SEARCH

SEARCH BY CITATION

Keywords:

  • ferritin;
  • ferroportin;
  • iron;
  • iron overload;
  • reticuloendothelial cell

Abstract

  1. Top of page
  2. Abstract
  3. Patients and methods
  4. Results
  5. Hyperferritinaemia transmitted as an autosomal dominant trait in the family and clinical evidence for selective reticuloendothelial iron overload in the proband
  6. Mutation analysis of L and H ferritin genes
  7. Ferroportin gene (SLC11A3) mutation analysis
  8. Ferroportin gene (SLC11A3) polymorphisms
  9. DHPLC scanning for the three base pair deletion in exon 5 of ferroportin gene (SLC11A3)
  10. Relationship between serum ferritin levels and age in patients heterozygous for the ferroportin Val 162 deletion
  11. Discussion
  12. Acknowledgments
  13. References

Summary. Iron overload may predominantly involve parenchymal or reticuloendothelial cells, the prototype of parenchymal iron overload being HFE-related genetic haemochromatosis. We studied a family with autosomal dominant hyperferritinaemia in whom the proband showed selective iron accumulation in the Kupffer cells on liver biopsy. Analysis of L and H ferritin genes excluded mutations responsible for hereditary hyperferritinaemia/cataract syndrome or similar translational disorders. Sequence analysis of the ferroportin gene (SLC11A3) in four individuals with hyperferritinaemia singled out a three base pair deletion in a region that contains four TTG repeats. This mutation removes a TTG unit from 780 to 791, and predicts the loss of one of three sequential valine residues 160–162. Denaturing high performance liquid chromatography can be used for its detection. SLC11A3 polymorphism analysis indicates that this probably represents a recurrent mutation due to slippage mispairing. Affected individuals may show marginally low serum iron and transferrin saturation, and young women may have marginally low haemoglobin concentration levels. Serum ferritin levels are directly related to age, but are 10–20 times higher than normal. Heterozygosity for the ferroportin Val 162 deletion represents the prototype of selective reticuloendothelial iron overload, and should be taken into account in the differential diagnosis of hereditary or congenital hyperferritinaemias.

Hepatocytes and reticuloendothelial cells are the two major areas of iron storage, and the dynamics of iron uptake and release in these two cells are quite different (Finch & Huebers, 1982). Hepatocytes take up iron from plasma transferrin in amounts that vary according to transferrin saturation, reflecting the greater iron donating capacity of diferric compared with monoferric transferrin (Huebers & Finch, 1984). The reticuloendothelial cell does not take up iron from transferrin, but rather receives it from the processing of senescent red cells. After the senescent red cells are phagocytized, haem oxygenase 1 catabolizes haem, releasing iron to a Fe-ATPase transporter that is responsible for intracellular transmembrane iron transport (Baranano et al, 2000). The processed iron is rapidly released to plasma transferrin or is stored in ferritin molecules. Although the exact mechanism of iron release by the macrophage is not fully understood, recent evidence indicates that ferroportin (originally defined as ferroportin 1 and encoded by the SLC11A3 gene) plays a crucial role as an iron exporter (Donovan et al, 2000).

Iron overload may be classified as predominantly parenchymal or reticuloendothelial according to the predominant tissue site of iron deposition (Finch & Huebers, 1982). A typical selective reticuloendothelial iron overload can be found in inflammatory states, and is associated with a low to normal transferrin saturation and a progressive increase in serum ferritin and marrow haemosiderin with time. Inflammatory states, in fact, are characterized by an excessive production of pro-inflammatory cytokines that transcriptionally induce the H chain of ferritin (Torti & Torti, 2002). In turn, the increased ferritin production may produce a marked perturbation in favour of storage, in time leading to increased amounts of iron in the reticuloendothelial cell.

The existence of cases of reticuloendothelial iron overload without inflammation was recognized by Finch more than 20 years ago, when he wrote: ‘Until the mechanism of iron exchange between macrophage and transferrin is better understood, the nature of the abnormality [macrophage iron overload] in apparently healthy people will remain speculative’ (Finch & Huebers, 1982). We describe a family with a dominant hyperferritinaemia and selective reticuloendothelial iron overload associated with a three base pair deletion in the ferroportin gene, and discuss similar families that have been recently reported.

