sideroblasts in the bone marrow. No female carrier, however, has been reported as being affected by the ataxia and the inheritance is described as X-linked recessive. Using linkage analysis, the condition was mapped to Xq13 (Raskind et al, 1991), a region distinct from that associated with pyridoxine-responsive XLSA.

The human ABC7 gene maps to Xq13 and encodes a ‘half-type’ ATP Binding Cassette (ABC) transporter, containing a single transmembrane domain consisting of several putative transmembrane regions and a single ATP binding domain. It is located in the inner mitochondrial membrane (Savary et al, 1997; Csere et al, 1998; Shimada et al, 1998) as a homodimer or as a heterodimer with another ‘half-type’ transporter. The yeast protein Atm1p, essential for iron homeostasis, shares 48·9% residue similarity with ABC7 (Kispal et al, 1997; Csere et al, 1998; Shimada et al, 1998) and ATM1 gene inactivation causes yeast cells to show changes reminiscent of changes that occur in erythroblasts in sideroblastic anaemia. They have a 30-fold increase in mitochondrial iron, are deficient in the holoforms but not the apoforms of haem-containing proteins, have increased glutathione, and show poor growth on certain substrates (Leighton & Schatz, 1995; Kispal et al, 1997). That this phenotype can be reversed by addition of a plasmid-born copy of ABC7 (Kispal et al, 1997; Allikmets et al, 1999) demonstrates the functional equivalence of these proteins.

Thus, ABC7 became an additional candidate gene in the study of SA and, in particular, XLSA/A. Allikmets et al (1999) reported the finding of a missense mutation in the fifth putative transmembrane region of the protein and recently, Bekri et al (2000) reported the finding of a separate mutation C-terminal to the sixth putative transmembrane region. We wish to report the finding of a third missense mutation, which lies between the two already reported, in an unrelated family with four male members affected by XLSA/A (Hellier et al, 2001). These findings confirm the involvement of this gene in this syndrome, and demonstrate a key role for this part of the protein in erythroblast iron metabolism.

Patients and methods

  1. Top of page
  2. Abstract
  3. Patients and methods
  4. Results
  5. Discussion
  6. Acknowledgments
  7. References

Patients The family studied was of North European ancestry and contained four male members affected by cerebellar ataxia, spanning two generations. The clinical and neurological details have been published recently (Hellier et al, 2001). All four were found to have microcytic red cells with decreased mean cell haemoglobin (MCH) values, despite the presence of normal iron stores. Three of those affected are still alive. A bone marrow examination on the youngest showed ‘several abnormal sideroblasts including imperfect ring forms’. Coincidental inheritance of a mutation in the erythroid-specific 5′ aminolevulinic acid synthase gene (ALAS2) and an ataxia gene was ruled out by carrying out sequence analysis of DNA from one of the affected brothers essentially as described previously (Cotter et al, 1999). Further investigations concentrated initially on the two youngest men and their mother. Serum ferritin was measured using an enzyme-linked immunoabsorbent assay (ELISA) (Worwood et al, 1991) and red cell protoporphyrin using the fluorescence method of Piomelli (1973). Blood films were prepared and stained with Jenner Giemsa for routine examination and Perl's stain for iron. Red cell parameters were obtained using the Bayer Technicon (Tarytown, NY, USA) Advia automatic cell analyser.

Controls Normal control DNA was prepared from routine blood samples obtained in a manner approved by the local research ethics committee from healthy women attending the antenatal clinic. In addition, two control samples were studied from patients seeking diagnosis whose anaemia was shown to have a different cause.

Extraction of RNA and DNA DNA was prepared from EDTA blood using the salt extraction method of Miller et al (1988). Total cell RNA was extracted from the white cell pellet obtained by centrifugation (5000 g) at 4°C after ammonium chloride/ammonium bicarbonate lysis of the red cells using RNAzol B as per the manufacturer's instructions (Biogenesis, Poole, Dorset, UK).

Characterization of the ABC7 gene The genomic sequence was found by carrying out a BLAST sequence similarity search (National Centre for Biotechnology Information, Bethesda, MD, USA) of human DNA sequences in the Genbank databases, using the published ABC7 cDNA sequence (Genbank accession number AB005289).

Protein structure analysis Structural analysis of the ABC7 protein (Chou & Fasman, 1978, Garnier et al, 1978; Kyte & Doolittle, 1982) was performed using the Protean part of Lasergene (DNA Star Incorporated, Madison, Wisconsin, USA).

