SEARCH

SEARCH BY CITATION

Keywords:

  • transcobalamin deficiency;
  • mutation;
  • splice site;
  • vitamin B12;
  • anaemia

Abstract

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Patients.
  5. Assays for serum B12 and TC.
  6. RNA/DNA extraction, DNA amplification, cloning and translation in the reticulocyte lysate system.
  7. Transfection studies in Cos cells.
  8. Metabolic radiolabelling of TC.
  9. Results
  10. Transcobalamin in plasma
  11. Genetic analysis
  12. Transfection studies
  13. Discussion
  14. References

Summary.  Transcobalamin (TC), a vitamin B12 (cobalamin, Cbl) binding protein in plasma, promotes the cellular uptake of the vitamin by receptor-mediated endocytosis. Inherited TC deficiency is an autosomal recessive disorder characterized by megaloblastic anaemia caused by cellular vitamin B12 depletion. It may be accompanied by neurological complications, including a delay in psychomotor and mental development. This report describes three sisters with inherited TC deficiency resulting from a splicing defect in the TC gene. A point mutation was identified in intron 3 splice site of the TC gene that activates a cryptic splice site in exon 3. The transcript generated has an in-frame deletion of 81 nucleotides and the resulting truncated protein is unstable and not secreted by the cells. Until now, genetic studies have been reported in only five patients with TC deficiency and the molecular defect was different in each of them, which gives evidence for a genetic heterogeneity of the disease.

Vitamin B12 (Cobalamin, Cbl) forms complexes with three proteins: intrinsic factor (IF), haptocorrin (HC) and transcobalamin (TC) (Nexo, 1998). IF is required for vitamin B12 intestinal uptake, whereas TC transports vitamin B12 to tissues and cells that express specific receptors, which internalize the vitamin as the TC–Cbl complex (Rothenberg & Quadros, 1995). Upon its entry into the cell, the TC is degraded, the Cbl is released and converted to the co-enzyme forms, adenosylcobalamin and methylcobalamin, which serve as cofactors for two Cbl dependent enzymes, the mitochondrial methylmalonyl CoA mutase and the cytosolic methionine synthase (Quadros et al, 1976; Chanarin, 1979).

Inherited TC deficiency is an autosomal recessive disorder that results in clinical Cbl deficiency because of cellular Cbl depletion (Hakami et al, 1971; Cooper & Rosenblatt, 1987; Kaikov et al, 1991; Fowler, 1998). In these cases, plasma Cbl is usually in the normal range because most of the Cbl in the circulation is bound to HC. TC deficiency presents in early infancy as severe anaemia, failure to thrive and, sometimes, neurological complications, including a delay in psychomotor and mental development (Hall, 1992).

Bibi et al (1999) described three sisters, whose parents were first cousins. All three patients presented with megaloblastic anaemia, thrombocytopenia and methylmalonic aciduria that responded to vitamin B12 treatment. Some 40 reports describing TC deficiency have been published to date, but the molecular defects underlying the disorder have been identified in only five patients. The genetic abnormalities detected are heterogeneous and include extensive deletion, single nucleotide deletion, nonsense mutation and more recently, a variance in RNA editing (Li et al, 1994a,b; Qian et al, 2002).

In this report, we describe the molecular studies of the three siblings reported by Bibi et al (1999). The parents and their three unaffected children were also studied. In searching for the molecular basis of TC deficiency and its impact on the functional properties of the translated TC, we have identified a point mutation in intron 3 splice site of the TC gene that activates a cryptic splice site in exon 3. The resulting mRNA is 81 nucleotides shorter and yields a truncated protein (lacking 27 amino acids) that does not bind Cbl and is unstable.

Patients.