A family with autosomal dominant hyperferritinaemia.  The proband was a young woman living in North-Eastern Greece who was found to have elevated serum ferritin (1396 µg/l) on a routine blood examination. Liver function tests and acute phase reactants were normal. Haemoglobin was marginally low (12·0 g/dl; reference range 12·0–16·0) with a normal MCV (94 fl; reference range 82–98 fl). Evaluation of body iron status showed marginally low serum iron (8·9 µmol/l; reference range 10·7–26·8 µmol/l) and transferrin saturation (15%; reference range 15–45%). The elevated serum ferritin was confirmed through subsequent determinations and found to fluctuate in a range from 1200 to 1600 µg/l. Analysis of the HFE gene excluded both the C282Y and H63D mutations. Based on recent reports of the so-called hereditary–hyperferritinaemia/cataract syndrome (Cazzola et al, 1997), other available family members were studied. It became thereby apparent that hyperferritinaemia was transmitted as an autosomal dominant trait in this family (Fig 1), but without any evidence of cataract.

image

Figure 1. Pedigree of the family with hereditary hyperferritinaemia. Circles denote female family members and squares male family members; the arrow indicates the proband and symbols with diagonal lines indicate deceased members. Solid symbols indicate individuals with hyperferritinaemia while open symbols denote subjects with normal serum ferritin levels respectively.

Download figure to PowerPoint

Genetic investigations.  The procedures followed were in accordance with the ethical standards of the institutional committee on human experimentation and with the Helsinki Declaration of 1975, as revised in 1983. Informed consent was obtained for genetic studies. Genomic DNA was isolated from peripheral blood samples according to standard procedures.

Mutational analysis of L and H ferritin genes.  The entire iron responsive element (IRE) sequence of the H- and L-subunit gene was amplified by polymerase chain reaction (PCR) (Cazzola et al, 2002) and denaturing high performance liquid chromatography (DHPLC) (unpublished observations) was used for screening of IRE mutations (Cazzola et al, 2002).

Mutational analysis of the ferroportin gene (SLC11A3).  The genomic structure of the ferroportin 1 gene was kindly provided by Adriana Donovan, Division of Hematology/Oncology, Children's Hospital, Boston, MA, USA.

Each exon of the ferroportin gene was then amplified by PCR from patient and control samples and subjected to sequence analysis. PCR primers for direct sequencing analysis of the promoter region, the 5′ UTR region that contains the IRE, and 8 exons (including flanking intron-exon boundaries) are listed in Table I. PCR conditions were as follows: 0·25 µg DNA; 200 µmol/l dNTP; 10 mmol/l Tris-HCl (pH 8·3), 50 mmol/l KCl; 1·5 mmol/l MgCl2; 0·001% (w/v) gelatin; 1·5 units of AmpliTaq Gold DNA polymerase (Applied Biosystems, Foster City, CA, USA); 15 pmol of each primer, in a total volume of 50 µl. Cycles: 94°C for 45 s, annealing temperature specific for each primer set, as shown in Table I for 45 s, 72°C for 4 s, for a total of 30 cycles. The amplicon of the promoter region was obtained in the presence of 10% dimethyl sulphoxide (DMSO). Samples were analysed by direct sequencing in both directions using the DYEnamic ET Terminator Cycle Sequencing kit (Amersham Pharmacia Biotech, Cologno Monzese, Italy) and ABI PrismTM 377 sequencer (PE Applied Biosystems). The fragment encompassing the putative promoter region and exon 1 was sequenced with the same primers used for PCR and the additional reverse primer 5′-CAACGACGACTTTGGCAAAG-3′. Exon 7 was split into two PCR and sequencing reactions (exon7-I and exon7-II, see Table I).

Table I.  Primers used for mutational analysis of ferroportin gene (SLC11A3).
Primer namePCR primer (5′-3′)Annealing temperature (°C)PCR product (bp)
  • *

    This region includes also the promoter and the 5

  • ′UTR sequences.

Promoter-Forward*GCAAGGTTGACGGGAGCTCG62·5571
Exon 1-ReverseGTAGAGTTGCTTGTCTCCAAAGC  
Exon 2-ForwardAGCTCATTAAGTGACTACCATCGC62·5199
Exon 2 ReverseGGCTTAATACAACTGGCTAGAACG  
Exon 3-ForwardCCTTTTGATAAGGAAGCAACTTCC62·5306
Exon 3-ReverseCAGAGGTAGCTCAGGCATTGGTCC  
Exon 4-ForwardGAGACATTTTGATGTAATGTACAC58·0210
Exon 4-ReverseCTACCAGATATTCAATTTTCTGCC  
Exon 5-ForwardCCACCAAAGACTATTTTAAACTGC62·5283
Exon 5-ReverseTCACCACCGATTTAAAGTGAATCC  
Exon 6-ForwardGATGGGTTTGCACACTTACCTGCC62·5337
Exon 6-ReverseAGGTCTGAACATGAGAACAAAAGG  
Exon 7-I ForwardGGCTTTTATTTCTACATGTCCTCC58·0483
Exon 7-I ReverseGCTTCCAGGCATGAATACAGAG  
Exon 7-II ForwardTGTGGTTTGGTTCGGACAGG58·0404
Exon 7-II ReverseACATTTAGGGAACATTTCAGATCA  
Exon 8-ForwardAAGGTGACTTAAAGACAGTCAGGC62·5593
Exon 8-ReverseGCTGACTTAGGTTTCCTAAACAGC  