Sequence analysis Polymerase chain reaction (PCR) amplification was carried out for 35–43 cycles in a 25 µl volume using Perkin Elmer PCR buffer, 1·5 mmol/l MgCl2, 100 µmol/l each dNTP and 1·0 U of Ampitaq Gold (PE Applied Biosystems, Foster City, CA, USA). PCR product clean-up and removal of dNTPs prior to sequencing was performed using the High Pure PCR Product Purification Kit (Roche Molecular Biochemicals, Lewes, UK). Reverse transcription PCR (RT-PCR) was performed on total cell RNA, using the RT-PCR kit (PE Applied Biosystems). Reverse transcription was carried out in 20 µl volumes using PE PCR buffer, 5 mmol/l MgCl2, 1 mmol/l each dNTP, 1 U/µl RNase inhibitor, 2·5 U/µl MuLV reverse transcriptase, 2·5 µmol/l random hexamer RNA primers and up to 1 µg of RNA. PCR reactions were subsequently performed in a 25-µl volume using final concentrations of 2 mmol/l MgCl2, 1·0 U of Amplitaq Gold and a 5-µl volume of cDNA generated in the RT step. Direct sequencing of PCR products was carried out using ABI Prism Big Dye Terminator Cycle Sequencing Ready Reaction kit (PE Applied Biosystems) according to the manufacturers instructions, and analysed by electrophoresis and fluorescence detection on an ABI Prism 377 DNA sequencer. Unless stated otherwise, the primers used in sequencing were the same as those used for the amplification and each product was sequenced in both directions.

Confirmation of the mutation; screening normal alleles for the mutation Restriction digestion of PCR product 5 to confirm the presence of the G1299C mutation was carried out overnight at 45°C with MaeI and buffer (Roche Molecular Biochemicals, Lewes, UK). Fragment visualization was achieved using ethidium bromide staining after electrophoresis on 3% Nusieve agarose (Flowgen, Ashby de la Zouch, UK).

Results

  1. Top of page
  2. Abstract
  3. Patients and methods
  4. Results
  5. Discussion
  6. Acknowledgments
  7. References

Haematology

Figure 1 shows scattergrams generated from red cell parameter measurements obtained on the three family members studied and Table I contains the results of various haematological and biochemical blood tests. The identification numbers used for the various members of this family are those given in the extended pedigree of Hellier et al (2001). Microcytic, hypochromic cells were clearly present in all three members of the family despite normal iron levels in two (II 5 and III 3). Borderline/low ferritin levels in III 2 suggested impending iron deficiency; however, the blood picture was essentially unchanged when iron stores were normal (Hellier et al, 2001). A slight excess of abnormal cells in the mother can be seen most clearly in the red cell scattergram and is reflected in the very slight increase in red cell distribution (RDW) (14·1%). In both brothers, total erythrocyte protoporphyrin (TEP) levels were high and further analysis revealed that most of this (> 90%) was in the zinc form (data not shown). Blood films of all three family members showed considerable variation in size and shape with microcytosis and hypochromia evident. Pappenheimer bodies were seen in both affected brothers and were present in the mother albeit in fewer numbers of red cells (data not shown).

image

Figure 1.  Red cell scattergrams (y axis MCV, x-axis haemoglobin content) and histograms for the members of the family studied. Please refer to text and to Hellier et al (2001) for the pedigree number assignments.

Download figure to PowerPoint

Table I.   Haematological findings for the family investigated compared with those of two other families described with mutations in the ABC7 gene and XLSA/A.
 This study and Hellier et al (2001)*Pagon et al (1985)Bekri et al (2000)
NRII5III3III2NRIII2III1IV5NRI1II1II2
  • * Previously reported in Hellier et al (2001).

  • Splenectomised for unrelated causes.

  • 5

  • ·

    5 years.

  • §

    mol/mol haem.

  • µg/gHb.

  • HCT, haematocrit; MCV, mean cell volume; MCH, mean cell haemoglobin; RDW, red cell distribution width; NR, normal range; TEP, total erythrocyte protoporphyrin; SI, serum iron; TIBC, total iron binding capacity. Please refer to text and original papers for the pedigree number assignments.