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Patients.
  5. Assays for serum B12 and TC.
  6. RNA/DNA extraction, DNA amplification, cloning and translation in the reticulocyte lysate system.
  7. Transfection studies in Cos cells.
  8. Metabolic radiolabelling of TC.
  9. Results
  10. Transcobalamin in plasma
  11. Genetic analysis
  12. Transfection studies
  13. Discussion
  14. References

The patients were 9-, 10- and 11-year-old female children of Moroccan parents who were first cousins. Three additional siblings, two girls and a boy were unaffected. All studies were conducted after obtaining the informed consent of all individuals involved and the approval of the hospital ethical committee. Serum and whole blood were available for all family members but skin biopsy for fibroblast cultures was available from the second affected sister only. The fibroblast cell line kept at the Repository for Mutant Human Cell strains (Montreal, Canada) was forwarded to our laboratory for our studies. Normal skin fibroblast cultures used as a control were a gift from the genetics department at this hospital. The fibroblasts were propagated at 37°C in minimum essential medium (MEM) containing 10% fetal calf serum (FCS), 2 mmol/l l-glutamine and 1 × non-essential amino acids. Cos cells were cultured at 37°C in MEM, containing 10% FCS and 4 mmol/l l-glutamine.

Assays for serum B12 and TC.

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Patients.
  5. Assays for serum B12 and TC.
  6. RNA/DNA extraction, DNA amplification, cloning and translation in the reticulocyte lysate system.
  7. Transfection studies in Cos cells.
  8. Metabolic radiolabelling of TC.
  9. Results
  10. Transcobalamin in plasma
  11. Genetic analysis
  12. Transfection studies
  13. Discussion
  14. References

Total unsaturated B12 binding capacity (UB12 BC) and that caused by unbound TC (apo-TC) in serum were measured as previously described (Jacob et al, 1977; Djalali et al, 1990; Benhayoun et al, 1993). The fraction of TC saturated with Cbl (holo-TC) was determined using the holo-TC assay kit (ICN diagnostics, Orsay, France) (Ulleland et al, 2002).

RNA/DNA extraction, DNA amplification, cloning and translation in the reticulocyte lysate system.

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Patients.
  5. Assays for serum B12 and TC.
  6. RNA/DNA extraction, DNA amplification, cloning and translation in the reticulocyte lysate system.
  7. Transfection studies in Cos cells.
  8. Metabolic radiolabelling of TC.
  9. Results
  10. Transcobalamin in plasma
  11. Genetic analysis
  12. Transfection studies
  13. Discussion
  14. References

Total RNA and genomic DNA were extracted from fibroblasts using the RNeasy kit and the QIAamp spin column procedure, respectively (Qiagen, Hilden, Germany). Full length TC cDNAs were obtained after reverse transcription and amplification with forward primer JLO1 and reverse primer JLO2 as described elsewhere (Namour et al, 2001). TC cDNAs were also amplified as several overlapping fragments using primer pairs encompassing the full length cDNA as previously described (Namour et al, 2001). Notably, amplification with forward primer S2 (286 TGCCAGGGCAAGCCTTCCAT 305) and reverse primer AS2 (690 GATCTCCTCTCGCACTGTTCT 670) generated a 404 bp fragment containing 5′ end of exon 3, exon 4 and 3′ end of exon 5. The region of the gene encompassing exon 3 and containing the 5′ end of intron 3 was also amplified from genomic DNA using forward primer DEL1 located in intron 2 (5′ ATTAACTGGCCTTGTCCTAGG 3′) and reverse primer GTI located in intron 3 (5′ AGAATGGATGGTGGGAAAGAC 3′). Amplification was carried out in a 50 μl volume containing 1.5 mmol/l MgCl2, 200 mmol/l dNTP mixture, 20 pmol of each primer and 1.25 U of Taq polymerase (Perkin Elmer, Roche Molecular Systems, Branchburg, NJ, USA). An initial denaturation step at 94°C for 1 min was followed by 30 polymerase chain reaction (PCR) cycles of 30 s at 94°C, 30 s at 58°C and 30 s at 72°C, and ended with a 7 min incubation at 72°C. DNA sequencing and cloning of the full length TC cDNAs in the pcDNA3 vector were performed as previously described (Namour et al, 2001). For the in vitro translation reaction, a TNT® Coupled Reticulocyte Lysate System was used following the manufacturer's protocol (Promega, Madison, WI, USA). The positive control for these experiments was a cDNA isolated from CaCo-2 cells that had previously been cloned in a pcDNA3 vector (Namour et al, 2001). The product of the in vitro transcription–translation reaction was analysed by sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE).