In order to develop a simple approach to scanning for SLC11A3 exon 5 mutations, DHPLC was used. The amplicon corresponding to exon 5 of the ferroportin gene was prepared using the primer pairs and conditions described in Table I. This fragment was subjected to DHPLC analysis according to the method developed by Xiao & Oefner (2001) on a Transgenomic WAVE® System equipped with a preheated C18 reversed phase column based on non-porous poly(stirene/divinyl-benzene) particles (DNASepTM; Transgenomic, Crewe, UK). At the end of the PCR run, heteroduplexes were generated by denaturation at 95°C for 5 min followed by gradual reannealing for 60 min at 56°C. An aliquot (5 µl) of the PCR reaction product was injected into the column, and hetero- and homoduplexes were eluted with a linear gradient formed by mixing buffer A (0·1 mol/l triethylammine acetate pH 7·0) and buffer B (triethylammine acetate pH 7·0, containing 250 ml/l acetonitrile) at a constant flow rate of 0·9 ml/min. DNA was detected at 260 nm. The loading step was performed at 49% of B, while the analytical gradient was 4 min long and buffer B was increased from 54% to 62%. The column was then cleaned with 100% buffer B for 30 s and equilibrated at starting conditions for 1 min. The analysis was performed at the recommended operating temperature (RTm) of 56°C as determined by the WavemakerTM software.

Hyperferritinaemia transmitted as an autosomal dominant trait in the family and clinical evidence for selective reticuloendothelial iron overload in the proband

  1. Top of page
  2. Abstract
  3. Patients and methods
  4. Results
  5. Hyperferritinaemia transmitted as an autosomal dominant trait in the family and clinical evidence for selective reticuloendothelial iron overload in the proband
  6. Mutation analysis of L and H ferritin genes
  7. Ferroportin gene (SLC11A3) mutation analysis
  8. Ferroportin gene (SLC11A3) polymorphisms
  9. DHPLC scanning for the three base pair deletion in exon 5 of ferroportin gene (SLC11A3)
  10. Relationship between serum ferritin levels and age in patients heterozygous for the ferroportin Val 162 deletion
  11. Discussion
  12. Acknowledgments
  13. References

As illustrated in the genealogical tree (Fig 1), hyperferritinaemia was transmitted as an autosomal dominant trait in this family. Table II shows the available haematological and iron status data. Two women and a young man had marginally low haemoglobin levels but with normal MCVs. Total iron-binding capacity (TIBC) values were normal, while transferrin saturation was marginally low in a few affected individuals. Apart from these findings, no consistent clinical manifestation was found in individuals with hyperferritinaemia.

Table II.  Main haematological and body iron status parameters in affected individuals from the family studied (see also pedigree in Fig 1).
Subject/age (years) Hb, g/dlMCV, flSerum iron, µmol/lTIBC, µmol/lTransferrin saturation, %Serum ferritin, µg/l
  1. ND, not determined.

Men
II-04, 7014·09214·548·7302352
II-05, 6612·98910·942·9257500
III-04, 5116,79315·761·1262170
III-11, 2914·39412·061·4191230
IV-06, 19NDND 9·262·3261920
Women
II-02, 74NDND 8·249·1173180
III-10, 3112·094 8·961·6151396
III-12, 2611·19813·947·929402
IV-05, 25NDND15·761·1261269
Reference rangeM 13·0–17·082–9810·7–26·842·9–6415–45M 20–250
W 12·0–16·0    W 10–200

A liver biopsy for the proband showed selective accumulation of iron in the Kupffer cells, with no evidence of liver fibrosis (Fig 2).

image

Figure 2. Liver histology (Perls' stain). Liver biopsy from the proband showing iron staining selectively in Kupffer cells (original magnification: 400x).