Hb (g/dl)M13–16 F11–1513151214–18 13–1711108
HCT (%) 34–50403530
MCV (fl)84–9994798590676880–100816259
MCH (pg)27–3430242627–32271917
RDW (%)< 14142018
TEP (µmol/l RBC)0·4–1·71·4*4·9*3·1*8–18§27§184§170·4–1·72620
     1–5       
SI (µmol/l) 19*30*20*10–2812·718·41310–40977
TIBC (µmol/l)  67*39*53·6–62·558·856·146·845–77754541
Transferrin (percentage saturation) 30*44·8*51* 223328 121617
Ferritin (µg/l)15–200 15–300542041420–160401601715–300105277622

Characterization of the ABC7 gene

A BLAST search of the high throughput genomic sequences database (htgs) in Genbank, revealed a genomic sequence (accession number AC002417), which matched all but the most 5′ 520nt of the published cDNA HuABC7 sequence (accession number AB005289). The 1896nt of matching cDNA were mapped to 12 exons of varying size (Fig 2A).

image

Figure 2.  Exon structure (A) and arrangement of PCR amplification (B) of the human ABC7 gene.

Download figure to PowerPoint

Analysis of the ABC7 gene sequence

The 12 identifiable exons within AC002417 were amplified in 11 PCR reactions. Primers were designed to encompass 5′ and 3′ splice recognition sites of each exon and be unique to other human sequences entered into Genbank. The remaining 520nt of coding sequence were amplified in two overlapping RT PCR reactions (Fig 2B). Primer sequences and conditions of amplification for the 11 genomic PCRs and the two RTPCRs are listed in Table II. RTPCR1 was a nested reaction using an internal 3′ primer.

Table II.   PCR primers and conditions of amplification of genomic and cDNA ABC7 sequences.
PCR5′ Primer3′ PrimerbpµM°C
  1. bp, product size in bases; µM, individual primer concentration; °C, annealing temperature.

1GTGTATAATGGGTAATTGATGTTAAACCTCCTTGAAGAAAGTCAAC2221·560
2CTATACTCCTTTGATTCTAATAATATTCAATTGCTACTAATGAG3911·554
3GTTTGGGAAGAACAATAACTGTAGATCAAATCTTAGTGCA3791·556
4AAGTCTGATGAAAAGTATACGCCTGTAAATGTGATAGCCA2890·854
5CTATAAACCTATCGTAAATTGGATAATAGGATGATGTTCACATACTT2831·559
6GCTGTACTCTAGGCAGTGCGTAAATCATCAGCCTATAATACAGAAT2621·560
7TAATAGGAGCTAAATAACCTTTCTTGATCAACCCAATAAATCCTCC142360
8TAATAATGAACATAAATAGAGAGGCTCTGACAAATTAGAGTTTG3061·552
9TAATCAATGGAAACACTAAAAACTTACTGAAACTTCCAAGTAGAA2421·558
10TTTACACATTTGCCTAATGTGTACTAAGCTTCTTGTATCTATAACA241354
11TCAGTTATTATGCTAGTTAAATCTTATCTAAAAGAAGGATTATA391252
RTPCR
1TGAGGCAAGATCTACGCTCAAGAGAACTGTCCTGAATTGCCTTT2541·556
Nested 1 GCCTTTTCCCAATCTCTGCCAT2041·556
2TACCAGATTCCAGAGTCATTAATTTCCCGACATCTGGTTGAGGCTGTCTACA3581·557
G1299CTAATGGTGCTCGCCAGTCAGGGAAACAGTTCCCAGAAAGTTCAGGGGT1151·560

DNA sequence analysis of ABC7 was performed on genomic DNA from the two affected brothers, their mother and two control subjects. All PCR and RTPCR products were sequenced in at least one direction and those from one of the two affected brothers were sequenced in both orientations. Sequence data was compared with both the published cDNA sequence (accession number AB005289) and the htgs sequence entry (accession number AC002417).

Identification of a novel family specific mutation

A family specific missense mutation, G1299C in the cDNA, predicting an amino acid residue change from valine to leucine (V411L), was found. The mutation was present in DNA from both brothers and in one of their mother's two alleles. It was not present in the published cDNA and genomic sequences or in the two normal alleles from the control subjects (Fig 3A).

image

Figure 3.  Demonstration and confirmation of the G1299C mutation. (A) Reverse sequence data, the G1299C (C[RIGHTWARDS ARROW]G in reverse) mutation is indicated by the arrow. (B) Restriction profile of PCR5 product with and without the G1299C mutation. (C) Agarose gel electrophoresis of digested PCR products. Please refer to text and to Hellier et al (2000) for pedigree number assignments. NC, normal control.

