SEARCH

SEARCH BY CITATION

Keywords:

  • Bernard–Soulier syndrome;
  • GPIX Asn-45Ser;
  • molecular diagnosis;
  • immune thrombocytopenia

Abstract

  1. Top of page
  2. Abstract
  3. Patients and methods
  4. Results
  5. Discussion
  6. Acknowledgments
  7. References

Summary. Bernard–Soulier syndrome (BSS) is a rare inherited disorder with giant platelets, thrombocytopenia and a prolonged bleeding time. These abnormalities are caused by genetic defects of the glycoprotein (GP) Ib-IX complex that constitutes the von Willebrand factor receptor on the platelet surface. Here, we describe four unrelated German patients with low platelet counts and mild bleeding tendency. Three patients had been diagnosed with immune thrombocytopenia (ITP) and were treated with steroids without response. Another patient presented with easy bruising. Peripheral blood smears showed giant platelets. Ristocetin-induced platelet aggregation was almost absent, and quantitative flow cytometry and Western blotting disclosed a greatly reduced surface expression of GPIb-IX. Unexpectedly, sequencing the entire coding regions of GPIbα, GPIbβ and GPIX revealed that all four unrelated patients were homozygous for an A to G mutation in position 1826 of the GPIX gene, constituting a Asn-45Ser change. This mutation has been described before and now represents by far the most often identified molecular defect causing BSS in Caucasians. Because BSS patients are likely to be misdiagnosed with ITP, treatment-resistant ITP patients should be re-evaluated thoroughly. Asn-45Ser genotyping may be a helpful tool for differential diagnosis.

Bernard–Soulier syndrome (BSS) is a rare, inherited bleeding disorder with giant platelets, thrombocytopenia and a prolonged bleeding time. Its prevalence is expected to be less than 1 in 1 000 000 in the populations of Europe, North America and Japan. The clinical manifestations of BSS are diverse. Platelet counts in BSS patients may range from very low to normal, skin bleeding times may range from > 20 min to marginally normal, and severe, as well as absent, bleeding episodes have been reported.

Abnormalities are caused by genetic defects of the glycoprotein (GP) Ib/IX/V complex, which constitutes the von Willebrand factor receptor on the platelet surface. The complex is formed by the association of four separate gene products: GPIbα is covalently linked to GPIbβ, and they associate, non-covalently, with GPIX and GPV, most probably in a 2:2:2:1 ratio (Modderman et al, 1992; Lopez et al, 1998). The most frequent genetic causes of BSS are defects in the GPIbα gene, which often lead to protein truncation and loss of its trans-membrane domain (Nurden & George, 2001). Defects of the GPIbβ and GPIX genes are observed less frequently, whereas defects of GPV have not been reported to date, although the gene is known to be polymorphic (Koskela et al, 1998). Besides mutations leading to an absence or reduced amount of the GPIb-X complex on the platelet surface, variant forms of BSS, with essentially normal surface expression, but abnormal binding properties, have been reported (Lopez et al, 1998).

In this study, we describe the molecular characterization of four unrelated BSS patients.

Patients.  Blood samples from four unrelated German patients from different federal states were sent to our laboratory during a period of 2 years. All patients had a history of chronic bleeding and moderate-to-distinct thrombocytopenia (Table I). Three patients were suspected to suffer from immune thrombocytopenia (ITP). Blood samples from healthy blood donors were used as controls in all experiments. Samples from patients and donors were obtained with informed consent and with the approval of the National Blood Service ethics review board.

Table I.  Clinical details of the four BSS patients studied.
Patient (sex)Age (years)Platelet count (109/l)Clinical signsComplications in surgical interventionsInitial diagnosis
  1. m, male; f, female.

1 (m)6325–50Easy bruising; mild epistaxis; one episode of severe epistaxisTwo tooth extractions without major bleedingITP
2 (f)1319–78Easy bruising; mild epistaxis; gingival bleeding; menorrhagiaAppendectomy without major bleeding; secondary haemorrhage after tooth extraction for 2 dITP
3 (m)  967–69Mild epistaxis; one episode of peranal haemorrhageUnknown thrombopathy
4 (m)1054–68Tonsillectomy without major bleeding; moderate secondary haemorrhage after tooth extractionITP

Platelet morphology and function studies.  Giemsa peripheral blood smears were performed from all blood samples. Platelet-rich plasma (PRP) was obtained from ACD-anticoagulated blood by spontaneous sedimentation at 37°C. Aggregometry was performed as reported previously (Sachs et al, 2000).