Download figure to PowerPoint

Mutation analysis of L and H ferritin genes

  1. Top of page
  2. Abstract
  3. Patients and methods
  4. Results
  5. Hyperferritinaemia transmitted as an autosomal dominant trait in the family and clinical evidence for selective reticuloendothelial iron overload in the proband
  6. Mutation analysis of L and H ferritin genes
  7. Ferroportin gene (SLC11A3) mutation analysis
  8. Ferroportin gene (SLC11A3) polymorphisms
  9. DHPLC scanning for the three base pair deletion in exon 5 of ferroportin gene (SLC11A3)
  10. Relationship between serum ferritin levels and age in patients heterozygous for the ferroportin Val 162 deletion
  11. Discussion
  12. Acknowledgments
  13. References

We have previously shown that hereditary hyperferritinaemia may be caused by various point mutations or deletions within the IRE of L-ferritin mRNA that result in constitutive upregulation of L-ferritin translation, and that this genetic condition is characterized by early onset cataract of variable severity (Cazzola et al, 1997, 2002; Cazzola, 2002). In addition, it has been suggested that gain-of-function mutations in the IRE of H-ferritin mRNA may also results in hereditary hyperferritinaemia (Kato et al, 2001).

Although the proband had no evidence of cataract, we used DHPLC to scan the L and H ferritin genes for IRE mutations. This approach has now replaced in our laboratories the double-gradient denaturing gradient gel electrophoresis (DG-DGGE) method previously used (Cremonesi et al, 2001; Cazzola et al, 2002). All elution profiles were normal in all the examined family members (both with and without hyperferritinaemia), indicating the absence of any mutations in these regulatory regions (data not shown).

Ferroportin gene (SLC11A3) mutation analysis

  1. Top of page
  2. Abstract
  3. Patients and methods
  4. Results
  5. Hyperferritinaemia transmitted as an autosomal dominant trait in the family and clinical evidence for selective reticuloendothelial iron overload in the proband
  6. Mutation analysis of L and H ferritin genes
  7. Ferroportin gene (SLC11A3) mutation analysis
  8. Ferroportin gene (SLC11A3) polymorphisms
  9. DHPLC scanning for the three base pair deletion in exon 5 of ferroportin gene (SLC11A3)
  10. Relationship between serum ferritin levels and age in patients heterozygous for the ferroportin Val 162 deletion
  11. Discussion
  12. Acknowledgments
  13. References

Through direct sequencing, an exon 5 three base pair deletion was detected in the proband and other three affected members (Fig 3). This deletion cannot be defined precisely, due to the fact that the wild-type sequence in this region of the gene contains four TTG repeats (Fig 3). Therefore, the deleted unit may be a TTG or, less probably, a TGT or a GTT from nucleotide 780–791 in exon 5. In any case, the three base pair deletion predicts the loss of one of three highly conserved, sequential valine residues 160–162. We chose to define this mutation as Val 162 deletion.

image

Figure 3. Sequence analysis of ferroportin gene (SLC11A3) exon 5 genomic DNA from a normal individual and from the proband after PCR amplification. In the proband, the presence of a three base-pair deletion on one allele produces superimposing peaks in the electropherograms 3′ to the deletion breakpoint following automated sequence analysis. Both wild-type and mutated sequences are shown under the proband's electropherograms to better illustrate the origin of the above superimposing peaks: the deleted TTG unit is reported within parentheses in the wild-type sequence.

Download figure to PowerPoint

Ferroportin gene (SLC11A3) polymorphisms

  1. Top of page
  2. Abstract
  3. Patients and methods
  4. Results
  5. Hyperferritinaemia transmitted as an autosomal dominant trait in the family and clinical evidence for selective reticuloendothelial iron overload in the proband
  6. Mutation analysis of L and H ferritin genes
  7. Ferroportin gene (SLC11A3) mutation analysis
  8. Ferroportin gene (SLC11A3) polymorphisms
  9. DHPLC scanning for the three base pair deletion in exon 5 of ferroportin gene (SLC11A3)
  10. Relationship between serum ferritin levels and age in patients heterozygous for the ferroportin Val 162 deletion
  11. Discussion
  12. Acknowledgments
  13. References

Sequence analysis of the ferroportin gene confirmed the presence in this family of three polymorphisms previously described by Lee et al (2001) and Devalia et al (2002):

  • (a) 7 or 8 CGG trinucleotides in the TATA box of the putative promoter region;

  • (b) G or C in position −24 within the first intron (IVSI-24);

  • (c) a T or C at the third base of codon 221 (T977 or C977), which does not involve any amino acid change (V221).

