SEARCH

SEARCH BY CITATION

Keywords:

  • lymphoma;
  • p27Kip1;
  • cell cycle;
  • TGF-β;
  • cyclin D3

Abstract

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. p27Kip1 expression in aggressive non-Hodgkin's lymphoma tissues
  6. p27Kip1 expression in peripheral blood lymphocytes and in lymphoma cell lines
  7. Effect of TGF-β and serum stimulation
  8. Expression of p27Kip1 protein in subcellular fractions of lymphoma cells
  9. Sequestration of p27Kip1 by cyclin D3 in both nuclear and cytoplasmic fractions
  10. Discussion
  11. Acknowledgments
  12. References

Summary. The cyclin-dependent kinase inhibitor p27Kip1 is a key regulator of the G1/S transition, and an inverse relationship between p27Kip1 protein expression and proliferation index has been reported in malignant lymphomas. However, a subset of aggressive B-cell lymphomas demonstrates high p27Kip1 expression despite a high proliferation index. The aim of this study was to determine potential mechanisms by which lymphoma cells abrogate the growth inhibitory effect of high p27Kip1. The effect of transforming growth factor-β (TGF-β) and serum stimulation on p27Kip1 expression and cyclin E/cdk2 activity was investigated in four lymphoma cell lines, Jurkat, CEM-6, OCI-Ly1 and Nalm-6. Reactive lymphocytes responded to growth inhibitory TGF-β by inducing p27Kip1 expression, with subsequent accumulation of cells in G0/G1. In contrast, TGF-β did not alter the level of p27Kip1 in Jurkat, CEM-6 and OCI-Ly1 cells with no change in cyclin E/cdk2-kinase activity. Serum stimulation also did not result in a significant change in p27Kip1 expression. Western blot analysis of subcellular fractions demonstrated cytoplasmic p27Kip1, corroborated by immunocytochemistry in a subset of the lymphoma cells. Sequestration of p27Kip1 by cyclin D3 was observed in the nuclear and cytoplasmic fractions of Nalm-6, OCI-Ly-1 and NCEB cells. These results indicate that multiple mechanisms contribute to the abrogation of growth regulation by unscheduled high p27Kip1 protein expression including deficient response to TGF-β and serum, sequestration by cyclin D3 and cytoplasmic displacement.

p27Kip1 is a key cell cycle regulator (Polyak et al, 1994a,b; Sherr, 1994, 1995, 1996), which acts during G0 and the early G1 phase of the cell cycle to inhibit cyclin D1/cdk4 and cyclin E/cdk2 complexes (Sherr, 1995). Thus, it is highly expressed when cells are arrested in G0/G1 and its expression declines as cells progress towards S phase (Koff et al, 1993; Koff & Polyak, 1995). Its expression is crucial for the regulation of growth arrest induced by rapamycin (Kawamata et al, 1998), cyclic adenosine monophosphate (cAMP) (Kato et al, 1994; Nourse et al, 1994; Fang et al, 1996), contact inhibition or serum deprivation. Loss of p27Kip1 protein is an independent negative prognostic indicator in a number of cancers including breast (Catzavelos et al, 1997), colon (Loda et al, 1997), prostate (Tsihlias et al, 1998) and gastric carcinomas (Mori et al, 1997), and non-Hodgkin's lymphoma (NHL) (Erlanson et al, 1998; Vrhovac et al, 1998; Moller et al, 1999).

In lymphoid cells, the level of p27Kip1 mRNA and protein is high in non-proliferating lymphocytes and transforming growth factor-β (TGF-β)-treated lymphocytes (Kamesaki et al, 1998), whereas in activated and proliferating cells such as centroblasts, immunoblasts or mitogenically stimulated peripheral blood lymphocytes (Solvason et al, 1996), the level of p27Kip1 expression is low (Vrhovac et al, 1998). p27Kip1 gene alterations are either rare (Morosetti et al, 1995) or absent (Quintanilla-Martinez et al, 1998) in lymphoid neoplasms, thus epigenetic mechanisms occurring at the transcriptional, translational or post-translational level are important in p27Kip1 deregulation (Hengst & Reed, 1996). The ubiquitin proteolysis pathway is a critical mode of regulating p27Kip1 levels (Pagano et al, 1995) with increased steady state levels and stability seen in quiescent cells (Hengst & Reed, 1996; Sandhu et al, 1997). Phosphorylation of p27Kip1 by cyclin E/cdk2 at G1 is required for its degradation via the ubiquitin pathway (Schneider et al, 1996; Sheaff et al, 1996; Thomas et al, 1998).

Several studies have reported an inverse relationship between p27Kip1 protein expression and the proliferative index in malignant lymphomas (Sanchez-Beato et al, 1997; Erlanson et al, 1998) with low p27Kip1 expression having an adverse prognostic significance (Erlanson et al, 1998; Moller et al, 1999). A subset of lymphomas, however, failed to demonstrate an inverse relationship between p27Kip1 and MIB1 (Quintanilla-Martinez et al, 1998). More recent studies have reported anomalous high p27Kip1 expression in subsets of aggressive B lymphomas (Barnouin et al, 1999; Sanchez-Beato et al, 1999), as well as in malignant gliomas (Nakasu et al, 1999) with altered subcellular localization of p27Kip1 contributing to the neoplastic process in oesophageal carcinoma (Sgambato et al, 1998; Singh et al, 1998). In this study, we expanded on these observations to determine the prevalence of high p27Kip1 expression in a diverse group of malignant lymphoma cell lines and tissues and to determine potential mechanisms by which lymphoma cells abrogate the growth inhibitory effect of high p27Kip1. Our studies indicate that multiple mechanisms can confer lymphoma cell resistance to unscheduled high p27Kip1 expression including deficient regulation by TGF-β and serum, cytoplasmic displacement with or without sequestration with cyclin D3.

Tissue samples.  Tumour specimens from 23 cases of non-Hodgkin's lymphoma (NHL) and different samples of reactive lymphoid tissue, including chronic tonsillitis and lymphadenitis, were obtained from the routine surgical pathology files of the Department of Anatomic Pathology, Sunnybrook and Women's College Health Sciences Center, Toronto, from the period 1995–1998. Tissues were formalin-fixed and paraffin-embedded for histopathological diagnosis and immunohistochemical studies. NHL cases were classified according to the revised European–American classification of lymphoid neoplasms (Harris et al, 1994). The diagnoses of the selected aggressive NHLs were as follows: diffuse large B-cell lymphoma (18 cases), Burkitt lymphoma (1 case) and peripheral T-cell lymphoma (4 cases).

