Histone deacetylase inhibitors potently repress CXCR4 chemokine receptor expression and function in acute lymphoblastic leukaemia


  • Roman Crazzolara,

    1. Tyrolean Cancer Research Institute (TCRI) at the University of Innsbruck,
    2. Department of Paediatrics, Innsbruck University Hospital, Innsbruck, Austria,
    Search for more papers by this author
  • Karin Jöhrer,

    1. Tyrolean Cancer Research Institute (TCRI) at the University of Innsbruck,
    Search for more papers by this author
  • Ricky W. Johnstone,

    1. Gene Regulation Laboratory, Peter MacCallum Cancer Institute, Melbourne, Australia,
    Search for more papers by this author
  • Richard Greil,

    1. Tyrolean Cancer Research Institute (TCRI) at the University of Innsbruck,
    2. Laboratory of Molecular Cytology, Department of Internal Medicine, Innsbruck University Hospital, and
    Search for more papers by this author
  • Reinhard K Ofler,

    1. Tyrolean Cancer Research Institute (TCRI) at the University of Innsbruck,
    2. Division of Molecular Pathophysiology, Institute of Pathophysiology, University of Innsbruck, Innsbruck, Austria
    Search for more papers by this author
  • Bernhard Meister,

    1. Tyrolean Cancer Research Institute (TCRI) at the University of Innsbruck,
    2. Department of Paediatrics, Innsbruck University Hospital, Innsbruck, Austria,
    Search for more papers by this author
  • David Bernhard

    1. Tyrolean Cancer Research Institute (TCRI) at the University of Innsbruck,
    2. Division of Molecular Pathophysiology, Institute of Pathophysiology, University of Innsbruck, Innsbruck, Austria
    Search for more papers by this author

Roman Crazzolara, MD, Department of Paediatrics, Innsbruck University Hospital, Anichstrasse 35, 6020 Innsbruck, Austria. E-mail: roman.crazzolara@uibk.ac.at


Summary. The chemokine receptor CXCR4 plays a crucial role in the survival and trafficking of leukaemia cells and requires further attention as human immunodeficiency virus type I (HIV-I) utilises CXCR4 as the major coreceptor for cellular entry. We demonstrated that inhibitors of histone deacetylases, currently being tested in clinical trials for the treatment of various tumours, extensively downregulated CXCR4 protein and mRNA levels in leukaemia cell lines and lymphoblasts from patients with childhood acute leukaemia. As a result, the ability of stromal cell-derived factor-1 to induce cellular migration was impaired. Repression of CXCR4 transcription by inhibitors of histone deacetylases might therefore represent a promising novel approach in the treatment of acute leukaemias.

The chemokine receptor CXCR4 (also termed LESTR or fusin) is a G protein-coupled 7-transmembrane domain receptor specific for the chemokine stromal cell-derived factor-1 (SDF-1) (Bleul et al, 1996; Oberlin et al, 1996). Physiological interactions of this ligand–receptor system have been implicated in embryogenesis, including homing of myelo- and haematopoetic progenitors, heart development, neuronal cell migration and vascular development, as demonstrated by SDF-1- and CXCR4-knockout mice (Nagasawa et al, 1996; Ma et al, 1998). Further, SDF-1 has been shown to play an important role in the trafficking and survival of various leukaemic cells in vitro (Burger et al, 1999; Nishii et al, 1999; Bradstock et al, 2000; Mohle et al, 2000; Crazzolara et al, 2001) and breast cancer cells in vivo (Muller et al, 2001), where antibody-mediated blocking of CXCR4 reduced metastasis formation in mice. Additionally, CXCR4 was identified as an essential cofactor for the entry of T-cell lymphotropic human immunodeficiency virus (HIV) isolates, mediated by the viral envelope glycoprotein gp120 (Bleul et al, 1996; Oberlin et al, 1996). As CXCR4 constitutes a potential neutralization target for HIV infection, inhibitory peptides and antibodies have been generated. Limited bio-availability of these macromolecular drugs and mutations in the HIV gp120 protein may reduce the efficiency of preventing the infection. Thus, low-molecular-weight CXCR4 expression-reducing compounds would represent a promising novel opportunity for improved treatment of different diseases, such as cancer and HIV infection.