With respect to these polymorphisms and based on findings from four affected family members, the SLC11A3 haplotype associated the three base pair deletion in exon 5 was determined as 7 CGG, IVSI-24G and 977C in our family.

DHPLC scanning for the three base pair deletion in exon 5 of ferroportin gene (SLC11A3)

  1. Top of page
  2. Abstract
  3. Patients and methods
  4. Results
  5. Hyperferritinaemia transmitted as an autosomal dominant trait in the family and clinical evidence for selective reticuloendothelial iron overload in the proband
  6. Mutation analysis of L and H ferritin genes
  7. Ferroportin gene (SLC11A3) mutation analysis
  8. Ferroportin gene (SLC11A3) polymorphisms
  9. DHPLC scanning for the three base pair deletion in exon 5 of ferroportin gene (SLC11A3)
  10. Relationship between serum ferritin levels and age in patients heterozygous for the ferroportin Val 162 deletion
  11. Discussion
  12. Acknowledgments
  13. References

The DNA region encompassing exon 5 along with intron/exon boundaries of the ferroportin gene was subjected to DHPLC analysis. At 56°C, the temperature that allowed the most efficient mutation detection, the wild-type control sample displayed a single peak due to the fully helical homoduplex DNA. In contrast, all amplimers from the four affected individuals analysed in our family produced typical profiles with an additional peak due to the presence of partially denatured heteroduplex species, probably generated by hairpin loop formation between the longer and the shorter mismatched DNA strands (Fig 4).

image

Figure 4. DHPLC analysis of the ferroportin Val 162 deletion. The retention time (min) is represented on the X-axis, and the ultraviolet absorbance at 260 nm on the Y-axis. Shown are elution profiles for patients carrying the mutation (upper four profiles) and for a wild-type homozygous DNA control sample (lower profile) at 56°C, the temperature that allowed the most efficient mutation detection. Under this condition, the wild-type control sample displayed a single peak due to fully helical homoduplex DNA. In contrast, all amplimers from the affected individuals analysed in our family produced typical profiles with an additional peak. This latter – as schematically indicated in the insert – is likely due to the presence of partially denatured heteroduplex species, probably generated by hairpin loop formation between the longer and the shorter mismatched DNA strands.

Download figure to PowerPoint

Relationship between serum ferritin levels and age in patients heterozygous for the ferroportin Val 162 deletion

  1. Top of page
  2. Abstract
  3. Patients and methods
  4. Results
  5. Hyperferritinaemia transmitted as an autosomal dominant trait in the family and clinical evidence for selective reticuloendothelial iron overload in the proband
  6. Mutation analysis of L and H ferritin genes
  7. Ferroportin gene (SLC11A3) mutation analysis
  8. Ferroportin gene (SLC11A3) polymorphisms
  9. DHPLC scanning for the three base pair deletion in exon 5 of ferroportin gene (SLC11A3)
  10. Relationship between serum ferritin levels and age in patients heterozygous for the ferroportin Val 162 deletion
  11. Discussion
  12. Acknowledgments
  13. References

As serum ferritin increases with age in normal individuals (Lipschitz et al, 1974), we analysed this relationship in patients heterozygous for the ferroportin Val 162 deletion. Figure 5A shows that there was a close relationship between serum ferritin levels and age in the affected members from our family: the older the subject, the higher serum ferritin, although the observed ferritin values were 10–20 times higher than normal. The significance of the above relationship increased (Fig 5B) when regression analysis was extended to include members from other families with selective reticuloendothelial iron overload carrying the same mutation of the ferroportin gene (Devalia et al, 2002; Roetto et al, 2002). In contrast, there was no significant difference between men and women.

image

Figure 5. Relationship between age and serum ferritin in individuals who were heterozygous for the ferroportin Val 162 deletion. (A) Affected individuals from the family herein reported. Regression analysis showed a significant direct relationship between serum ferritin and age (adjusted R = 0·66, F = 7·08, P = 0·0288). (B) Pooled affected individuals from the family herein reported and from the families reported by Devalia et al (2002) and Roetto et al (2002), all with predominantly reticuloendothelial iron overload. Regression analysis showed a significant direct relationship between serum ferritin and age (adjusted R = 0·72, F = 16·13, P = 0·0013), about 52% of variation in serum ferritin being explained by variation in age. In contrast, there was no significant relationship between serum ferritin and sex.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Patients and methods
  4. Results
  5. Hyperferritinaemia transmitted as an autosomal dominant trait in the family and clinical evidence for selective reticuloendothelial iron overload in the proband
  6. Mutation analysis of L and H ferritin genes
  7. Ferroportin gene (SLC11A3) mutation analysis
  8. Ferroportin gene (SLC11A3) polymorphisms
  9. DHPLC scanning for the three base pair deletion in exon 5 of ferroportin gene (SLC11A3)
  10. Relationship between serum ferritin levels and age in patients heterozygous for the ferroportin Val 162 deletion
  11. Discussion
  12. Acknowledgments
  13. References