Flow cytometry.  Commercially available assays (Biocytex, Marseille, France) containing monoclonal antibodies (mAbs) specific to GPIbα, GPIX, GPV, GPIIb and GPIIIa were used to quantify the number of binding sites present on the platelets of both patients and controls. The fluorescence intensity, measured on the immunolabelled platelets using a FACSCalibur (Becton Dickinson, Heidelberg, Germany), was transformed into the number of accessible sites resulting from the included calibrator (standard beads) and negative isotypic controls as recommended by the manufacturer. All tests were performed in triplicate with PRP instead of whole blood.

Immunoblotting.  Immunoblotting under reducing conditions was performed as described previously (Sachs et al, 2000). Briefly, 109 washed platelets were lysed in 1 ml of solubilization buffer, and proteins were separated with 7·5% sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to a nitrocellulose membrane. Membrane strips were blocked with bovine serum albumin in phosphate-buffered saline and incubated with mAbs Gi16 (anti-GPIIb), Gi27 (anti-GPIbβ), SW16 (anti-GPV), SZ2 (anti-GPIbα) and FMC25 (anti-GPIX). Peroxidase-conjugated rabbit anti-mouse antibody (Dianova, Hamburg, Germany) was used as a secondary antibody.

Amplification of genomic DNA and sequencing.  Genomic DNA was isolated from EDTA-anticoagulated blood using QIAamp (Qiagen, Hilden, Germany). The coding regions for GPIbβ and GPIX were amplified as described previously (Sachs et al, 2000). The coding regions of the GPIbα gene were amplified using corresponding primer pairs A1 to A5 (Table II). All PCR products were purified on 1·5% SeaKem® agarose gel (FMC, Hessisch Oldendorf, Germany) using QIAquick (Qiagen). DNA sequencing was performed using BigDye® 3·0 (Applied Biosystems, Weiterstadt, Germany) on a Prism 3100® genetic analyser according to the manufacturer's instructions. All sequences were compared with data obtained from the National Center for Biotechnology Information (NCBI) database (accession numbers NM_000173, NM_000407 and NM_80478).

Table II.  Primers used for BSS screening.
PrimerPrimer position*Primer sequence (5′−3′)
  1. * Primer positions according to NCBI database accession numbers M22403, AF006988·1 and M80478·1 respectively.

GP Ib alpha
 A12761–2780gagagaaggacggagtcgag
 A1R3218–3199ggttgtgtctttcggcaggt
 A23125–3144ctgtgaggtctccaaagtgg
 A2R3585–3566tagccagactgagcttctcc
 A33511–3530aaggcaatgagctgaagacc
 A3R4108–4087cttgtgttggatgcaaggag
 A44056–4075tccactgcttctctagacag
 A4R4492–4473ggctgatcaagttcagggat
 A54394–4413cacaagcctgatcactccaa
 A5R4978–4959ttctctcaaggtccccaaac
GP Ib beta
 B112979–13005ctgagcttactgctcctgctgctggc
 B1R13637–13618gagtttgcaggcccgtgttg
GP IX
 IX11581–1600ccctgaggatcggtccaggc
 IX1R1955–36cggtcctccagccagaggcg
 IX21667–1686tgttcctgctctgggccaca
 IX2R2249–2229ttggtggagtctggggacct

Genotyping of the GPIX A1826G substitution by restriction fragment length polymorphism (RFLP). GPIX PCR products no. 2 (comprising nucleotides 1667–2249) from controls and patients were digested with the restriction enzyme Fnu4HI (New England Biolabs, Schwalbach, Germany), as recommended, and all samples were analysed on a 2·2% agarose gel.