Transfection studies in Cos cells.

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Patients.
  5. Assays for serum B12 and TC.
  6. RNA/DNA extraction, DNA amplification, cloning and translation in the reticulocyte lysate system.
  7. Transfection studies in Cos cells.
  8. Metabolic radiolabelling of TC.
  9. Results
  10. Transcobalamin in plasma
  11. Genetic analysis
  12. Transfection studies
  13. Discussion
  14. References

Cos cells (1.5 × 106) were seeded in 75 cm2 flasks and after 24 h in culture, were transfected with 35 μg full-length normal or mutant TC cDNA containing plasmid using the calcium phosphate method. Two days post-transfection, cells were washed with phosphate-buffered saline, extracted with lysis buffer (Tris 50 mmol/l pH 7.4, NaCl 150 mmol/l, 1% Triton X-100, protease inhibitors cocktail 100 μl/107 cells, purchased from Sigma, St Louis, MO, USA), then the cell debris was removed by centrifugation at 30 000 g and the supernatant fraction was analysed for Cbl binding capacity. Co-transfection with β-galactosidase plasmid was used to correct for transfection efficiency.

Cell lysates and culture medium were incubated with cyano [57Co]Cbl and analysed by gel filtration chromatography to identify TC bound Cbl as previously described (Namour et al, 2001). Cbl binding was also determined by saturation analysis and removal of free cyano [57Co]cbl by adsorption to haemoglobin-coated charcoal (Gottlieb et al, 1965).

Metabolic radiolabelling of TC.

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Patients.
  5. Assays for serum B12 and TC.
  6. RNA/DNA extraction, DNA amplification, cloning and translation in the reticulocyte lysate system.
  7. Transfection studies in Cos cells.
  8. Metabolic radiolabelling of TC.
  9. Results
  10. Transcobalamin in plasma
  11. Genetic analysis
  12. Transfection studies
  13. Discussion
  14. References

Cos cells (5 × 105) cultured in 25 cm2 flasks were transfected with plasmid DNA (pcDNA3-normal TC or pcDNA3-mutant TC) using Exgen 500 transfection reagent (Euromedex, Mundolsheim, France). After 4 h, the cells were washed with methionine-free Dulbecco's modified essential medium (DMEM) and incubated with 2.22 GBq of 35S methionine (Amersham, Orsay, France) in 3 ml medium (90% methionine-free DMEM and 10% FCS) for 24 h. Following the incubation, the medium was collected and 500 μl of the medium was mixed with 3 μl of rabbit anti-TC polyclonal antiserum and incubated overnight at 4°C. To this solution, 50 μl of protein A Sepharose CL4B (Amersham, Orsay, France) was added, mixed for 2 h at 4°C and the protein A bound antibody-TC was collected by centrifugation at 200 g for 3 min at 4°C. The sepharose beads were washed four times with 10 mmol/l Tris–HCl pH 7.4, 150 mmol/l NaCl, resuspended in SDS-PAGE buffer (Tris–HCl 62.5 mmol/l pH 6.8, glycerol 10%, SDS 2%, β-mercaptoethanol 5%) and heated at 100°C for 5 min. Protein A-sepharose beads were then pelleted by centrifugation and an aliquot of the supernatant fraction was analysed by SDS-PAGE in a 12% gel. The gel was dried and the 35S-methionine-labelled protein was revealed by autoradiography.

Transcobalamin in plasma

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Patients.
  5. Assays for serum B12 and TC.
  6. RNA/DNA extraction, DNA amplification, cloning and translation in the reticulocyte lysate system.
  7. Transfection studies in Cos cells.
  8. Metabolic radiolabelling of TC.
  9. Results
  10. Transcobalamin in plasma
  11. Genetic analysis
  12. Transfection studies
  13. Discussion
  14. References

Apo-TC levels were dramatically decreased in the three affected siblings (48, 24 and 56 pmol/l) whereas the unaffected members of the family with no signs of Cbl deficiency had borderline low apo-TC concentrations (median 359 pmol/l, range 310–423). In the affected siblings, holo-TC was detected at 6.6 and 11 pmol/l in two of them and was undetectable in the other sibling. In the healthy family members, the holo-TC median value was 31.5 pmol/l (range 18–70) (Table I). These results were confirmed by gel filtration chromatography of serum incubated with [57Co]Cbl where TC-bound Cbl was undetectable in the affected siblings but eluted as a major peak in asymptomatic family members.