Isolation and activation of peripheral blood lymphocytes. Peripheral blood was obtained by venepuncture from healthy volunteers. Peripheral blood lymphocytes were isolated by density-dependent cell separation on Ficoll. Briefly, peripheral blood was diluted in a 1 : 1 ratio with sterile phosphate-buffered saline (PBS). Two volumes of the blood were then laid onto 1 volume of Ficoll-Paque (Amersham Pharmacia Biotechnology Inc., Piscataway, NJ, USA) (60%) and centrifuged at 1400 r.p.m. for 30 min at room temperature. Mononuclear cells were collected from the buffy coats. Monocytes were removed by plastic adherence on tissue culture-treated Petri dishes for 6 h at 37°C and 5% CO2. The remaining peripheral blood lymphocytes were then maintained under the same conditions as lymphoma-derived cell lines. Cells were activated by 1% phytohaemaglutinin (PHA; GibCo BRL, Rockville, MD, USA) and phorbol myristate acetate (PMA; Sigma Chemicals Corp., St. Louis, MO, USA) (5 ng/ml) for 20 h before harvesting for Western blotting and flow cytometric analysis.

Cell cultures.  Human malignant lymphoma cell lines were obtained from American Type Culture Collection (Rockville, MD, USA) or from the laboratory of Dr N. Berinstein, University of Toronto. All cell lines were maintained in Roswell Park Memorial Institute (RPMI)-1640 medium (GibCo BRL) supplemented with 10% heat-inactivated fetal calf serum, 2 mmol/l l-glutamine and 100 units/ml of penicillin-streptomycin mixture (GibCo BRL) at 37°C and 5% CO2.

Cell cycle analysis.  Cell cycle profiles were analysed by flow cytometry as described previously (Kumar & Atlas, 1992). Briefly, 1 × 106 control or treated cells were pelleted and resuspended in 1·2 ml of propidium iodide solution (50 µg/ml in 0·1% sodium citrate plus 0·1% Triton X-100; Sigma Chemicals Corp.). All profiles were generated using a FACScan flow cytometer and Cell Quest software (Becton Dickinson, San Jose, CA, USA).

Preparation of cell lysates and immunoblot analysis.  Cells were lysed using radioimmunoprecipitation assay (RIPA) buffer [25 mmol/l Tris-HCl, 0·1% sodium dodecyl sulphate (SDS), 1% Triton X-100, 1% sodium deoxycholate, 0·15 mol/l NaCl, 1 mmol/l EDTA and 0·1% protease inhibitor cocktail (Sigma Corp.)]. Protein concentrations of cell extracts were measured using the bicinchoninic acid (BCA) protein assay kit (Pierce, IL, USA). For each lane, 15 µg proteins were resolved by 12% SDS-polyacrylamide gel electrophoresis (SDS-PAGE) using a Bio-Rad mini gel system. Separated proteins were subsequently transferred onto a nitrocellulose film using a semi-dry transfer apparatus (Bio-Rad). The following antibodies were used for immunoblot analysis: mouse monoclonal antibody against cyclin-dependent kinase 2 (CDK2), cyclin D3 (Santa Cruz Biotechnology, CA, USA), mouse monoclonal antibody against p27Kip1 (Transduction Laboratories, Lexington, KY, USA), and mouse monoclonal antibody against p21Waf1 (Calbiochem, La Jolla, CA, USA). Immunoreactive protein bands were visualized using the enhanced chemiluminescence (ECL) kit (Amersham Pharmacia Biotechnology Inc.).

Immunohistochemistry.  Serial sections (5 µm-thick) were mounted on glass slides coated with 2% aminopropyltrioxysilane (APES; Sigma Corp.) in acetone. Sections were dewaxed in xylene and rehydrated in graded ethanols. Endogenous peroxidase activity was blocked by immersion in 0·3% methanolic peroxide for 15 min. Immunoreactivity of the target antigens was enhanced by microwaving and incubating the tissue sections for 10 min in 0·1 mol/l citrate buffer. p27kip1 protein expression was detected by incubating the tissue sections with a monoclonal antibody to p27Kip1 (Transduction Laboratories) diluted 1 : 500. The proliferation index was assessed by using the MIB1 monoclonal antibody (Novocastra, Newcastle, UK) diluted 1 : 1000 in PBS that recognizes an epitope of the Ki-67 antigen. The sections were then incubated with a biotinylated perioxidase agent (BioGenex, San Ramon, CA, USA). Antigen–antibody reactions were visualized using diaminobenzadine as the chromogen. Normal mouse serum containing mixed immunoglobulins at a concentration approximating that of the primary antibody was used as a negative control. Sections were counterstained with haematoxylin and eosin (H&E). Normal tonsil tissue was used as a positive control for all antibodies.

Interpretation of immunohistochemical stains.  The percentages of neoplastic cells expressing p27Kip1 and MIB1 by immunohistochemical stains in each case were assessed by counting 400 cells from at least three different representative fields using the 50x objective. Cells that showed distinct nuclear staining that was considerably above background levels were considered positive.

Preparation of nuclear and cytoplasmic fractions. Subcellular components were fractionated as previously described (Singh et al, 1998) with minor modifications. Briefly, exponentially growing cells were collected and resuspended in hypertonic buffer supplemented with 0·1% protease inhibitor cocktail (Sigma Chemicals Corp.). After swelling in ice for 20 min, plasma membranes were disrupted by repeated pipetting through a pipette tip. Cell breakage was assessed by microscopic observation. Samples were microcentrifuged at 3000 r.p.m. for 10 min at 4°C to collect the cytoplasmic fraction (supernatant). The pellets were washed once with hypertonic buffer and resuspended in RIPA buffer. The nuclear fraction (supernatant) was recovered by microcentrifugation at 12 000 r.p.m. at 4°C for 10 min.

The purity of the cytoplasmic and nuclear fractions was confirmed by Western blot analysis of a nucleus-specific protein, Ki67.

Immunoprecipitation.  For immunoprecipitation followed by immunoblotting, 200 µg proteins in 500 µl RIPA buffer were mixed with 2 µg antibodies and incubated overnight at 4°C with gentle shaking. Immune complexes were collected on protein G-Agarose beads (GibCo BRL) and washed five times in lysis buffer.