Download figure to PowerPoint

Although the valine to leucine change is a conservative one, leucine has a somewhat larger side chain and a greater tendency to form an alpha helix. The Garnier–Robson analysis of the structure of the predicted variant ABC7 (Garnier et al, 1978), for example, shows a slight increase in a short alpha helical region on the C-terminal side of the substituted amino acid (data not shown).

The mutation predicts a loss of a MaeI restriction enzyme cutting site (GATCTAGAAT [RIGHTWARDS ARROW] GATCTACTAA) in PCR product 5 (Fig 3B). Figure 3C shows confirmation of this mutation in DNA from the three members of the family studied extensively here. In addition the mutation was confirmed to be present in another affected member of the family (II 2). The mutation was not found in any of the 200 alleles from 100 normal female controls.

The abnormal allele is expressed at the RNA level

Direct sequence analysis of an RT-PCR product from peripheral blood extracted RNA using primers flanking the mutation (Table II) confirmed that this abnormal allele was expressed in ample amounts. Furthermore, both alleles were expressed in the mother (data not shown).

Additional sequence changes noted

Two further base changes from the published cDNA sequence (G1011A, and A1104T) were found; however, their presence in the control DNA and the genomic DNA sequence entry (AC002417) excluded them as causative of XLSA/A. These changes translate to amino acid changes G315R and I346F respectively. These occur within a region of high conservation and predict identity to both mouse and yeast homologues. An additional nucleotide change (G to C), 10nt into intron 10, was also present in controls and thus is unconnected to XLSA/A.

Discussion

  1. Top of page
  2. Abstract
  3. Patients and methods
  4. Results
  5. Discussion
  6. Acknowledgments
  7. References

The genomic sequence and structure of ABC7 was determined in members of a family with the biochemical and haematological features of sideroblastic anaemia and the clinical symptoms of spinocerebellar ataxia. While this manuscript was in preparation, a second mutation in ABC7 was reported (Bekri et al, 2000). When we performed RT-PCR on the first 520nt of the gene, Bekri et al (2000) characterized this portion of the gene and mapped its coding sequence to four exons, predicting 16 exons altogether. In our family we demonstrated a third mutation (cDNA: G1299C predicting V411L) in exon 9 of the ABC7 transporter gene, further strengthening the link between ABC7 and XLSA/A.

A change from valine to leucine is rather conservative and the predicted effect on protein structure slight. However, that this is the only mutation found in all affected family members tested and that it is absent in over 200 normal alleles strongly support its importance in XLSA/A in this family. Furthermore, the predicted amino acid substitutions arising from previously reported mutations I400M (Allikmets et al, 1999) and E433K (Bekri et al, 2000) and that reported here at residue 411 highlight the importance of this region of the protein in iron homeostasis and ataxia.

The precise transport function of ABC7 is not certain, but growing evidence suggests a role in the transport out of mitochondria of iron–sulphur clusters destined for the cytosol (Kispal et al, 1999; Bekri et al, 2000; Lill & Kispal, 2000). The reported mutations in ABC7 are missense causing amino acid substitutions that lie towards the C-terminal end of the transmembrane domain responsible for binding and transport of the substrate. It seems probable that these are the functions with which they interfere rather than ATP binding or hydrolysis.

Some significance may be sought from the severity of the disease. The haematological and biochemical values of the patients of this study are compared with those of the subjects of the two previous reports in Table I. In the patients described anaemia was absent or mild, the decrease in mean cell volume (MCV) was slight and red cell protoporphyrin levels were only slightly increased. In the family most recently published (Bekri et al, 2000), the amino acid change is much less conservative and is of a basic lysine residue for the acidic glutamate. The MCV and haemoglobin were markedly reduced and erythrocyte protoporphyrin greatly elevated. In the first reported family with this disorder (Pagon et al, 1985; Allikmets et al, 1999), the amino acid substitution is more conservative and the red cell changes more moderate, albeit more pronounced than those of the patients studied here. A difference in severity of ataxia between the families is, however, not obvious (Table III) and our findings confirm the conclusion of Allikmets et al (1999) that only a slight structural change to this part of the protein is required for this clinical effect. For the time being, therefore, mutations in ABC7 should be considered in any unexplained X-linked ataxias, even in the absence of haematological changes.