Table I.  Transcobalamin levels and the genotype of the family with congenital transcobalamin deficiency.
PatientHolo-TC (pmol/l)Apo-TC (pmol/l)Gel filtration serumMutation
  1. ND, not detectable.

Index caseND 48TC not detectedHomozygote
Affected sister 111 24TC not detectedHomozygote
Affected sister 2 6.6 56TC not detectedHomozygote
Sister 327423TC presentHeterozygote
Brother41372TC presentHeterozygote
Sister 470310TC presentHeterozygote
Mother18342TC presentHeterozygote
Father36348TC presentHeterozygote
Control
 Mean61514  
 Range24–157350–1300  

Genetic analysis

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Patients.
  5. Assays for serum B12 and TC.
  6. RNA/DNA extraction, DNA amplification, cloning and translation in the reticulocyte lysate system.
  7. Transfection studies in Cos cells.
  8. Metabolic radiolabelling of TC.
  9. Results
  10. Transcobalamin in plasma
  11. Genetic analysis
  12. Transfection studies
  13. Discussion
  14. References

Reverse transcription-PCR of RNA extracted from normal fibroblasts and amplified with primers S2 (located in exon 3) and AS2 (located in exon 5), yielded a fragment with an expected size of 404 bp. Similar analysis of RNA from the patient's fibroblasts yielded a smaller fragment (Fig 1A) that, by DNA sequence determination, was missing 81 nucleotides in the 3′ end of exon 3. This deletion began with GT, which is known to be the consensus sequence of the donor splice site of introns. Next we examined the region around exon 3 in genomic DNA using reverse primer GTI in intron 3 and a forward primer DEL1 hybridizing to the 3′ end of intron 2. Amplification of genomic DNA using these primers yielded fragments of the same 312 bp size (Fig 1B). Sequencing of this fragment from the patient's DNA identified a mutation T[RIGHTWARDS ARROW]G at the donor splice site of intron 3 which forced the dinucleotide 347GT348 in exon 3 to be activated as a cryptic donor splice site. The resulting abnormal splicing yielded a truncated TC cDNA lacking the last 81 nucleotides in exon 3 but with a conserved reading frame. Genomic DNA extracted from whole blood drawn from all the family members was amplified with DEL1/GTI and sequenced. All affected siblings were homozygous for the mutation and asymptomatic family members (including the parents) were heterozygous.

image

Figure 1. Agarose gel electrophoresis and ethidium bromide staining of PCR products generated by RT-PCR of RNA extracted from cultured fibroblasts (A) and by genomic DNA amplification (B). (A) Transcobalamin (TC) fragment was generated using a forward primer (S2) located at the 5′ end of exon 3 and a reverse primer (AS2) located in exon 5. Lane 1, mutant TC; lane 2, normal TC. (B) TC fragment was generated using a forward primer (Del 1) located in exon 3 and a reverse primer (GTI) located in intron 3. Lane 1, mutant TC; lane 2, normal TC.

Download figure to PowerPoint

In vitro transcription and translation with the TNT® reticulocyte lysate system followed by immunoprecipitation of the product with a monospecific antiserum to TC and SDS-PAGE analysis, yielded a smaller size protein for the transcript generated from the mutant TC cDNA, a finding consistent with a 27 amino acid deletion (Fig 2).

image

Figure 2. SDS-PAGE analysis of an in vitro transcription-translation product of transcobalamin (TC) cDNA in pcDNA vector. The 35S-methionine labelled TC was immunoprecipitated with an antiserum to human TC, separated in a 10% gel and the proteins visualized by autoradiography. Lane 1, normal TC; lane 2, mutant TC with a 27 AA deletion.