Immune complex kinase assay.  The cyclin E/cdk2 kinase assay was performed as described previously (Kamesaki et al, 1998) with modifications. Briefly, cell lysates were prepared in Nonidet P-40 (NP-40) lysis buffer. Proteins (200 µg) in 500 µl NP-40 lysis buffer were mixed with 2 µg of monoclonal anticyclin E antibodies (Santa Cruz Biotechnology). The immune complexes were then precipitated and washed as described in the previous section. The protein-bound beads were incubated in 50 µl of assay solution containing kinase buffer [50 mmol/l Tris-HCl, pH 7·5, 10 mmol/l MgCl2 and 1 mmol/l dithiothreitol (DTT)], 5 µg of histone H1 (GibCo BRL) 1 µmol/l ATP, and 370 kBq [γ-32P] ATP (111 TBq/mmol) at 30°C for 30 min. The reaction was terminated by the addition of SDS sample-loading buffer. Proteins were separated by 12% PAGE. Histone H1 kinase activity was detected using autoradiography.

Reverse transcription polymerase chain reaction (RT-PCR).  Total RNA was extracted using TRIzol Reagent (GibCo BRL) following the manufacturer's instructions. First-strand cDNA was synthesized from 2 µg of RNA in 20 µl of reaction solution using a random primer and Superscript II reverse transcriptase Reagent (GibCo BRL) according to the manufacturer's instructions. The p27Kip1 cDNA was amplified using HP27-7 forward (AACGTGCGAGTGTCTAACG) and HP27-234 reverse (CTCTTGCCACTCGTACTTG). GAPDH cDNA was amplified using a forward primer (CGGAGTCAACGGATTTGGTCG) and a reverse primer (AGCCTTCTCCATGGTGGTGAAGAC). The thermal cycling conditions for all PCR were: 94°C for 5 min, followed by 30 cycles of 94°C for 50 s, 59°C for 50 s and 72°C for 90 s. The PCR products were resolved on a 2% agarose gel and stained with ethidium bromide (Sigma Chemicals Corp.). Densitometry was performed using the Molecular Dynamic Imaging system and ImageQuant 3·3 software to quantify relative amounts of protein and nucleic acids detected by Western blots and ethidium bromide-stained gels respectively.

p27Kip1 expression in aggressive non-Hodgkin's lymphoma tissues

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. p27Kip1 expression in aggressive non-Hodgkin's lymphoma tissues
  6. p27Kip1 expression in peripheral blood lymphocytes and in lymphoma cell lines
  7. Effect of TGF-β and serum stimulation
  8. Expression of p27Kip1 protein in subcellular fractions of lymphoma cells
  9. Sequestration of p27Kip1 by cyclin D3 in both nuclear and cytoplasmic fractions
  10. Discussion
  11. Acknowledgments
  12. References

To determine the frequency of anomalous high p27Kip1 protein expression in aggressive lymphomas, we performed immunohistochemical analysis on lymph nodes involved by reactive hyperplasia and aggressive NHL. As previously reported (Quintanilla-Martinez et al, 1998), reactive tonsils and lymph nodes showed strong nuclear p27Kip1 expression in mantle cells and interfollicular small lymphocytes, whereas most germinal centre cells were negative (Fig 1A). The expression pattern of MIB1 was opposite to that seen for p27Kip1, with numerous centroblasts demonstrating strong expression while centrocytes and mantle cells were rarely positive (data not shown). A total of 23 cases of aggressive NHL were analysed for p27Kip1 and MIB1 by immunohistochemistry. Representative H&E-stained sections and immunohistochemistry results are shown in Fig 1(B–E). p27Kip1 and MIB1 staining was scored using a four-point grading system (< 25%, 25–50%, 51–75%, > 75%) and the data are summarized in Table I. In the majority of aggressive NHL cases (17/23; 74%) there was low (< 50%) p27Kip1 expression with 10 cases exhibiting < 25% (Fig 1D) and seven showing 25–50% immunoreactivity. However, six cases (26%) showed greater than 50% p27Kip1 expression (Fig 1E), despite a moderate to high proliferation index (Fig 1C).

image

Figure 1.   (A) A reactive germinal centre of a lymph node demonstrates p27Kip1 expression within the mantle B cells and interfollicular T cells with no staining within most of the germinal centre B cells (x100). (B) Aggressive non-Hodgkin's lymphoma (H&E x200). (C) High proliferation index demonstrated with MIB1 stain (x200). (D) Most cases demonstrated low p27Kip1 expression (x200). (E) Six cases of DLBCL showed high p27Kip1 expression (x200) despite a high proliferation index.

Download figure to PowerPoint

Table I.   Correlation between p27Kip1 and MIB1 expression in aggressive NHLs.*
CaseDiagnosesMIB1%p27%
  1. *Percentages of neoplastic cells expressing p27Kip1 or MIB1 by immunohistochemical stains were assessed by counting 400 cells from at least three different representative fields. Cells that showed distinct nuclear staining that was considerably above background levels were considered positive.

1DLBCL50–75< 25
2DLBCL50–75< 25
3PTCL50–7525–50
4DLBCL50–7526–50
5PTCL50–7550–75
6DLBCL> 75> 75
7DLBCL50–75< 25
8DLBCL50–7550–75
9DLBCL> 75< 25
10DLBCL25–5025–50
11PTCL50–7525–50
12DLBCL50–7525–50
13DLBCL50–7525–50
14DLBCL> 75< 25
15DLBCL> 7550–75
16Burkitt's> 75< 25
17DLBCL> 75< 25
18DLBCL50–7550–75
19DLBCL> 75< 25
20PTCL> 75< 25
21DLBCL50–75< 25
22DLBCL> 7550–75
23DLBCL> 7525–50

p27Kip1 expression in peripheral blood lymphocytes and in lymphoma cell lines

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. p27Kip1 expression in aggressive non-Hodgkin's lymphoma tissues
  6. p27Kip1 expression in peripheral blood lymphocytes and in lymphoma cell lines
  7. Effect of TGF-β and serum stimulation
  8. Expression of p27Kip1 protein in subcellular fractions of lymphoma cells
  9. Sequestration of p27Kip1 by cyclin D3 in both nuclear and cytoplasmic fractions
  10. Discussion
  11. Acknowledgments
  12. References