Table III.   A comparison of the neurological assessments of families described with mutations in the human ABC7 gene and XLSA/A.
 Age of onset (years)Age of walking (years)Intention tremor/ dysmetria Dysarthria Nystagmus StrabismusDeep tendon reflexesPlantar responses
Bekri et al (2000)< 16No data++No data[DOWNWARDS ARROW][DOWNWARDS ARROW]
Pagon et al (1985)0·59/1++ –1/53/5[UPWARDS ARROW][UPWARDS ARROW]/[DOWNWARDS ARROW]
This study< 211/3/5++++[UPWARDS ARROW][DOWNWARDS ARROW]

Attempting to explain the erythroid phenotype highlights a paucity of direct information about key regulatory phenomena, so we can only speculate. The presence of raised total erythrocyte protophorphyrin in affected individuals, despite increased iron within the mitochondrion, points to defective incorporation of ferrous iron into protoporphyrin IX by ferrochelatase, the final step of the haem synthesis pathway. Increased levels of zinc protoporphyrin in the red cells of our patients, however, demonstrate that ferrochelatase is active. This poses the question of why disruption in the export of Fe–S clusters or their precursors should prevent incorporation of iron into haem. Ferrochelatase accepts ferrous but not ferric iron as a substrate and Lange et al (1999) showed that reduced iron for haem synthesis, in yeast, is generated and delivered to ferrochelatase as required and is not preformed. A physical link between the import of ferrous iron and the export of Fe–S would be an attractive explanation for the deleterious effect on the former of deficiency in the latter.

A reduction in cytosolic iron sulphur clusters mimics a low iron state in the cytosol by converting the cytoplasmic enzyme aconitase to the iron regulatory protein IRP1 (Haile et al, 1992). In the erythroblast this should lead to a decreased synthesis of ferritin (Hentze et al, 1987), increased production of transferrin receptors (Müllner et al, 1989) and continued uptake of available iron. Whether or not this is sufficient to produce the ring sideroblasts remains to be seen; however, ALAS2 mRNA carries a 5′ iron responsive element functional in erythroleukaemia cell lines (Cox et al, 1991; Dandekar et al, 1991) and its translation may therefore be decreased as a result of negative regulation by IRP1. Alternatively, ALAS1 activity could be enhanced by haem feedback regulation sufficient to contribute in these patients to the raised protoporphyrin in the reticulocytes and red cells. The earlier stages of erythroid differentiation, however, are more dependent on high levels of ALAS2 activity which are unlikely to be replaced by ALAS1 for their haem supply. ALAS activity rather than the ferrochelatase step may therefore be limiting at these earlier stages of differentiation and its decreased activity able to contribute to the decrease in overall haem production, mitochondrial iron loading and the anaemia.

Acknowledgments

  1. Top of page
  2. Abstract
  3. Patients and methods
  4. Results
  5. Discussion
  6. Acknowledgments
  7. References

Thanks to the Leukaemia Research Appeal for Wales for financial support. We thank Professor D. F. Bishop for drawing to our attention the cloning of hABC7 and its candidature for XLSA/A and Dr E. Hatchwell for alerting us to the existence of the genomic sequence in the htgs database. Thanks also to Joyce Hoy and Barrie Francis for technical help with the AB1 377 electrophoresis and to Professor Mark Worwood, Jackie Woolf and Professor George Elder for valuable and helpful discussion.