Download figure to PowerPoint

Transfection studies

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Patients.
  5. Assays for serum B12 and TC.
  6. RNA/DNA extraction, DNA amplification, cloning and translation in the reticulocyte lysate system.
  7. Transfection studies in Cos cells.
  8. Metabolic radiolabelling of TC.
  9. Results
  10. Transcobalamin in plasma
  11. Genetic analysis
  12. Transfection studies
  13. Discussion
  14. References

Cos cells transfected with a pcDNA3 vector containing no target cDNA produced 0.5 nmol of TC/L, which was consistent with the amount of TC produced by these cells propagating in culture. However, Cos cells transfected with a plasmid containing the normal TC cDNA derived from CaCo-2 cells produced 30 nmol of TC/L of culture medium as quantified by the amount of [57Co]Cbl associated with a protein corresponding to the size of TC by gel filtration chromatography. Cos cells transfected with pcDNA3 containing the mutant TC cDNA failed to produce any additional TC other than the amount corresponding to the TC constitutively synthesized by these cells. These results were further confirmed by measuring the binding of [57Co]Cbl with the charcoal assay in culture medium and cell lysates, which showed increased binding in medium from cultures transfected with the plasmid containing the normal cDNA but not with the plasmid containing the mutant cDNA (Fig 3). No binding activity was found in the lysates of cells transfected with the normal TC cDNA, which is in agreement with TC being constitutively secreted into the extracellular compartment (Quadros et al, 1989). However, no TC was found in the cells transfected with mutant TC thus ruling out a defect in the secretory pathway as a likely cause for the lack of TC in the culture medium.

image

Figure 3. Binding of 57Co-Cbl in the culture medium and cell lysates of Cos cells transfected with pcDNA3 vector containing normal or mutant transcobalamin cDNA.

Download figure to PowerPoint

[35S]methionine radio-labelling, followed by immunoprecipitation with a polyclonal anti-TC antibody, identified TC in the culture medium of Cos cells transfected with the plasmid containing normal TC cDNA but no TC was detected in the medium of Cos cells transfected with the plasmid containing the mutant TC cDNA (Fig 4) and in addition, no [35S]methionine-labelled TC accumulated in the cells (data not shown).

image

Figure 4. SDS-PAGE analysis of immunoprecipitated 35S-methionine labelled transcobalamin (TC) in the culture medium of transfected Cos cells. Lane 1, not transfected; lane 2, pcDNA 3 containing normal TC cDNA and lane 3, pcDNA 3 containing mutant TC cDNA.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Patients.
  5. Assays for serum B12 and TC.
  6. RNA/DNA extraction, DNA amplification, cloning and translation in the reticulocyte lysate system.
  7. Transfection studies in Cos cells.
  8. Metabolic radiolabelling of TC.
  9. Results
  10. Transcobalamin in plasma
  11. Genetic analysis
  12. Transfection studies
  13. Discussion
  14. References

To date, the molecular basis of TC deficiency has only been reported in five patients and these reports have identified distinct mechanisms leading to TC deficiency. As TC deficiency is an autosomal recessive disease, both alleles must be mutated for the phenotype to be expressed. In one report, one affected child had an extensive deletion on one TC allele and a four-nucleotide deletion in the other, leading to a reading frame shift and a premature termination codon (Li et al, 1994a). Both the mutations caused TC mRNA and protein deficiency resulting in vitamin B12 cellular depletion. A second report described two children with nonsense mutations and single nucleotide deletions on both TC alleles resulting in a frameshift and premature termination (Li et al, 1994b). Both patients had undetectable TC mRNA and protein in their fibroblasts. More recently, two unrelated patients were described with the same TC deficiency phenotype, characterized by a full length TC transcript, and immunoreactive TC that did not bind [57Co]Cbl because of several mutations identified in the cDNA but not in the corresponding regions of the genomic DNA. These mutations were ascribed to RNA editing mechanisms and the authors showed that editing of the primary transcript can produce a non-functional protein and thus constitute another genetic mechanism of TC deficiency (Qian et al, 2002).