p27Kip1 protein expression in unstimulated and PHA- and PMA-activated peripheral blood lymphocytes (PBL) was determined by Western blot analysis (Fig 2A). The expression was compared with that of total cell lysates from a panel of exponentially growing malignant lymphoma cell lines of B- and T-cell lineage. A strong 27-kDa band consistent with p27Kip1 protein was seen in quiescent PBLs. Mitogen activation for 24 h resulted in significant decrease in p27Kip1 expression, while growth inhibitory conditions such as 24-h treatment with TGF-β resulted in significant induction of p27Kip1 protein expression (Fig 2A). Analysis of p27Kip1 expression in lymphoma cell lines (Fig 2A) demonstrated that, although p27Kip1 RNA levels (Fig 2B) were similar when GAPDH was used as cDNA control, the levels of p27Kip1 protein expression determined by Western blot analysis were largely variable and many cell lines showed high constitutive levels of p27Kip1 protein. This suggests that p27Kip1 may be regulated at a post-transcriptional level (Pagano et al, 1995; Sheaff et al, 1996; Vlach et al, 1996). No significant differences were noted in the levels of a related cyclin-dependent kinase inhibitor, p21Waf1 protein expression (Fig 2A). Notably, p27Kip1 protein levels in Jurkat, CEM-6, HPB (T-cell acute lymphoblastic leukaemia (ALL)), Karpas 299 (T-cell anaplastic large cell lymphoma) and PB697 (Pre-B-ALL) were significantly higher than in NCEB (mantle cell lymphoma), OCI-Ly1, Karpas 422 (diffuse large B-cell lymphoma), Raji (Burkitt lymphoma) and Nalm-6 (Pre B-ALL) cells. Immunohistochemistry performed on cell blocks prepared from exponentially growing lymphoma cells was consistent with this and showed that, while four cell lines demonstrated an inverse relationship between p27Kip1 and MIB1, this was not observed in three cell lines (Jurkat, SMS and Karpas 422) (data not shown).

image

Figure 2.  Expression of p27Kip1 mRNA and protein expression in malignant lymphoma cells and peripheral blood lymphocytes (PBL). (A) Western blot analysis of non-Hodgkin's lymphoma cell lines and PBL for p27Kip1 and p21Waf1 expression. (B) RT-PCR analysis for p27Kip1 transcript expression using GAPDH as the cDNA loading control.

Download figure to PowerPoint

Effect of TGF-β and serum stimulation

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. p27Kip1 expression in aggressive non-Hodgkin's lymphoma tissues
  6. p27Kip1 expression in peripheral blood lymphocytes and in lymphoma cell lines
  7. Effect of TGF-β and serum stimulation
  8. Expression of p27Kip1 protein in subcellular fractions of lymphoma cells
  9. Sequestration of p27Kip1 by cyclin D3 in both nuclear and cytoplasmic fractions
  10. Discussion
  11. Acknowledgments
  12. References

TGF-β is a growth inhibitory cytokine that induces p27Kip1 protein expression with subsequent inhibition of cyclin E/cdk2 kinase activity (Kamesaki et al, 1998). The effect of TGF-β and serum stimulation on p27Kip1 expression and cyclin E/cdk2 activity was investigated in four malignant lymphoma cell lines (Jurkat, CEM-6, OCI-Ly1 and Nalm-6) with variable levels of p27Kip1 expression and compared with that of PBL. After 24 h of TGF-β exposure, the level of p27Kip1 expression had increased > twofold (Fig 2A) in reactive lymphocytes, resulting in the accumulation of cells in G0/G1 phase of the cell cycle (71·2 ± 1·8% to 84 ± 1·2% = 12·8% increase)(P < 0·05) (Fig 3). Mitogenic stimulation with PHA and PMA resulted in > 10-fold decrease in p27Kip1 expression. In contrast, Jurkat, CEM-6 and OCI-Ly1 lymphoma cells did not show reduction of p27Kip1 levels after serum stimulation (Fig 4A). Furthermore, when cultured in the presence of TGF-β (Fig 4B), the cells failed to induce p27Kip1 expression with no obvious reduction in cyclin E/cdk2-kinase activity, as measured by histone H1 kinase activity after cyclin E immunoprecipitation (Fig 4C). TGF-β and serum stimulation also failed to modulate the cell cycle parameters with no significant change in the number of cells in the G0/G1 phase (< 2%) of the cell cycle (Fig 3) for all the cell lines tested. The results suggested that these lymphoma cells were resistant to the growth inhibitory signals induced by TGF-β and growth stimulatory signals of serum stimulation. In one cell line (Nalm-6), an induction of p27Kip1 protein was seen after exposure to TGF-β, however, this was associated with a paradoxical increase in cyclin E/cdk2 kinase activity, suggesting the presence of a pathway distal to TGF-β that may be contributing to the loss of growth regulation in this cell line.

image

Figure 3.  Effect of TGF-β on cell growth parameters in PBL and lymphoma cells (Jurkat, CEM-6 and Nalm-6). Cell cycle analyses were performed to determine percentage of cells in G0/G1 phase after PBL were activated for 24 h with PHA and PMA. Cell cycle analyses were performed to determine percentage of cells in G0/G1 phase after PBLs and lymphoma cells (Jurkat, CEM-6 and Nalm-6) were incubated with TGF-β for 24 h.

Download figure to PowerPoint

image

Figure 4.  Effect of serum stimulation and TGF-β on expression of p27Kip1 and CDK2 kinase activity. (A) Serum stimulation following a 24-h period of serum starvation fails to result in significant p27Kip1 protein expression. (B) TGF-β incubation does not induce significant p27Kip1 protein expression. (C) No significant change in cyclin E/CDK2 kinase activity as measured by phosphorylation of histone H1.