Results

  1. Top of page
  2. Abstract
  3. Patients and methods
  4. Results
  5. Discussion
  6. Acknowledgments
  7. References

All patients were thrombopenic, and morphologically abnormal giant platelets were observed in peripheral blood smears. Platelet aggregation was normal in response to ADP, but greatly reduced in response to ristocetin in all patient samples (Fig 1). This abnormality could not be corrected by the addition of normal plasma (data not shown). Thus, the provisional diagnosis of BSS was made.

image

Figure 1. Aggregometry obtained with two patient samples (patients 1 and 2) and a healthy control subject. Platelets were diluted in plasma, and ADP (10 µmol/l; left) or ristocetin (1·5 µg/ml; right) was added. T, Transmission, t, time.

Download figure to PowerPoint

The expression of the GPIb/IX/V complex was analysed by flow cytometry. As shown in Table III, all three constituents of the GPIb/IX/V complex were considerably reduced. In contrast, the number of binding sites for anti-GPIIb and anti-GPIIIa was increased in all patients, because of abnormally large platelets.

Table III.  Mean numbers (no.) of GPIb/IX/V and GPIIb/IIIa binding sites on the platelets of six control individuals and of the BSS patients as analysed by flow cytometry.
PatientMean no. of Ib/IX/V antigens per plateletMean no. of IIb/IIIa antigens per platelet
ControlsIb, 32·767  53·826
IX, 27·553 
V, 12·829 
1Ib, 8·003126·616
IX, 5·479 
V, 3·975 
2Ib, 6·014  99·999
IX, 3·356 
V, 2·327 
3Ib, 5·283  64·966
IX, 5·291 
V, 4·020 
4Ib, 5·151  79·546
IX, 3·846 
V, 2·112 

To obtain further evidence, platelet lysates from two patients and a healthy control subject were analysed by immunoblotting. Figure 2 shows reduced amounts of GPIb and GPV, whereas GPIX was undetectable in the patient samples.

image

Figure 2. Immunoblot analysis of platelet lysates from a healthy control subject (lane 1) and two patients (lane 2, patient 1; lane 3, patient 2). Membrane strips were incubated with either anti-GPIX and anti-GPV (left) or anti-GPIbα and anti-GPIbβ (right). All strips were incubated with anti-GP IIb to control protein load.

Download figure to PowerPoint

In order to detect a change in the amino acid sequence responsible for the BSS phenotype, we performed DNA sequence analysis for all subunits. All four BSS patients were found to be homozygous for an A to G substitution at position 1826 of the GPIX gene. This mutation results in an Asn-45Ser substitution of the GPIX protein. No other mutations were detected. Further investigations showed no difference in the GPIbα and GPIbβ genes when compared with wild-type isoforms.

The A1826G mutation in GPIX introduces a recognition site for the restriction endonuclease Fnu4HI. Restriction digestion confirmed that all patients were homozygous for the substitution (Fig 3).

image

Figure 3. Analysis of Fnu4HI-digested polymerase chain reaction products obtained with primer pair IX2 and IX2R. A control subject had 151 bp and 129 bp restriction fragments (ctl), whereas all four BSS patients had 129 bp and 105 bp fragments. MW, 100 bp marker (Peqlab, Erlangen, Germany).

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Patients and methods
  4. Results
  5. Discussion
  6. Acknowledgments
  7. References

All four BSS cases presented in this paper had classic symptoms known to be linked with this disease: thrombocytopenia, giant platelets and a lack of aggregation to ristocetin. Immunochemical studies of the patients' platelets revealed greatly reduced numbers of GPIb, GPIX and GPV subunits. Analysing the entire coding sequence of GPIbα, GPIbβ and GPIX showed an A to G mutation in position 1826 of the GPIX gene in all four patients, which leads to an Asn-45Ser substitution in the GPIX protein.

These findings are of special interest for two reasons. First, BSS is a rare and molecularly diverse disease. The molecular defects characterized in BSS patients are found throughout the genes for GPIbα, Ibβ and IX. Furthermore, most of the mutations described so far have not been found outside the index family.