Other investigators have independently reported mutations in the human ferroportin gene in recent months (Montosi et al, 2001; Njajou et al, 2001; Devalia et al, 2002; Roetto et al, 2002; Wallace et al, 2002), and substantial clinical differences exist between the reported families.

Njajou et al (2001) and Montosi et al (2001) have described families with a condition defined by authors as autosomal dominant genetic haemochromatosis. This type of genetic iron overload has been defined by OMIMTM (Online Mendelian Inheritance in Man) as haemochromatosis type 4, or HFE4 (OMIM 606069). Hyperferritinaemia was found in nearly all affected members, whereas only a portion of them showed evidence of increased transferrin saturation and/or parenchymal iron overload. Several individuals showed accumulation of iron in the Kupffer cells, and a few had also evidence of parenchymal iron overload. Two distinct missense mutations were found in the ferroportin gene from affected members belonging to the Dutch (N144H in exon 5; Njajou et al, 2001) and Italian families (A77D in exon 3; Montosi et al, 2001). It is currently unclear whether these mutations involve loss or gain of function (Fleming & Sly, 2001). Haploinsufficiency for ferroportin would decrease iron absorption and impair iron release from reticuloendothelial cells. As commented by Fleming & Sly (2001), this could explain the low serum iron and transferrin saturations, the anaemia early in life found by the Italian investigators, and the sensitivity to phlebotomy observed in some of the reported patients. However, haploinsufficiency for ferroportin does not explain why some patients developed true parenchymal iron overload.

More recently, Devalia et al (2002) and Roetto et al (2002) have reported patients with selective reticuloendothelial iron overload transmitted as an autosomal dominant trait. Affected individuals showed isolated hyperferritinaemia and were found to have the three base pair deletion in exon 5 of the ferroportin gene that was also found in our family. Wallace et al (2002) have reported a family with the same ferroportin mutation in which the oldest patients showed both reticuloendothelial and parenchymal iron overload on liver biopsy and increased transferrin saturation. This family was therefore more similar to those described by Njajou et al (2001) and Montosi et al (2001). Despite this discrepancy, findings of this study and those of studies by Devalia et al (2002) and Roetto et al (2002) indicate that heterozygosity for Val 162 deletion is probably associated with a predominantly reticuloendothelial iron overload. In fact, these patients showed selective iron accumulation in the Kupffer cells on liver biopsy, and their TIBC values were normal, indicating normal hepatocyte iron content and normal transferrin production (Huebers & Finch, 1984). The marginally low serum iron and transferrin saturation levels were consistent with a partly defective iron release by macrophages.

The Val 162 deletion in ferroportin gene appears therefore to represent a loss-of-function mutation that mainly impairs reticuloendothelial iron metabolism, although it has no major impact on intestinal iron absorption in heterozygous individuals. The alteration in reticuloendothelial iron metabolism is the opposite of that found in HFE-related genetic haemochromatosis, a condition characterized by increased macrophage iron release (Fillet et al, 1989). Protein topology modelling predicts 9–10 transmembrane region for ferroportin protein (Devalia et al, 2002). The deleted Val 162 is located on a loop exposed to extracellular space, near Asn144, which mutated into His in the Dutch family (Njajou et al, 2001). Also, the mutation, originally found in zebrafish, is located in the same region: it corresponds to the L170F substitution, and its homozygosity was found to be lethal (Donovan et al, 2000). These observations further indicated that mutations in this region cause loss of functionality of the protein, impairing iron release from reticuloendothelial cells. The mutation described in the large Italian family (Montosi et al, 2001) involves an amino acid residue located at the extracellular edge of the first predicted transmembrane region. As some affected individual from this family showed parenchymal iron deposits in addition to reticuloendothelial iron accumulation, it is possible that the A77D mutation may have different effects on ferroportin functionality. Alternatively, patients showing selective macrophage iron overload initially might accumulate iron also in hepatocytes later in life due to their genetic backgrounds and/or environmental factors. This crucial point needs to be clarified in further studies.