Download figure to PowerPoint

Expression of p27Kip1 protein in subcellular fractions of lymphoma cells

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. p27Kip1 expression in aggressive non-Hodgkin's lymphoma tissues
  6. p27Kip1 expression in peripheral blood lymphocytes and in lymphoma cell lines
  7. Effect of TGF-β and serum stimulation
  8. Expression of p27Kip1 protein in subcellular fractions of lymphoma cells
  9. Sequestration of p27Kip1 by cyclin D3 in both nuclear and cytoplasmic fractions
  10. Discussion
  11. Acknowledgments
  12. References

Cytoplasmic displacement and sequestration of p27Kip1has been reported to be potential mechanisms of p27Kip1 inactivation in a number of neoplastic cells (Singh et al, 1998; Sgambato et al, 1999). In addition, anomalous high p27Kip1 expression and its association with overexpressed cyclin D3 in some aggressive B-cell lymphomas (Barnouin et al, 1999; Sanchez-Beato et al, 1999) is suggested to be a mechanism contributing to p27Kip1 inactivation. This, together with our current in vivo and in vitro observation of cytoplasmic expression of p27Kip1, led us to analyse its expression in subcellular fractions of lymphoma cells. Western blot analysis of nuclear and cytoplasmic fractions demonstrated that, whereas expression of a nuclear protein Ki67 was restricted to the nuclear fractions in all cell lines (Fig 5A), p27Kip1 protein was found in the cytoplasmic fraction (Fig 5A) in most cell lines. Furthermore, in 6/11 of lymphoma cell lines, approximately 40% of total p27Kip1 was displaced to the cytoplasmic compartment. In addition, a positive correlation between the level of nuclear p27Kip1 and cytoplasmic p27Kip1 expression was seen in most cell lines. Immunohistochemical analysis of cell blocks prepared from exponentially growing cells also demonstrated the presence of punctate granular p27Kip1 within the cytoplasm of tumour cells in 2/11 lines and 4/23 cases of lymphoma. Figure 5B demonstrates the presence of p27Kip1 protein in the cytoplasm of a representative cell line. These results suggest that alterations in the subcellular localization of p27Kip1 expression occur frequently and may play a role in cellular resistance to the growth inhibitory effect of high p27Kip1 in aggressive lymphoma cells.

image

Figure 5.   (A) Western blot analysis of nuclear and cytoplasmic fractions. Nuclear and cytoplasmic fractions were subject to Western blot analyses using antibodies to p27Kip1, cyclin D3 and Ki-67. (B) Immunohistochemical analysis of a cell line (L428) demonstrates punctate granular p27Kip1 expression within the cytoplasm of many tumour cells (x400). (C) Immunoprecipitation of nuclear and cytoplasmic fractions with anti-p27Kip1 followed by Western blot analysis for cyclin D3 demonstrates p27Kip1/cyclin D3 complexes.

Download figure to PowerPoint

Sequestration of p27Kip1 by cyclin D3 in both nuclear and cytoplasmic fractions

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. p27Kip1 expression in aggressive non-Hodgkin's lymphoma tissues
  6. p27Kip1 expression in peripheral blood lymphocytes and in lymphoma cell lines
  7. Effect of TGF-β and serum stimulation
  8. Expression of p27Kip1 protein in subcellular fractions of lymphoma cells
  9. Sequestration of p27Kip1 by cyclin D3 in both nuclear and cytoplasmic fractions
  10. Discussion
  11. Acknowledgments
  12. References

Analysis of cyclin D3 levels within the nuclear and cytoplasmic fractions demonstrated high levels of protein expression in 7/11 lymphoma cell lines. In the Epstein-Barr virus-transformed lymphoblastoid cell lines (GM 607) and two lymphoma cell lines including L428 (Hodgkin's lymphoma) and NCEB (mantle cell lymphoma), there was absence of cyclin D3 expression in either the nuclear or cytoplasmic fractions. In two cell lines, OCI-Ly1 and Karpas 422, cyclin D3 protein expression was detected in only the cytoplasmic fractions. Interestingly, an alternative high-molecular-weight form of cyclin D3 (smear above cyclin D3 in Fig 5A, middle) was present in only the nuclear fractions of 10 cell lines. Furthermore, the alternative form of cyclin D3, but not the wild type species, was present in three cell lines (L428, NCEB and GM607). A positive correlation between p27Kip1 and cyclin D3 levels was observed in Jurkat and PB697 while a negative correlation was seen in HPB, Nalm-6 and Raji cells. Sanchez-Beato et al (1999) have previously demonstrated that cyclin D3/p27Kip1 complexes within the nucleus are inactive in a subset of aggressive B lymphomas. Immunoprecipitation studies of seven cell lines with variable levels of p27Kip1 expression, including three with high p27Kip1 levels (Jurkat, CEM- and PB697) and low (NCEB) to minimal levels of p27Kip1 (Raji, OCI LY-1 and Nalm-6), followed by immunoblotting with anticyclin D3 antibody (Fig 5C), demonstrated the presence of cyclin D3/p27Kip1 complexes within both the nuclear and cytoplasmic fractions. These results indicate that, in addition to overexpression of cyclin D3, its sequestration with p27Kip1 occurs within the nuclear and cytoplasmic fractions in a large number of malignant lymphoma cell lines. Furthermore, the low levels of p27Kip1 expression observed by Western blot analysis may be attributed to subtotal sequestration by cyclin D3 in OCI-Ly-1, Raji and Nalm-6 cells.

Discussion

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. p27Kip1 expression in aggressive non-Hodgkin's lymphoma tissues
  6. p27Kip1 expression in peripheral blood lymphocytes and in lymphoma cell lines
  7. Effect of TGF-β and serum stimulation
  8. Expression of p27Kip1 protein in subcellular fractions of lymphoma cells
  9. Sequestration of p27Kip1 by cyclin D3 in both nuclear and cytoplasmic fractions
  10. Discussion
  11. Acknowledgments
  12. References

The cyclin-dependent kinase inhibitor p27Kip1 is an important regulator of the G1/S transition (Polyak et al, 1994b). The growth inhibitory effect of many cytokines is associated with the induction of Cip/Kip and INK4 family of cyclin-dependent kinase inhibitors (Polyak et al, 1994a). Several studies have reported an inverse relationship between p27Kip1 protein expression and the proliferative index in malignant lymphomas (Sanchez-Beato et al, 1997), with low p27Kip1 expression having an adverse prognostic significance (Erlanson et al, 1998; Moller et al, 1999). A subset of aggressive B-cell lymphomas, however, demonstrate high p27Kip1 expression despite a high proliferation index (Barnouin et al, 1999) and adverse clinical outcome (Sanchez-Beato et al, 1999). We also observed deregulated high p27Kip1 protein expression in 8/28 cases of aggressive malignant lymphomas and 6/11 lymphoma cell lines. Such paradoxical correlation of CDK inhibitors with cell proliferation has been reported in other malignancies including gastric, colorectal and breast carcinomas, especially those that were highly aggressive and metastatic (Sgambato et al, 1998; Singh et al, 1998; Nakasu et al, 1999).

p27Kip1 plays a critical role in the development and differentiation of T lymphocytes (Tsukiyama et al, 2001). Exquisite control of p27Kip1 levels in reactive lymphocytes is critical for maintenance of normal differentiation and proliferation of T lymphocytes. Transgenic mice that express high levels of p27Kip1 show abnormal development of thymocytes that appear to be blocked at the CD4–CD8–CD25+CD44 low stage. T cells from these mice also exhibited a reduced ability to proliferate in response to mitogenic stimulation and defective immunoresponsiveness (Tsukiyama et al, 2001). Mice deficient in p27Kip1 have increased proliferative responses to multiple cytokines including interleukin (IL)-2, IL-4 and IL-12, suggesting a role for p27Kip1 as a negative regulator of cytokine-stimulated T-cell growth (Zhang et al, 2000). p27Kip1 has also been demonstrated to play a role in T-cell anergy by inhibition of IL-2 transcription and clonal expansion of alloreactive human and mouse helper T lymphocytes (Boussiotis et al, 2000). The constitutively high levels of p27Kip1 observed in a majority of lymphoma cell lines and in lymphoma tissues suggest that abrogation of normal growth regulation by p27Kip1 is common.