References

  1. Top of page
  2. Abstract
  3. Patients and methods
  4. Results
  5. Discussion
  6. Acknowledgments
  7. References
  • Allikmets, R., Raskind, W.H., Hutchinson, A., Schueck, N.D., Dean, M., Koeller, D.M. (1999) Mutation of a putative mitochondrial iron transporter gene (ABC7) in X-linked sideroblastic anemia and ataxia (XLSA/A). Human Molecular Genetics, 8, 743749.DOI: 10.1093/hmg/8.5.743
  • Bekri, S., Kispal, G., Lange, H., Fitzsimons, E., Tolmie, J., Lill, R., Bishop, D.F. (2000) Human ABC7 transporter gene structure and mutation causing X-linked sideroblastic anemia with ataxia with disruption of cytosolic iron-sulfur protein maturation. Blood, 96, 32563264.
  • Borgna-Pignatti, C., Marradi, P., Pinelli, L., Monetti, N., Patrini, C. (1989) Thiamine-responsive anemia in DIDMOAD syndrome. Journal of Pediatrics, 114, 405410.
  • Bottomley, S.S. (1998) Sideroblastic anemias. In: Wintrobe's Clinical Haematology (ed. by G.R.Lee, J.Foerster, J.Lukens, et al), pp. 10221045. Williams & Wilkins, Baltimore, MD.
  • Chou, P.Y. & Fasman, G.D. (1978) Prediction of the secondary structure of proteins from their amino acid sequence. Advances in Enzymology, 47, 45148.
  • Cotter, P.D., May, A., Li, L., Al-Sabah, A.I., Fitzsimons, E., Cazzola, M., Bishop, D.F. (1999) Four new mutations in the erythroid-specific 5-aminolevulinate synthase (ALAS2) gene causing X-linked sideroblastic anaemia: increased pyridoxine responsiveness after removal of iron overload by phlebotomy and coinheritance of hereditary hemochromatosis. Blood, 93, 17571769.
  • Cox, T.C., Bawden, M.J., Martin, A., May, B.K. (1991) Human erythroid 5-aminolevulinate synthase. promoter analysis and identification of an iron-responsive element in the mRNA. EMBO Journal, 10, 18911902.
  • Csere, P., Lill, R., Kispal, G. (1998) Identification of a human mitochondrial ABC transporter, the functional orthologue of yeast Atm1p. FEBS Letters, 441, 266270.
  • Dandekar, T., Stripecke, R., Gray, N.K., Goossen, B., Constable, A., Johansson, H.E., Hentze, M.W. (1991) Identification of a novel iron-responsive element in murine and human erythroid δ-aminolevulinic acid synthase mRNA. EMBO Journal, 10, 19031909.
  • Garnier, J., Osguthorpe, D.J., Robson, B. (1978) Analysis of the accuracy and implications of simple method for predicting the secondary structure of globular proteins. Journal of Molecular Biology, 120, 97120.
  • Gatterman, N. (1999) From sideroblastic anemia to the role of mitochondrial DNA mutations in myelodysplastic syndromes. Leukemia Research, 24, 141151.DOI: 10.1016/s0145-2126(99)00160-5
  • Gatterman, N., Retzlaff, S., Wang, Y.-L., Berneburg, M., Heinisch, J., Wlaschek, M., Aul, C., Schneider, W. (1996) A heteroplasmic point mutation of mitochondrial tRNALeu (CUN) in non-lymphoid cell lineages from a patient with acquired sideroblastic anaemia. British Journal of Haematology, 93, 845855.
  • Haile, D.J., Rouault, T.A., Tang, C.K., Chin, J., Harford, J.B., Klausner, R.D. (1992) Reciprocal control of RNA-binding and aconitase activity in the regulation of the iron-responsive element binding protein: role of the iron-sulfur cluster. Proceedings of the National Academy of Sciences of the United States of America, 89, 75367540.
  • Hellier, K.D., Hatchwell, E., Duncombe, A.S., Kew, J., Hammans, S.R. (2001) X-linked sideroblastic anaemia with ataxia: another mitochondrial disease? Journal of Neurology, Neurosurgery and Psychiatry, 70, 6569.
  • Hentze, M.W., Rouault, T.A., Caughman, S.W., Dancis, A., Harford, J.B., Klausner, R.D. (1987) A. cis-acting element is necessary and sufficient for translational regulation of human ferritin expression in response to iron. Proceedings of the National Academy of Sciences of the United States of America, 84, 67306734.