In this study, we describe three sisters with TC deficiency confirmed by the inability of the cultured fibroblasts to internalize Cbl without exogenously added TC (Bibi et al, 1999). In all three cases, a transversion (T[RIGHTWARDS ARROW]G) at the splice site in both TC alleles suppresses the wild-type donor splice site of intron 3. As a consequence, a cryptic splice site in exon 3 is activated which interacts with the acceptor splice site of intron 3 to produce an alternatively spliced transcript lacking 81 nucleotides. This in-frame deletion would yield a truncated protein that is 27 amino acids shorter than the normal TC (lacking residues from E99 to H126). Aberrant mRNA splicing because of mutations at splice junctions is a common cause of genetic disease (Brinkmann et al, 1991; Aminoff et al, 1999; Attanasio et al, 2003; Mine et al, 2003; Tanner et al, 2003) and accounts for approximately 15% of all point mutations; as many as 60% of these involve the G-T dinucleotide (Krawczak et al, 1992).

Three phenotypes of inherited TC deficiency have been identified: (1) absence of a functional or immunoreactive TC (Li et al, 1994a); (2) an immunologically crossreacting protein is detected but this protein does not bind Cbl (Seligman et al, 1980); (3) TC binds Cbl normally but the TC–Cbl complex does not bind to the membrane receptor (Haurani et al, 1979). The mutant TC described in this report was transcribed and translated normally in a cell-free system but when transfected into cultured cells, the protein was not secreted as evidenced by the lack of a functional or immunoreactive TC protein in the culture medium. This finding was in agreement with the sizeable decrease of TC in the serum of the three affected siblings and the inability of the fibroblasts from one affected sibling to secrete TC. This could happen if the mutant TC was sequestered in the cytoplasm because of a defect in intracellular protein routing. However, this seems unlikely because no TC was detected in the lysates of cells transfected with the mutant TC. The other possibility is that the mutant TC is unstable and is rapidly degraded in the cytoplasm. Many proteins, including cyclins and other regulators of the cell cycle and transcription factors, undergo proteolysis by the ubiquitin-proteasome pathway (Sommer & Wolf, 1997; Doherty et al, 2002). Proteasomes are involved in regulating the levels of physiological proteins (Boudjelal et al, 2000; Rui et al, 2001). They degrade natively disordered substrates (Liu et al, 2003) and truncated proteins (Emi et al, 2002). Therefore, a TC with a 27 amino acid deletion may present a misfolded configuration that renders it susceptible to degradation by the proteasome. It has been recently shown that disulphide bonds are critical for human TC function and stability. However, the six conserved cysteine residues are not equivalent in the context of intracellular folding and expression. Disruption of the C3–C249 disulphide bond seems to have no effect on the expression and function of TC. Disruption of disulphide bonds C98–C291 or C147–C187 results in the expression of a misfolded TC that is rapidly degraded by the proteosomal system (Kalra et al, 2003). The deletion of residues E99–H126 described here is in close proximity to C98. The resulting configuration may weaken the C98–C291 disulphide bond and affect the stability of TC thus promoting proteosomal degradation of the truncated protein.

In conclusion, this study describes a TC deficiency because of a mutation at a splice junction. A total of four genetic studies (including the present study) have now been reported in patients with TC deficiency and in all four, the gene defect was different, which emphasizes the genetic heterogeneity of the disease.