Inhibitors of histone deacetylases, such as suberoylanilide hydroxamic acid (SAHA) or the butyrate pro-drug tributyrin, are well known for their antitumoral activities in vitro and are currently tested in clinical trials for their potential use in patients. These agents have been shown to (i) induce cancer cell apoptosis (Bernhard et al, 1999a; Ruefli et al, 2001), (ii) stop cancer cell proliferation (Bernhard et al, 1999a), (iii) enhance physiological death-receptor signals that are important for the immune response against viral infections (Bernhard et al, 2001) and (iv) reduce CXCR4 mRNA in human colonic epithelial cells (Jordan et al, 1999). Here we report, for the first time, that in leukaemia cell lines, as well as in lymphoblasts from patients with childhood acute lymphoblastic leukaemia (ALL), histone deacetylase inhibitors downregulate CXCR4 mRNA and protein, resulting in diminished SDF-1-induced leukaemia cell migration.

Materials and methods

Reagents.  Recombinant human SDF-1β was from R&D Systems (Vienna, Austria). Suberoylanilide hydroxamic acid (SAHA) was a kind donation from Dr Victoria Richon and Professor Paul A. Marks (Memorial Sloan-Kettering Cancer Institute, New York, USA). All other reagents, including butyric acid, were from Sigma (Vienna, Austria) unless indicated otherwise.

Cell lines and culture conditions.  T-ALL cell lines CEM-C7H2, Jurkat and HUT-78 were cultured in Roswell Park Memorial Institute (RPMI)-1640 medium (Life Technologies, Paisley, UK) supplemented with 10% fetal calf serum (Biological Inc., Beth Haemek, Israel) under standard conditions.

Quantification of apoptosis and cell viability.  Apoptosis was measured using the TACS™ annexin V fluorescein isothiocyanate (FITC) kit (Trevigen, Gaithersburg, MD, USA) and cell viability was determined using the Cell Proliferation Kit I (methyl thiazol tetrazoliumbromide (MTT); Boehringer Mannheim, Germany) as described previously (Bernhard et al, 1999a).

Isolation of leukaemic lymphoblasts.  Acute lymphoblastic leukaemia (ALL) lymphoblasts were isolated by a negative selection procedure from bone marrow samples of childhood ALL patients at diagnosis after informed consent. By using antibodies (all from DAKO Diagnostics AG, Vienna, Austria) against monocytes (CD14), T lymphocytes (CD3), B lymphocytes (CD23) and natural killer (NK) cells (CD56), secondarily coated with Dynabeads Pan Mouse IgG, a purity of > 95% lymphoblasts was achieved for all samples.

Immunostaining and fluorescence-activated cell sorter (FACS) analyses.  For surface immunostaining, 2 × 105 cells were washed twice in cold phosphate-buffered saline (PBS) and stained for 30 min at 4°C with fluorescein isothiocyanate (FITC)- or phycoerythrin (PE)-conjugated monoclonal antibodies (mAb) CD4-FITC (clone L200), CD3-PE (clone UCHT1) (all from Becton Dickinson, Vienna, Austria), CD49e-FITC (clone IIA1), CXCR4-PE (clone 12G5) (all from Pharmingen, Hamburg, Germany) or with isotype-control antibodies (IgG1 and IgG2a, FITC-/PE-conjugated; Becton-Dickinson), washed again and subjected to FACS-analyses. FACS-analyses were performed on a FACScan flow cytometer (Becton Dickinson, San Diego, CA, USA) and analysed with the procell quest software package.

Transmigration assays.  To perform the migration assays, 200 ng/ml of recombinant human SDF-1β was added to the lower chamber of the transmigration device (24-well, 3 µmol/l; Transwell, Corning-Costar, Bodenheim, Germany). Leukaemia cells as well as cell lines (2 × 105) were added to the upper chamber in serum-free medium and incubated (after an 12-h incubation period with or without the respective histone deacetylase inhibitors, i.e. butyrate and SAHA) for 4 h under culture conditions. The upper chamber was then carefully removed and the cells in the bottom chamber recovered for determination of cell numbers (Crazzolara et al, 2001).