  • Inoue, H., Tanizawa, Y., Wasson, J., Behn, P., Kalidas, K., Bernal-Mizrachi, E., Meuckler, M., Marshall, H., Donis-Keller, H., Crock, P., Rogers, D., Mikuni, M., Kumashiro, H., Higashi, K., Sobue, G., Oka, Y., Permutt, M.A. (1998) A. gene encoding a transmembrane protein is mutated in patients with diabetes mellitus and optic atrophy (Wolfram syndrome). Nature Genetics, 20, 143148.DOI: 10.1038/2441
  • Kispal, G., Csere, P., Guiard, B., Lill, R. (1997) The ABC transporter atm1p is required for mitochondrial iron homeostasis. FEBS Letters, 418, 346350.DOI: 10.1016/s0014-5793(97)01414-2
  • Kispal, G., Csere, P., Prohl, C., Lill, R. (1999) The mitochondrial proteins Atm1p and Nfs1p are essential for biogenesis of cytosolic Fe/S proteins. EMBO Journal, 18, 39813989.
  • Kyte, J. & Doolittle, R.F. (1982) A. simple method for displaying the hydropathic character of a protein. Journal of Molecular Biology, 157, 105132.
  • Labay, V., Raz, T., Baron, D., Mandel, H., Williams, H., Barrett, T., Szargel, R., McDonald, L., Shalata, A., Nosaka, K., Gregory, S., Cohen, N. (1999) Mutations in SCL19A2 cause thiamine-responsive megaloblastic anaemia associated with diabetes mellitus and deafness. Nature Genetics, 22, 300304.
  • Lange, H., Kispal, G., Lill, R. (1999) Mechanism of iron transport to the site of heme synthesis inside yeast mitochondria. Journal of Biological Chemistry, 274, 1898918996.
  • Leighton, J. & Schatz, G. (1995) An ABC transporter in the mitochondrial inner membrane is required for normal growth of yeast. EMBO Journal, 14, 188195.
  • Lill, R. & Kispal, G. (2000) Maturation of cellular Fe-S proteins: an essential function of mitochondria. Trends in Biochemical Sciences, 25, 352356.
  • May, A. & Fitzsimons, E.J. (1994) Sideroblastic anaemia. In: Balliere's Clinical Haematology, 7, no. 4: Clinical Disorders of Iron Metabolism (ed. by C.Hershko), pp. 851879. Ballière Tindall, London.
  • Miller, S.A., Dykes, D.D., Polesky, H.F. (1988) A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Research, 16, 12151215.
  • Müllner, E.W., Neupert, B., Kühn, L.C. (1989) A specific mRNA binding factor regulates the iron-dependent stability of cytoplasmic transferrin receptor mRNA. Cell, 58, 373382.
  • Pagon, R.A., Bird, T.D., Detter, J.C., Pierce, I. (1985) Hereditary sideroblastic anemia and ataxia – an X-linked recessive disorder. Journal of Medical Genetics, 22, 267273.
  • Pearson, H.A., Lobel, J.S., Kocoshis, S.A., Naiman, J.L., Windmiller, J., Lammi, A.T., Hoffman, R., Marsh, J.C. (1979) A new syndrome of refractory anaemia with vacuolisation of marrow precursors and exocrine pancreatic dysfunction. Journal of Pediatrics, 95, 976984.
  • Piomelli, S. (1973) A micromethod for free erythrocyte porphyrins: the FEP test. Journal of Laboratory and Clinical Medicine, 81, 932940.
  • Raskind, W.H., Wijsman, E., Pagon, R.A., Cox, T.C., Bawden, M.J., May, B.K., Bird, T.D. (1991) X-linked sideroblastic anemia and ataxia – linkage to phosphoglycerate kinase at Xq13. American Journal of Human Genetics, 48, 335341.
  • Savary, S., Allikmets, R., Denizot, F., Luciani, M.F., Mattei, M.G., Dean, M., Chimini, G. (1997) Isolation and chromosomal mapping of a novel ATP-binding cassette transporter conserved in mouse and human. Genomics, 41, 275278.
  • Shimada, Y., Okuno, S., Kawai, A., Shinomiya, H., Saito, A., Suzuki, M., Omori, Y., Nishino, N., Kanemoto, N., Fujiwara, T., Horie, M., Takahashi, E. (1998) Cloning and chromosomal mapping of a novel ABC transporter gene (hABC7), a candidate for X-linked sideroblastic anemia with spinocerebellar ataxia. Journal of Human Genetics, 43, 115122.DOI: 10.1007/s100380050051
  • Strom, T.M., Hortnagel, K., Hofmann, S., Gekeler, F., Scharfe, C., Rabl, W., Gerbitz, K.D., Meitinger, T. (1998) Diabetes insipidus, diabetes mellitus, optic atrophy and deafness (DIDMOAD) caused by mutations in a novel gene (wolframin) coding for a predicted transmembrane protein. Human Molecular Genetics, 7, 20212028.DOI: 10.1093/hmg/7.13.2021
  • Worwood, M., Thorpe, S.J., Heath, A., Flowers, C.H., Cook, J.D. (1991) Stable lyophilized reagents for the serum ferritin assay. Clinical Laboratory Haematology, 13, 297305.