References

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Patients.
  5. Assays for serum B12 and TC.
  6. RNA/DNA extraction, DNA amplification, cloning and translation in the reticulocyte lysate system.
  7. Transfection studies in Cos cells.
  8. Metabolic radiolabelling of TC.
  9. Results
  10. Transcobalamin in plasma
  11. Genetic analysis
  12. Transfection studies
  13. Discussion
  14. References
  • Aminoff, M., Carter, J.E., Chadwick, R.B., Johnson, C., Gräsbeck, R., Abdelaal, M.A., Broch, H., Jenner, L.B., Verroust, P.J., Moestrup, S.K., De La Chapelle, A. & Krahe, R. (1999) Mutations in CUBN, encoding the intrinsic factor-vitamin B12 receptor, cubilin, cause hereditary megaloblastic anaemia 1. Nature Genetics, 21, 309313.
  • Attanasio, C., David, A. & Neerman-Arbez, M. (2003) Outcome of donor splice site mutations accounting for congenital afibrinogenemia reflects order of intron removal in the fibrinogen alpha gene (FGA). Blood, 101, 18511856.
  • Benhayoun, S., Adjalla, C., Nicolas, J.P., Guéant, J.L. & Lambert, D. (1993) Method for the direct specific measurement of vitamin B12 bound to transcobalmin II in plasma. Acta Haematologica, 89, 195199.
  • Bibi, H., Gelman-Kohan, Z., Baumgartner, E.R. & Rosenblatt, D.S. (1999) Transcobalamin II deficiency with methylmalonic aciduria in three sisters. Journal of Inherited Metabolic Disease, 22, 765772.
  • Boudjelal, M., Wang, Z., Voorhees, J.J. & Fisher, G.J. (2000) Ubiquitin/proteasome pathway regulates levels of retinoic acid receptor γ and retinoid X receptor α in human keratinocytes. Cancer Research, 60, 22472252.
  • Brinkmann, A.O., Kuiper, G.G., Ris-Stalpers, C., van Rooij, H.C., Romalo, G., Trifiro, M., Mulder, E., Pinsky, L., Schweikert, H.U. & Trapman, J. (1991) Androgen receptor abnormalities. Journal of Steroid Biochemistry and Molecular Biology, 40, 349352.
  • Chanarin, I. (1979) Biochemistry of cobalamins. In: Megaloblastic Anaemias,pp. 421. Blackwell Scientific, Oxford, UK.
  • Cooper, B.A. & Rosenblatt, D.S. (1987) Inherited defects of vitamin B12 metabolism. Annual Review of Nutrition, 7, 291320.
  • Djalali, M., Guéant, J.L., Lambert, D., El Kholty, S., Saunier, M. & Nicolas, J.P. (1990) High-performance liquid chromatographic separation and dual competitive binding assay of corrinoids in biological material. Journal of Chromatography, 529, 8191.
  • Doherty, F.J., Dawson, S. & Mayer, R.J. (2002) The ubiquitin-proteasome pathway of intracellular proteolysis. Essays in Biochemistry, 38, 5163.
  • Emi, Y., Omura, S., Ikushiro, S. & Iyanagi, T. (2002) Accelerated degradation of mislocalized UDP-glucuronosyltransferase family 1 (UGT1) proteins in Gunn rat hepatocytes. Archives of Biochemistry and Biophysics, 405, 163169.
  • Fowler, B. (1998) Genetic defects of folate and cobalamin metabolism. European Journal of Pediatrics, 157(Suppl. 2), S60S66.
  • Gottlieb, C., Lau, K.S., Wasserman, L.R. & Herbert, V. (1965) Rapid charcoal assay for intrinsic factor gastric juice unsaturated B12 binding capacity, antibody to IF serum and serum unsaturated B12 binding capacity. Blood, 25, 875884.
  • Hakami, N., Neiman, P.E., Canellos, G.P. & Lazerson, J. (1971) Neonatal megaloblastic anaemia due to inherited transcobalamin II deficiency in two siblings. New England Journal of Medicine, 285, 11631170.
  • Hall, C.A. (1992) The neurologic aspects of transcobalamin II deficiency. British Journal of Haematology, 80, 117120.
  • Haurani, F.I., Hall, C.A. & Rubin, R. (1979) Megaloblastic anaemia as a result of an abnormal transcobalamin II (Cardeza). Journal of Clinical Investigation, 64, 12531259.
  • Jacob, E., Wrong, K.J.T. & Herbert, V. (1977) A simple method for the separate measurement of transcobalamins I, II and III: normal ranges in serum and plasma in men and women. Journal of Laboratory Medicine, 89, 11451152.