Our data demonstrate that anomalous high p27Kip1 in neoplastic lymphocytes may contribute to a lack of growth modulation by TGF-β and serum stimulation. TGF-β-mediated G1 arrest correlates with accumulation of the retinoblastoma gene product pRB and increased expression of p15Ink4, p21Waf1 and p27Kip1, which reduces the activity of specific CDKs with subsequent cell cycle arrest (Sandhu et al, 1997). Reactive lymphocytes responded to PHA- and PMA-stimulation by a greater than 10-fold reduction of p27Kip1 protein expression, while exposure to TGF-β resulted in induction of p27Kip1 expression with subsequent inhibition of cyclin E/cdk2-kinase activity and accumulation of cells in G0/G1 phase of the cell cycle. In contrast, Jurkat, CEM-6 and OCI-Ly1 lymphoma cells cultured in the presence of TGF-β failed to induce p27Kip1 expression with no change in cyclin E/cdk2-kinase activity. Serum stimulation also failed to induce a significant change in p27Kip1 protein levels. Only in Nalm-6 cells was there a slight change in p27Kip1 protein levels with serum stimulation or TGF-β incubation. The failure of lymphoma cells to transmit a signal upon binding of TGF-β and arrest in G1 is likely to contribute to unrestrained cell growth. This mechanism has been described in transformed epithelial cells (Filmus et al, 1992), but has not been demonstrated in lymphomas. A potential mechanism not addressed in our current study is loss of receptor expression, due to receptor mutation or inactivation of distal elements within the TGF-β-mediated signalling pathway. Nevertheless, our data suggest that deregulated high expression of p27Kip1 may represent a mechanism whereby lymphoma cells are resistant to the growth inhibitory effect of TGF-β.

The growth inhibitory effect of high p27Kip1 protein levels in aggressive lymphoma may be abrogated by several mechanisms. Potential mechanisms of escape from growth arrest mediated by high p27Kip1 include; (a) amplification of other cell cycle regulators such as cyclin D or cyclin E, which may drive the cell cycle independent of p27Kip1 expression; (b) sequestration by cell cycle proteins; (c) abnormal cellular localization causing inactivation; and (d) altered ubiquitin-mediated p27Kip1 degradation.

We analysed the expression of p27Kip1 in subcellular fractions of lymphoma cells that expressed variable levels of p27Kip1 to determine whether abnormal cellular localization could be a potential mechanism of its inactivation. This observation was in keeping with our results, which showed that a significant proportion (approximately 40%) of total p27Kip1 protein was found in the cytoplasmic fraction of 6/11 of lymphoma cell lines. Previous laser confocal microscopy and co-immunoprecipitation studies (Sanchez-Beato et al, 1999) have shown the existence of cyclin D3/p27Kip1 complexes within the nucleus of Burkitt lymphoma cells. Cytoplasmic displacement/sequestration of p27Kip1 has been reported to be a potential mechanism of its inactivation (Barnouin et al, 1999). More recently, p27Kip1 has been associated with detergent-insoluble microdomains of lymphocyte membranes, known as rafts, which are thought to provide a scaffold for signalling proteins (Yaroslavskiy et al, 2001). As the localization of proteins within raft structures is thought to be important for cell signalling, it is likely that the localization of p27Kip1 in these structures have a significant impact in the cell's response to signalling molecules. Our studies show that p27Kip1 is abnormally localized to the cytoplasm in a majority of cells and this can occur irrespective of over-expression of cyclin D3. These results are consistent with the notion that alterations in the subcellular localization of p27Kip1 expression may play a role in cellular resistance to the growth inhibitory effect of high p27Kip1 in lymphoma cells. Although we did not study the sequestration of other cell cycle-associated proteins such as cyclin E, cyclin D1 and Skp2, they may also play a role in abrogation of p27Kip1-mediated growth regulation. More recently, oncogenic RAS has been shown to mediate the mislocalization of p27Kip1 and CDK6 with concomitant abrogation of TGF-β-mediated growth inhibition (Liu et al, 2000). It is possible that the presence of RAS and other related oncogenes may modulate the cytoplasmic displacement seen in our lymphoma cell lines.

In summary, our study demonstrates that anomalous high p27Kip1 expression occurs in a large subset of aggressive lymphomas. We demonstrate that this is associated with disruption of the TGF-β-mediated growth inhibition and serum (cytokine)-mediated cell proliferation. Our observations indicate that multiple mechanisms contribute to lymphoma cell resistance to unscheduled high p27Kip1 expression, including cytoplasmic displacement and sequestration with cyclin D3. The role of mediators that may contribute to the unscheduled expression of p27Kip1 in lymphoma cells such as the recently characterized ubiquitin ligase, Skp2 (Sutterluty et al, 1999), is the focus of ongoing studies in our laboratory.