Gene mapping by analysis of DNA polymorphisms is a powerful tool for evaluating the genetic background for where a mutation arose and may suggest how it originated and spread among different populations. The finding of the same or different patterns of polymorphisms (haplotypes) linked to a pathological gene may help in elucidating the problem of its single or multiple occurrence within a population. To date, heterozygotes for the Val 162 deletion have been described in a limited number of studies (Devalia et al, 2002; Roetto et al, 2002; Wallace et al, 2002; this study). At variance with the present study, Devalia et al (2002) found eight rather than seven CGG trinucleotides in the promoter region in one affected member, and noted no correlation between IVSI-24 and hyperferritinaemia. Thus, the fact that at least two haplotypes have been typed so far in carriers of the mutated gene argues against a founder effect and supports the hypothesis of recurrent mutations. The presence of the short stretch of tandem TTG repeats at the breakpoints of the deletion may have somehow facilitated the skipping of one repeat during DNA replication, where slippage synthesis may have occurred due to the repetitive nature of the sequence (Magnani et al, 1996). This suggests that the Val 162 deletion may be a quite common mutation, with a higher than expected frequency in the general population. Reliable estimates of the prevalence of this mutation could be facilitated by the availability of a simple and fast mutational scanning technique. From this point of view, we have shown that DHPLC was effective in the recognition of this mutation (Fig 4), giving a usual pattern that might be diagnostic for the deletion.

Heterozygosity for Val 162 deletion represents the prototype of selective reticuloendothelial iron overload: therefore, the OMIM definitions ‘haemochromatosis, autosomal dominant’ or ‘haemochromatosis, type 4’ appear to be inappropriate for this clinical condition, which should rather be taken into account in the differential diagnosis of hereditary or congenital hyperferritinaemias, such as hereditary hyperferritinaemia/cataract syndrome (due to mutations in L ferritin IRE) and translational disorders of H ferritin. The most common problem is likely to be the misdiagnosis of this condition as haemochromatosis. As many physicians still diagnose iron overload by ferritin rather than using iron and transferrin saturation, it must be emphasized that hyperferritinaemia does not always equal parenchymal iron overload. Finally, it should not be assumed that patients who are heterozygous for the ferroportin Val 162 deletion will require treatment unless there is clear evidence of parenchymal iron overload.