  • Kaikov, Y., Wadsworth, L., Hall, C. & Rogers, P.C.J. (1991) Transcobalamin II case report and review of literature. European Journal of Paediatrics, 150, 841843.
  • Kalra, S., Li, N., Seetharam, S., Alpers, D.H. & Seetharam, B. (2003) Function and stability of human transcobalamin II: role of intramolecular disulfide bonds, C98-C291 and C147-C187. American Journal of Cell Physiology, 285, C150C160.
  • Krawczak, M., Reiss, J. & Cooper, D.N. (1992) The mutational spectrum of single base-pair substitutions in mRNA splice junctions of human genes: causes and consequences. Human Genetics, 90, 4154.
  • Li, N., Rosenblatt, D.S., Kamen, B.A., Seetharam, S. & Seetharam, B. (1994a) Identification of two mutant alleles of transcobalamin II in an affected family. Human Molecular Genetics, 3, 18351840.
  • Li, N., Rosenblatt, D. & Seetharam, B. (1994b) Nonsense mutation in human transcobalamin II deficiency. Biochemical and Biophysical Research Communications, 204, 11111118.
  • Liu, C.W., Corboy, M.J., DeMartino, G.N. & Thomas, P.J. (2003) Endoproteolytic activity of the proteasome. Science, 299, 408411.
  • Mine, M., Brivet, M., Touati, G., Grabowski, P., Abitbol, M. & Marsac, C. (2003) Splicing error in E1 alpha dehydrogenase mRNA caused by novel intronic mutation responsible for lactic acidosis and mental retardation. Journal of Biological Chemistry, 278, 1176811772.
  • Namour, F., Olivier, J.L., Abdelmoutalleb, I., Adjalla, C., Debard, R., Salvat, C. & Guéant, J.L. (2001) Transcobalamin codon 259 polymorphism in HT629 and Caco-2 cells and in Caucasians: relation to transcobalamin and homocystein concentration in blood. Blood, 97, 10921098.
  • Nexo, E. (1998) Cobalamin binding proteins. In: Vitamin B12 and B12 Proteins (ed. by B.Kräutler, D.Arigoni & B.T.Golding), pp. 461476. Wiley–VCH, Weinheim.
  • Qian, L., Quadros, E.V., Regec, A., Zittoun, J. & Rothenberg, S.P. (2002) Congenital transcobalamin II deficiency due to errors in RNA editing. Blood, Cells, Molecules and Diseases, 28, 134142.
  • Quadros, E.V., Matthews, D.M., Hoffbrand, A.V. & Linnell, J.C. (1976) Synthesis of cobalamin coenzymes by human lymphocytes in vitro and the effect of folates and metabolic inhibitors. Blood, 48, 609619.
  • Quadros, E.V., Rothenberg, S.P. & Jaffe, E.A. (1989) Endothelial cells from human umbilical vein secrete functional transcobalamin II. American Journal of Physiology, 256, C296C303.
  • Rothenberg, S.P. & Quadros, E.V. (1995) Transcobalamin II and the membrane receptor for the transcobalamin II–cobalamin complex. In: Clinical Haematology: Megaloblastic Anaemia (ed. by S.N. Wickramasinghe), pp. 499514. Baillière Tindal, London, UK.
  • Rui, L., Fisher, T.L., Thomas, J. & White, M.F. (2001) Regulation of insulin/insulin-like growth factor-1 signaling by proteasome-mediated degradation of insulin receptor substrate-2. Journal of Biological Chemistry, 276, 4036240367.
  • Seligman, P.A., Steiner, L.L. & Allen, R.H. (1980) Studies of a patient with megaloblastic anaemia and an abnormal transcobalamin II. New England Journal of Medicine, 303, 12091212.
  • Sommer, T. & Wolf, D.H. (1997) Endoplasmic reticulum degradation: reverse protein flow of no return. Faseb Journal, 11, 12271233.
  • Tanner, S.M., Aminoff, M., Wright, F.A., Liyanarachchi, S., Kuronen, M., Saarinen, A., Massika, O., Mandel, H., Broch, H. & La Chapelle de A. (2003) Amnionless, essential for mouse gastrulation, is mutated in recessive hereditary megaloblastic anaemia. Nature Genetics, 33, 426429.
  • Ulleland, M., Eilertsen, I., Quadros, E.V., Rothenberg, S.P., Fedosov, S.N., Sundrehagen, E. & Örning, L. (2002) Direct assay for cobalamin bound to transcobalamin (holo-transcobalamin) in serum. Clinical Chemistry, 48, 526532.