References

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. p27Kip1 expression in aggressive non-Hodgkin's lymphoma tissues
  6. p27Kip1 expression in peripheral blood lymphocytes and in lymphoma cell lines
  7. Effect of TGF-β and serum stimulation
  8. Expression of p27Kip1 protein in subcellular fractions of lymphoma cells
  9. Sequestration of p27Kip1 by cyclin D3 in both nuclear and cytoplasmic fractions
  10. Discussion
  11. Acknowledgments
  12. References
  • Barnouin, K., Fredersdorf, S., Eddaoudi, A., Mittnacht, S., Du Pan, L.X., M.Q. & Lu, X. (1999) Antiproliferative function of p27Kip1 is frequently inhibited in highly malignant Burkitt's lymphoma cells. Oncogene, 18, 63886397.
  • Boussiotis, V.A., Freeman, G.J., Taylor, P.A., Berezovskaya, A., Grass, I., Blazar, B.R. & Nadler, L.M. (2000) p27kip1 functions as an anergy factor inhibiting interleukin 2 transcription and clonal expansion of alloreactive human and mouse helper T lymphocytes. Nature Medicine, 6, 290297.
  • Catzavelos, C., Bhattacharya, N., Ung, Y.C., Wilson, J.A., Roncari, L., Sandhu, C., Shaw, P., Yeger, H., Morava-Protzner, I., Kapusta, L., Franssen, E., Pritchard, K.I. & Slingerland, J.M. (1997) Decreased levels of the cell-cycle inhibitor p27Kip1 protein: prognostic implications in primary breast cancer. Nature Medicine, 3, 227230.
  • Erlanson, M., Portin, C., Linderholm, B., Lindh, J., Roos, G. & Landberg, G. (1998) Expression of cyclin E and the cyclin-dependent kinase inhibitor p27 in malignant lymphomas-prognostic implications. Blood, 92, 770777.
  • Fang, F.G., Watanabe, N., Hunter, T. & Ruoslahti, E. (1996) Dependence of cyclin E-CDK2 kinase activity on cell anchorage. Science, 271, 499502.
  • Filmus, J., Zhao, J. & Buick, R.N. (1992) Overexpression of H-ras oncogene induces resistance to the growth-inhibitory action of transforming growth factor beta-1 (TGF-beta 1) and alters the number and type of TGF-beta 1 receptors in rat intestinal epithelial cell clones. Oncogene, 7, 521526.
  • Harris, N.L., Jaffe, E.S., Stein, H., Banks, P.M., Chan, J.K.C., Cleary, M.L., Delsol, G., De Wolf-Peeters, C., Falini, B., Gatter, K.C., Grogan, T.M., Isaacson, P.G., Knowles, D.M., Mason, D.Y., Muller-Hermelink, H.K., Pileri, S.A., Piris, M.A., Ralfkiaer, E. & Warnke, R.A. (1994) A revised European-American classification of lymphoid neoplasms: a revised European-American classification of lymphoid neoplasms: a proposal from the International Lymphoma Study Group. Blood, 84, 13611392.
  • Hengst, L. & Reed, S.I. (1996) Translational control of p27Kip1 accumulation during the cell cycle. Science, 271, 18611864.
  • Kamesaki, H., Nishizawa, K., Michaud, G.Y., Cossman, J. & Kiyono, T. (1998) TGF-beta 1 induces the cyclin-dependent kinase inhibitor p27Kip1 mRNA and protein in murine B cells. Journal of Immunology, 160, 770777.
  • Kato, J.Y., Matsuoka, M., Polyak, K., Massague, J. & Sherr, C.J. (1994) Cyclic AMP-induced G1 phase arrest mediated by an inhibitor (p27Kip1) of cyclin-dependent kinase-4 activation. Cell, 79, 487496.
  • Kawamata, S., Sakaida, H., Hori, T., Maeda, M. & Uchiyama, T. (1998) The upregulation of p27Kip1 by rapamycin results in G1 arrest in exponentially growing T-cell lines. Blood, 91, 561569.
  • Koff, A. & Polyak, K. (1995) p27KIP1, an inhibitor of cyclin-dependent kinases. Progress in Cell Cycle Research, 1, 141147.
  • Koff, A., Ohtsuki, M., Polyak, K., Roberts, J.M. & Massague, J. (1993) Negative regulation of G1 in mammalian cells: inhibition of cyclin E-dependent kinase by TGF-B. Science, 260, 536539.
  • Kumar, R. & Atlas, I. (1992) Interferon alpha induces the expression of retinoblastoma gene product in human Burkitt lymphoma Daudi cells: role in growth regulation. Proceedings of the National Academy of Sciences of the United States of America, 89, 65996603.
  • Liu, X., Sun, Y., Ehrlich, M., Lu, T., Kloog, Y., Weinberg, R.A., Lodish, H.F. & Henis, Y.I. (2000) Disruption of TGF-beta growth inhibition by oncogenic ras is linked to p27Kip1 mislocalization. Oncogene, 19, 59265935.
  • Loda, M., Cukor, B., Tam, S.W., Lavin, P., Fiorentino, M., Draetta, G.F., Jessup, J.M. & Pagano, M. (1997) Increased proteasome-dependent degradation of the cyclin-dependent kinase inhibitor p27 in aggressive colorectal carcinomas. Nature Medicine, 3, 231234.
  • Moller, M.B., Skjodt, K., Mortensen, L.S. & Pedersen, N.T. (1999) Clinical significance of cyclin-dependent kinase inhibitor p27Kip1 expression and proliferation in non-Hodgkin's lymphoma: independent prognostic value of p27Kip1. British Journal of Haematology, 105, 730736.
  • Mori, M., Mimori, K., Shiraishi, T., Tanaka, S., Ueo, H., Sugimachi, K. & Akiyoshi, T. (1997) p27 expression and gastric carcinoma. Nature Medicine, 3, 593.
  • Morosetti, R., Kawamata, N., Gombart, A.F., Miller, C.W., Hatta, Y., Hirama, T., Said, J.W., Tomonaga, M. & Koeffler, H.P. (1995) Alterations of the p27KIP1 gene in non-Hodgkin's lymphomas and adult T-cell leukemia/lymphoma. Blood, 86, 19241930.
  • Nakasu, S., Nakajima, M. & Handa, J. (1999) Anomalous p27kip1 expression in a subset of malignant gliomas. Brain Tumor Pathology, 16, 1721.
  • Nourse, J., Firpo, E., Flanagan, W.M., Coats, S., Polyak, K., Lee, M.-H., Massague, J., Crabtree, G.R. & Roberts, J.M. (1994) Interleukin-2-mediated elimination of the p27Kip1 cyclin-dependent kinase inhibitor prevented by rapamycin. Nature, 372, 570573.