Eight point mutations on GPIX, associated with BSS, have been reported (Wright et al, 1993; Noda et al, 1995, 1996; Noris et al, 1997; Suzuki et al, 1997; Kunishima et al, 1999; Rivera et al, 2001; Lanza et al, 2002). These mutations were located in the signal peptide (Leu-7Pro) and in the mature GPIX at positions 8, 21, 45, 55, 73, 97 and 127 respectively. The association between the Asn-45Ser mutation and BSS was originally discovered by Wright et al (1993) in a British patient. Interestingly, this mutation has also been found in an Austrian, a Swede, a Belgian and five unrelated Finnish patients (Clemetson et al, 1994; Donner et al, 1996; Koskela et al, 1999; Vanhoorelbeke et al, 2001). Expression studies in mammalian cells demonstrated that this mutation was directly responsible for decreased GPIb/IX/V expression (Sae-Tung et al, 1996). Here, we describe the occurrence of the Asn-45Ser mutation in four unrelated German BSS patients.

It seems unlikely that an identical mutation occurred several times in different European countries. Thus, it has been speculated that the Asn-45Ser mutation might be an ancient mutation shared by northern and central European populations. This theory could be supported by the characterization of our BSS cases.

Secondly, BSS is often misdiagnosed as ITP. Three out of the four BSS patients reported here have been diagnosed as, and treated for, ITP (Table I). Taking the clinical data into account, one must confess that the symptoms of these variant BSS patients resemble those seen in chronic ITP patients: epistaxis, easy bruising and lack of spontaneous bleeding. These mild phenotypes of our patients are comparable with those reported from other Asn-45Ser carriers. However, misdiagnosis causes inappropriate and expensive immune therapy. Thus, ITP patients resistant to treatment should be examined for the BSS phenotype. It has often been mentioned that under-reporting and misdiagnosis might be important reasons for the false low incidence of BSS (Lopez et al, 1998). Obviously, a certain percentage of treatment-resistant ITP patients could turn out to be variant BSS patients.

As the Asn-45Ser mutation of GPIX represents by far the most often identified molecular defect causing BSS, we suggest the introduction of Asn-45Ser genotyping for the laboratory diagnosis of BSS in European patients.

Acknowledgments

  1. Top of page
  2. Abstract
  3. Patients and methods
  4. Results
  5. Discussion
  6. Acknowledgments
  7. References

The authors wish to thank Dr C. Bettoni and Professor K. Welte (Hanover, Germany) and Professor W. Havers (Essen, Germany) who kindly referred the BSS cases to us. Our gratitude is extended to the families concerned for their co-operation in this study. This work was supported by a grant (SFB 547) from the Deutsche Forschungsgemeinschaft given to S. Santoso.