References

  1. Top of page
  2. Abstract
  3. Patients and methods
  4. Results
  5. Hyperferritinaemia transmitted as an autosomal dominant trait in the family and clinical evidence for selective reticuloendothelial iron overload in the proband
  6. Mutation analysis of L and H ferritin genes
  7. Ferroportin gene (SLC11A3) mutation analysis
  8. Ferroportin gene (SLC11A3) polymorphisms
  9. DHPLC scanning for the three base pair deletion in exon 5 of ferroportin gene (SLC11A3)
  10. Relationship between serum ferritin levels and age in patients heterozygous for the ferroportin Val 162 deletion
  11. Discussion
  12. Acknowledgments
  13. References
  • Baranano, D.E., Wolosker, H., Bae, B.I., Barrow, R.K., Snyder, S.H. & Ferris, C.D. (2000) A mammalian iron ATPase induced by iron. Journal of Biological Chemistry, 275, 1516615173.
  • Cazzola, M. (2002) Hereditary hyperferritinaemia/cataract syndrome. Baillière's Best Practice and Research Clinical Haematology, 15 (in press).
  • Cazzola, M., Bergamaschi, G., Tonon, L., Arbustini, E., Grasso, M., Vercesi, E., Barosi, G., Bianchi, P.E., Cairo, G. & Arosio, P. (1997) Hereditary hyperferritinemia–cataract syndrome: relationship between phenotypes and specific mutations in the iron-responsive element of ferritin light-chain mRNA. Blood, 90, 814821.
  • Cazzola, M., Foglieni, B., Bergamaschi, G., Levi, S., Lazzarino, M. & Arosio, P. (2002) A novel deletion of the l-ferritin iron-responsive element responsible for severe hereditary hyperferritinaemia–cataract syndrome. British Journal of Haematology, 116, 667670.
  • Cremonesi, L., Fumagalli, A., Soriani, N., Ferrari, M., Levi, S., Belloli, S., Ruggeri, G. & Arosio, P. (2001) Double-gradient denaturing gradient gel electrophoresis assay for identification of l-ferritin iron-responsive element mutations responsible for hereditary hyperferritinemia-cataract syndrome: identification of the new mutation C14G. Clinical Chemistry, 47, 491497.
  • Devalia, V., Carter, K., Walker, A.P., Perkins, S.J., Worwood, M., May, A. & Dooley, J.S. (2002) Autosomal dominant reticulo-endothelial iron overload associated with a three base pair deletion in the ferroportin 1 gene (SLC11A3). Blood, 100, 695697.
  • Donovan, A., Brownlie, A., Zhou, Y., Shepard, J., Pratt, S.J., Moynihan, J., Paw, B.H., Drejer, A., Barut, B., Zapata, A., Law, T.C., Brugnara, C., Lux, S.E., Pinkus, G.S., Pinkus, J.L., Kingsley, P.D., Palis, J., Fleming, M.D., Andrews, N.C. & Zon, L.I. (2000) Positional cloning of zebrafish ferroportin1 identifies a conserved vertebrate iron exporter. Nature, 403, 776781.
  • Fillet, G., Beguin, Y. & Baldelli, L. (1989) Model of reticuloendothelial iron metabolism in humans: abnormal behavior in idiopathic hemochromatosis and in inflammation. Blood, 74, 844851.
  • Finch, C.A. & Huebers, H.A. (1982) Perspectives in iron metabolism. New England Journal of Medicine, 306, 15201528.
  • Fleming, R.E. & Sly, W.S. (2001) Ferroportin mutation in autosomal dominant hemochromatosis: loss of function, gain in understanding. Journal of Clinical Investigation, 108, 521522.
  • Huebers, H.A. & Finch, C.A. (1984) Transferrin: physiologic behavior and clinical implications. Blood, 64, 763767.
  • Kato, J., Fujikawa, K., Kanda, M., Fukuda, N., Sasaki, K., Takayama, T., Kobune, M., Takada, K., Takimoto, R., Hamada, H., Ikeda, T. & Niitsu, Y. (2001) A mutation, in the iron-responsive element of H ferritin mRNA, causing autosomal dominant iron overload. American Journal of Human Genetics, 69, 191197.
  • Lee, P.L., Gelbart, T., West, C., Halloran, C., Felitti, V. & Beutler, E. (2001) A study of genes that may modulate the expression of hereditary hemochromatosis: transferrin receptor-1, ferroportin, ceruloplasmin, ferritin light and heavy chains, iron regulatory proteins (IRP)-1 and -2, and hepcidin. Blood Cells, Molecules and Diseases, 27, 783802.
  • Lipschitz, D.A., Cook, J.D. & Finch, C.A. (1974) A clinical evaluation of serum ferritin as an index of iron stores. New England Journal of Medicine, 290, 12131216.
  • Magnani, C., Cremonesi, L., Giunta, A., Magnaghi, P., Taramelli, R. & Ferrari, M. (1996) Short direct repeats at the breakpoints of a novel large deletion in the CFTR gene suggest a likely slipped mispairing mechanism. Human Genetics, 98, 102108.
  • Montosi, G., Donovan, A., Totaro, A., Garuti, C., Pignatti, E., Cassanelli, S., Trenor, C.C., Gasparini, P., Andrews, N.C. & Pietrangelo, A. (2001) Autosomal-dominant hemochromatosis is associated with a mutation in the ferroportin (SLC11A3) gene. Journal of Clinical Investigation, 108, 619623.
  • Njajou, O.T., Vaessen, N., Joosse, M., Berghuis, B., Van Dongen, J.W., Breuning, M.H., Snijders, P.J., Rutten, W.P., Sandkuijl, L.A., Oostra, B.A., Van Duijn, C.M. & Heutink, P. (2001) A mutation in SLC11A3 is associated with autosomal dominant hemochromatosis. Nature Genetics, 28, 213214.
  • Roetto, A., Merryweather-Clarke, A.T., Daraio, F., Livesey, K., Pointon, J.J., Barbabietola, G., Piga, A., Mackie, P.H., Robson, K.J.H. & Camaschella, C. (2002) A valine deletion of ferroportin1: a common mutation in hemochromatosis type 4? Blood, 100, 733734.
  • Torti, F.M. & Torti, S.V. (2002) Regulation of ferritin genes and protein. Blood, 99, 35053516.
  • Wallace, D.F., Pedersen, P., Dixon, J.L., Stephenson, P., Searle, J.W., Powell, L.W. & Subramaniam, V.N. (2002) Novel mutation in ferroportin1 is associated with autosomal dominant hemochromatosis. Blood, 100, 692694.
  • Xiao, W. & Oefner, P.J. (2001) Denaturing high-performance liquid chromatography: a review. Human Mutation, 17, 439474.