  • Pagano, M., Tam, S.W., Theodoras, A.M., Beer-Romero, P., Del Sal, G., Chau, V., Yew, P.R., Draetta, G.F. & Rolfe, M. (1995) Role of the ubiquitin-proteasome pathway in regulating abundance of the cyclin-dependent kinase inhibitor p27. Science, 269, 682685.
  • Polyak, K., Kato, J., Solomon, M.J., Sherr, C.J., Massague, J., Roberts, J.M. & Koff, A. (1994a) p27Kip1, a cyclin-Cdk inhibitor, links transforming growth factor-beta and contact inhibition to cell cycle arrest. Genes and Development, 8, 922.
  • Polyak, K., Lee, M.H., Erdjument-Bromage, H., Koff, A., Roberts, J.M., Tempst, P. & Massague, J. (1994b) Cloning of p27Kip1, a cyclin-dependent kinase inhibitor and a potent mediator of extracellular antimitogenic signals. Cell, 78, 5966.
  • Quintanilla-Martinez, L., Thieblemont, C., Fend, F., Kumar, S., Pinyol, M., Campo, E., Jaffe, E.S. & Raffeld, M. (1998) Mantle cell lymphomas lack expression of p27Kip1, a cyclin-dependent kinase inhibitor. American Journal of Pathology, 153, 175182.
  • Sanchez-Beato, M., Saez, A.I., Martinez-Montero, J.C., Maeo, M.S., Sanchez-Verde, L., Villuendas, R., Troncone, G. & Piris, M.A. (1997) Cyclin-dependent kinase inhibitor p27KIP1 in lymphoid tissue: p27KIP1 expression is inversely proportional to the proliferative index. American Journal of Pathology, 151, 151160.
  • Sanchez-Beato, M., Camacho, F.J., Martinez-Montero, J.C., Saez, A.I., Villuendas, R., Sanchez-Verde, L., Garcia, J.F. & Piris, M.A. (1999) Anomalous high p27/KIP1 expression in a subset of aggressive B-cell lymphomas is associated with cyclin D3 overexpression. p27/KIP1-cyclin D3 colocalization in tumor cells. Blood, 94, 765772.
  • Sandhu, C., Garbe, J., Daksis, J., Pan, C.H., Bhattacharya, N., Yaswen, P., Koh, J., Slingerland, J. & Stampfer, M.R. (1997) Transforming growth factor beta stabilizes p15INK4B protein, increases p15INK4B/cdk4 complexes and inhibits cyclin D1/cdk4 association in human mammary epithelial cells. Molecular and Cellular Biology, 17, 24582467.
  • Schneider, B.L., Yang, Q.H. & Futcher, A.B. (1996) Linkage of replication to start by the Cdk inhibitor Sic1. Science, 272, 560562.
  • Sgambato, A., Zhang, Y.-J., Ciaparrone, M., Soh, J.-W., Cittadini, A., Santella, R.M. & Weinstein, I.B. (1998) Overexpression of p27Kip1 inhibits the growth of both normal and transformed human mammary epithelial cells. Cancer Research, 58, 34483454.
  • Sgambato, A., Ratto, C., Faraglia, B., Merico, M., Ardito, R., Schinzari, G., Romano, G. & Cittadini, A.R. (1999) Reduced expression and altered subcellular localization of the cylin-dependent kinase inhibitor p27 (Kip1) in human colon cancer. Molecular Carcinogenesis, 26, 172179.
  • Sheaff, R.J., Thress, K., Groudine, M. & Roberts, J.M. (1996) Turnover of cyclin E by the ubiquitin-proteasome pathway is regulated by cdk2 binding and cyclin phosphorylation. Genes and Development, 10, 19791990.
  • Sherr, C.J. (1994) G1 phase progression: cycling on cue. Cell, 79, 551555.
  • Sherr, C.J. (1995) d-type cyclins. Trends in Biochemical Sciences, 20, 187190.
  • Sherr, C.J. (1996) Cancer cell cycles. Science, 274, 16721677.
  • Singh, S.P., Lipman, J., Goldman, H., Ellis, F.H., Aizenman, L., Cangi, M.G., Signoretti, S., Chiaur, D.S., Pagano, M. & Loda, M. (1998) Loss or altered subcellular localization of p27 in Barrett's associated adenocarcinoma. Cancer Research, 58, 17301735.
  • Solvason, N., Wu, W.W., Kabra, N., Wu, X., Lees, E. & Howard, M.C. (1996) Induction of cell cycle regulatory proteins in anti-immunoglobulin stimulated mature B lymphocytes. Journal of Experimental Medicine, 184, 407417.
  • Sutterluty, H., Chatelain, E., Marti, A., Wirbelauer, C., Senften, M., Muller, U. & Krek, W. (1999) p45SKP2 promotes p27Kip1 degradation and induces S phase in quiescent cells. Nature Cell Biology, 1, 207214.
  • Thomas, G.V., Szigeti, K., Murphy, M., Draetta, G., Pagano, M. & Loda, M. (1998) Down-regulation of p27 is associated with development of colorectal adenocarcinoma metastases. American Journal of Pathology, 153, 681687.
  • Tsihlias, J., Kapusta, L.R., DeBoer, G., Morava-Protzner, I., Zberanowski, I., Bhattacharya, N., Catzavelos, G.C., Klotz, L.H. & Slingerland, J.M. (1998) Loss of cyclin-dependent kinase inhibitor p27Kip1 is a novel prognostic factor in localized human prostate adenocarcinoma. Cancer Research, 58, 542548.
  • Tsukiyama, T., Ishida, N., Shirane, M., Minamishima, Y.A., Hatakeyama, S., Kitagawa, M., Nakayama, K. & Nakayama, K. (2001) Down-regulation of p27Kip1 expression is required for development and function of T cells. Journal of Immunology, 166, 304312.
  • Vlach, J., Hennecke, S., Alevizopoulos, K., Conti, D. & Amati, B. (1996) Growth arrest by the cyclin-dependent kinase inhibitor p27Kip1 is abrogated by c-Myc. EMBO Journal, 15, 65956604.
  • Vrhovac, R., Delmer, A., Tang, R., Marie, J.-P., Zittoun, R. & Ajchenbaum-Cymbalista, F. (1998) Prognostic significance of the cell cycle inhibitor p27Kip1 in chronic B-cell lymphocytic leukemia. Blood, 91, 46944700.
  • Yaroslavskiy, B.B., Stolz, D.B., Watkins, S.C., Alber, S.M., Bradbury, N.A. & Steinman, R.A. (2001) p27Kip1 localizes to detergent-insoluble microdomains within lymphocyte membranes. Molecular Medicine, 7, 4958.
  • Zhang, S., Lawless, V.A. & Kaplan, M.H. (2000) Cytokine-stimulated T lymphocyte proliferation is regulated by p27Kip1. Journal of Immunology, 165, 62706277.