Quantification of CXCR4 mRNA levels using real-time reverse-transcription polymerase chain reaction (RT-PCR). Before real-time PCR analysis (Taqman: AbiPrism 7700 sequence detector, Applied Biosystems; Brilliant Quantitative PCR Core Reagent kit, Stratagene, Vienna, Austria) total RNA was isolated and cDNAs were generated by random priming. Probes (5-carboxyfluorescein/3-carboxytetramethylrhodamine (5′-FAM/3′-TAMRA) label) and primers (Microsynth, Balgach, Switzerland) were selected using the Primer Express software (Applied Biosystems). Sequences (5′-3′ direction) of probes and primers were as follows: CXCR4 (sense) CCTGGCCTTCATCAGTCTGG; CXCR4 (antisense) TTGGCCTCTGACTGTTGGTG; Taqmanprobe CXCR4: CGCTACCTGGCCATCGTCCACG, 18S (sense) CCATTCGAACGTCTGCCCTAT; 18S (antisense) TCACCCGTGGTCACCATG; Taqmanprobe 18S: ACTTTCGATGGTAGTCGCCGTGCCT. CXCR4 mRNA levels were standardized to 18S ribosomal RNA levels.


CXCR4 is downregulated by histone deacetylase inhibitors

Surface CXCR4 levels of CEM-C7H2 leukaemia cells were evaluated by flow cytometry after incubation with different concentrations of butyrate and SAHA (Fig 1A) and at different time-points (Fig 1B). Regression analysis determined that CXCR4 protein downregulation started 130 ± 10 min (mean ± SEM, R2 = 0·993) after addition of the drugs. Maximum reduction of surface CXCR4 antigen was observed after 12 h of treatment with 10 mmol/l butyrate (reduction to 48% of control ± 4% SEM) and with 8 µmol/l SAHA (to 62 ± 3%). Similar results were obtained with the leukaemia cell lines Jurkat and HUT-78 (data not shown) and with lymphoblasts derived from the bone marrow of patients with childhood acute leukaemia (n = 4) (Fig 1C). Concordant with the downregulation of surface protein, CXCR4 mRNA levels (Fig 1D) decreased. These observations suggest that reduction of CXCR4 protein is a consequence of decreased CXCR4 gene transcription. To demonstrate the specific influence of histone deacetylase inhibitors on CXCR4 expression, cell death (by the annexin V method), cell viability (by the MTT assay) and the expression of additional membrane proteins were determined. Neither apoptosis-specific loss of phosphatidylserine asymmetry, nor MTT-reduction-associated metabolic functions were significantly altered in response to the treatment (Table I), nor were the other cell surface proteins CD3, CD4 and CD49e (VLA-5α) dramatically regulated (Fig 1E).

Figure 1.

Histone deacetylase inhibitors specifically downregulate CXCR4 chemokine receptor in acute lymphoblastic leukaemia (ALL) cells. CEM-C7H2 cells (A, B, D and E) and ALL lymphoblasts (C) were cultured in the presence or absence of butyrate (= B)/SAHA (= S) at the indicated concentrations and time-periods. Shown are: flow-cytometric analyses of surface CXCR4 protein on CEM-C7H2 cells (A and B) and bone marrow-derived lymphoblasts (C) from four patients with childhood ALL, real-time reverse transcription polymerase chain reaction (RT-PCR) quantification of CXCR4 mRNA expression (D) and flow-cytometric analyses (E) of surface proteins (CD3, 4, 49e, CXCR4) on CEM-C7H2 cells. Results represent the mean ± SEM of at least three independent experiments (MFI, mean fluorescence intensity).

Table I.  Apoptosis and spectrophotometric analyses of cell viability.
 % Specific cell death% Cell viability
  1. ± SD (12-h treatment).

  2. Apoptosis (% specific cell death) was measured using the annexin V method: % specific cell death = butyrate- or SAHA-induced cell death, spontaneous cell death in CEM-C7H2 cells (AxV, annexin V FITC; PI, propidium iodide; +, positive; –, negative). AxV–/PI+ refers to necrotic, AxV+/PI– to early apoptotic and AxV+/PI+ to late-apoptotic cells. Spectrophotometric analyses of cell viability by the methyl thiazol tetrazoliumbromide (MTT)-assay are shown (data are given as percentage cell viability). Results represent the mean ± SD of three independent experiments.