References

  1. Top of page
  2. Abstract
  3. Patients and methods
  4. Results
  5. Discussion
  6. Acknowledgments
  7. References
  • Clemetson, J.M., Kyrle, P.A., Brenne, B. & Clemetson, K.J. (1994) Variant Bernard–Soulier syndrome associated with a homozygous mutation in the leucin-rich domain of glycoprotein IX. Blood, 84, 11241131.
  • Donner, M., Karpman, D., Kristoffersson, A.C., Winqvist, I. & Holmberg, L. (1996) Recurrent mutation Asn45-Ser of glycoprotein IX in Bernard–Soulier syndrome. European Journal of Haematology, 57, 178179.
  • Koskela, S., Kekomäki, R. & Partanen, J. (1998) Genetic polymorphism in human platelet glycoprotein GP Ib/IX/V complex is enriched in GP V (CD42d). Tissue Antigens, 52, 236241.
  • Koskela, S., Javela, K., Jouppila, J., Juvonen, E., Nyblom, O., Partanan, J. & Kekomäki, R. (1999) Variant Bernard–Soulier syndrome due to homozygous Asn45Ser mutation in the platelet glycoprotein (GP) IX in seven patients of five unrelated Finnish families. European Journal of Haematology, 62, 256264.
  • Kunishima, S., Tomiyama, Y., Honda, S., Kurata, Y., Kumiya, T., Ozawa, K. & Saito, H. (1999) Cys97-Tyr mutation in the glycoprotein IX gene associated with Bernard–Soulier syndrome. British Journal of Haematology, 107, 539545.
  • Lanza, F., De La Salle, C., Bass, M.J., Schwartz, A., Boval, B., Cazenave, J.P. & Caen, J.P. (2002) A Leu7Pro mutation in the signal peptide of platelet glycoprotein GP (IX) in a case of Bernard–Soulier syndrome abolishes surface expression of the GP Ib-V-IX complex. British Journal of Haematology, 18, 260266.
  • Lopez, J.A., Andrews, R.K., Afshar-Kharghan, V.A. & Berndt, M.C. (1998) Bernard–Soulier syndrome. Blood, 91, 43974418.
  • Modderman, P.W., Admiraal, L.G., Sonnenberg, A. & Von Dem Borne, A.E.G.Kr. (1992) Glycoprotein V and Ib-IX form a noncovalent complex in the platelet membrane. Journal of Biological Chemistry, 267, 364369.
  • Noda, M., Fujimura, K., Takafuta, T., Shimomura, T., Fujimoto, T., Yamamoto, N., Tanoue, K., Arai, M., Suehiro, A., Kakishita, E., Shimasaki, A. & Kuramoto, A. (1995) Heterogeneous expression of glycoprotein Ib, IX and V in platelets from two patients with Bernard–Soulier syndrome caused by different genetic abnormalities. Thrombosis and Haemostasis, 74, 14111415.
  • Noda, M., Fujimura, K., Takafuta, T., Shimomura, T., Fuji, T., Katsutani, S., Fujimoto, T., Kuramoto, A., Yamazaki, T., Mochizuki, T., Matssuzaki, M. & Sano, M. (1996) A point mutation in glycoprotein IX coding sequence (Cys73 (TGT) to Tyr (TAT) causes impaired surface expression of GP Ib/IX/V complex in two families with Bernard–Soulier syndrome. Thrombosis and Haemostasis, 76, 874878.
  • Noris, P., Simek, S., Stibbe, J. & Von Dem Borne, A.E.G.Kr. (1997) A phenylalanine-55 to serine amino-acid substitution in the human glycoprotein IX leucine-rich repeat is associated with Bernard–Soulier syndrome. British Journal of Haematology, 97, 312320.
  • Nurden, A.T. & George, J.N. (2001) Inherited abnormalities of the platelet membrane: Glanzmann thrombasthenia, Bernard–Soulier syndrome, and other disorders. In: Hemostasis and Thrombosis. Basic Principles and Clinical Practice (ed. by R.W.Colman, J.Hirsh, V.J.Marder, A.W.Clowes & J.N. George), 921943. Lippincott, Williams & Wilkins, Philadelphia.
  • Rivera, C.E., Villagra, J., Riordan, M., Williams, S., Lindstrom, K.J. & Rick, M.E. (2001) Identification of a new mutation in platelet glycoprotein IX (GPIX) in a patient with Bernard–Soulier syndrome. British Journal of Haematology, 112, 105108.
  • Sachs, U.J.H., Kiefel, V., Böhringer, M., Afshar-Kharghan, V., Kroll, H. & Santoso, S. (2000) Single amino acid substitution in human platelet glycoprotein Ibβ is responsible for the formation of the platelet-specific alloantigen Iya. Blood, 95, 18491855.
  • Sae-Tung, G., Dong, J.F. & Lopez, J.A. (1996) Biosynthetic defect in platelet glycoprotein IX mutants associated with Bernard–Soulier syndrome. Blood, 87, 13611367.
  • Suzuki, K., Hayashi, T., Yahagi, A., Akiba, J., Tajima, K. & Satoh, S. (1997) Novel point mutation in the leucine-rich motif of the platelet glycoprotein IX associated with Bernard–Soulier syndrome. British Journal of Haematology, 99, 794800.
  • Vanhoorelbeke, K., Schlammadinger, A., Delville, J.P., Handsaeme, J., Vandecasteele, G., Vauterin, S., Pradier, O., Wijns, W. & Deckmyn, H. (2001) Occurrence of the Asn45Ser mutation in the GP IX gene in a Belgian patient with Bernard Soulier syndrome. Platelets, 12, 114120.
  • Wright, S.D., Michaelides, K., Johnson, D.J.D., West, N.C. & Tuddenham, E.G.D. (1993) Double heterozygosity for mutations in the platelet glycoprotein IX gene in three siblings with Bernard–Soulier syndrome. Blood, 81, 23392347.