Butyrate (10 mmol/l)1·3 ± 0·22·7 ± 0·51·9 ± 0·492·6 ± 5·5
SAHA (8 µmol/l)0·0 ± 0·01·4 ± 0·31·1 ± 0·493·4 ± 1·7

Histone deacetylase inhibitors reduce SDF-1-dependent leukaemia cell migration

Next, the functional consequence of reduced surface CXCR4 after leukaemia cell treatment with butyrate and SAHA was analysed. After CXCR4 downregulation by histone deacetylase inhibitors, the leukaemia cell-lines CEM-C7H2 (Fig 2A) and Jurkat (data not shown), as well as patients' lymphoblasts, (Fig 2B) showed markedly reduced SDF-1-dependent migration.

Figure 2.

Histone deacetylase inhibitors repress SDF-1/CXCR4-mediated migration of ALL-cells. CEM-C7H2 cells (A) and ALL lymphoblasts (B) were cultured in the absence or presence of increasing concentrations of butyrate (1, 10 mmol/l) and SAHA (0·4, 8 µmol/l) for 12 h, before plating onto 3-µM trans-well microporous membranes for the migration assay, as described in Materials and methods. Results represent the mean ± SEM of three independent experiments.


Although, histone hyperacetylation is usually thought to increase gene transcription, recent DNA-chip analysis (Mariadason et al, 2000) as well as investigations on the effects of sodium butyrate on steroid hormone function (e.g. Bernhard et al, 1999a) and c-myc expression (e.g. Bernhard et al, 1999b) demonstrate that histone hyperacetylation also represses transcription. In fact, one-third of the genes altered in expression (caused by histone hyperacetylation) are downregulated (Mariadason et al, 2000).

Here we report that inhibitors of histone deacetylases potently decrease CXCR4 mRNA, protein and function in leukaemia cell lines and lymphoblasts from patients with childhood leukaemia. These findings are of particular interest as CXCR4 plays an important role in embryogenesis, acute leukaemia and HIV entry into T cells.

Good correlation of CXCR4 downregulation with the histone deacetylase inhibiting ability of structurally unrelated drugs (butyrate and SAHA) suggested that a threshold degree of chromatin hyperacetylation with subsequent modulation of gene transcription was responsible for this effect. The induction or repression of complex transcription-regulatory cascades appears to be unlikely because repression of CXCR4 protein started 130 min after addition of butyrate and SAHA to the cells. The question as to whether butyrate and SAHA directly downregulated CXCR4 mRNA or upregulated a CXCR4 transcription repressor could not be answered because both inhibitors of transcription (actinomycin D) as well as of translation (cyclohexamide), block CXCR4 expression and are toxic for CEM-C7H2 cells (data not shown). However, considering the time necessary for induction of histone hyperacetylation, and subsequent modulation of transcription and translation, it appears to be more likely that histone deacetylase inhibitor-mediated hyperacetylation acts directly on CXCR4 transcription, for example, via blockage of nucleosomal remodelling, as has been shown for the mouse mammary tumour virus (MMTV) promotor (Bresnick et al, 1990).

It has recently been demonstrated (Mohle et al, 2000; Crazzolara et al, 2001) that SDF-1 induced migration of acute leukaemia cells is tightly correlated with surface CXCR4 levels and can be specifically blocked by antibodies against CXCR4. Therefore, downregulation of CXCR4 by histone deacetylase inhibitors is likely to be responsible for reduced SDF-1 mediated chemotaxis. Although we can not completely exclude the involvement of other factors or receptors in migration reduction, butyrate and SAHA do cause reduced cell migration.

These observations might have an impact on cancer as well as HIV chemotherapy: (i) current HIV treatment strategies focus on inhibiting virus-spreading through the blockage of cellular entry, which might be achieved by downregulation of CXCR4; (ii) since antibody-mediated blockage of CXCR4 reduced metastasis formation in mice, downregulation of surface CXCR4 by histone deacetylase inhibitors, already known for their anti-cancer effects, represents a promising novel therapeutic approach towards limiting the dissemination and survival of leukaemia cells.


This work was supported by the Kinderkrebshilfe Südtirol, Kinderkrebshilfe für Tirol, Vorarlberg und Südtirol, the Austrian Science Fund (SFB-F002 and P14482) and a project grant from the National Health and Medical Research Council of Australia, the Anti-Cancer Council of Victoria (ACCV) and the Wellcome Trust (UK). The TCRI is supported by the ‘Tiroler Landeskrankenanstalten Aktiengesellschaft (TILAK)’, the ‘Tyrolean Cancer Aid Society’, various businesses, financial institutions and the people of Tyrol.