SEARCH

SEARCH BY CITATION

Keywords:

  • Kawasaki disease;
  • leucocytes;
  • MMP-9

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. References

Matrix metalloproteinases (MMPs) play an important role in the progression of tumour cells and the invasion of inflammatory cells by degrading the extracellular matrix. In the MMP family, MMP-9 gelatinase is thought to contribute to the pathogenesis of inflammatory arteritis by disrupting the elastic lamina. The aim of the present study is to investigate the potential role of MMP-9 in Kawasaki disease (KD), an acute type of systemic vasculitis in children. We studied the total levels of MMP-9 (free proMMP-9 and free MMP-9) in the sera using a new assay system and the expression of MMP-9 mRNA in the leucocytes using reverse transcription-polymerase chain reaction in 18 patients with KD, 10 patients with sepsis and 10 healthy children (HC). The serum MMP-9 levels were significantly higher (P < 0·01) in the acute phase of KD than in the acute phase of sepsis and HC. In the time course of KD, the serum MMP-9 levels decreased significantly (P < 0·01) from the subacute through the convalescent phases. In the acute phase of KD, the serum MMP-9 levels showed a significantly positive correlation (P < 0·05) with the circulating leucocyte counts, especially the neutrophil counts. Furthermore, the expression of MMP-9 mRNA in the circulating leucocytes increased in the acute phase of KD and decreased from the subacute through the convalescent phases. These findings indicate that an excessive amount of MMP-9 is present in the plasma during the acute phase of KD, thus suggesting that circulating leucocytes may be a source of the MMP-9 secreted into the circulation.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. References

Matrix metalloproteinases (MMPs), a family of enzymes produced by a variety of cell types, have the ability to degrade the extracellular matrix [1,2]. The overexpression and activation of MMPs thus induce tissue destruction and are also associated with a number of specific diseases including rheumatoid arthritis, periodontal disease, cancer and atherosclerosis [1–3]. Most of MMPs cleave several types of matrix components and can degrade overlapping substrates such as collagen, fibronectin and laminin. In the MMP family, two gelatinases, MMP-2 (72 kDa form) and MMP-9 (92 kDa form), have a unique elastinolytic activity [4,5]. In vascular lesions, the disintegration of arterial elastic lamella and basement membranes by proteolytic enzymes may play an important role in arterial stability, excessive cell migration and proliferation. MMP-9 is thought to be involved in the pathogenesis of inflammatory vascular diseases such as giant cell arteritis [6] and temporal arteritis by degrading the internal elastic lamina [7]. Although this enzyme is produced by various types of cells, cytokine-activated leucocytes such as monocytes and neutrophils are major producers of this enzyme [8,9]. MMP-9 is secreted in a precursor form (proMMP-9), which can be converted to an active form by p-aminophenylmercuric acetate (APMA) in vitro or by proteinases in vivo[10].

The activity of MMPs is controlled by the tissue inhibitors of metalloproteinases (TIMPs) in vivo[1,2]. The imbalance between MMPs and TIMPs is considered to be important in the degenerative process. The activity of proMMP-9 and MMP-9 is inhibited by the binding of TIMP-1 and TIMP-2 in a 1 : 1 molar ratio [10]. Although the MMP-9 proteolytic activity has been detected by a nonquantitative method known as zymography [11], Verheijen et al. [12] developed a new assay system which converts total serum MMP-9 protein into the active form of MMP-9. Although APMA used in the present study can activate free proMMP-9 to the active form of MMP-9, proMMP-9/TIMP-1 complex is not activated by APMA [10]. The total levels of serum MMP-9 (free proMMP-9 and MMP-9 forms) can thus be detected in this assay.

Kawasaki disease (KD) is a multi-systemic type of vasculitis including coronary involvement [13]. Although its aetiology is still unknown, treatment with intravenous immunoglobulin (IVIG) is generally effective [14]. Immunological abnormalities during the acute phase of KD are characterized by a marked activation of the immune system: the functional activation of neutrophils and monocytes and an excessive production of such inflammatory mediators as cytokines (IL-1, IFN-γ and TNF-α), proteases (neutrophil elastase and myeloperoxidase) and toxic oxygen radicals [15–18]. These mediators are believed to be involved in the vascular lesions of the disease. Pathological studies demonstrated the infiltration of neutrophils and monocytes and the destruction of the intimal elastic lamina in the coronary artery lesions of KD [19,20]. We thus hypothesized that activated neutrophils and monocytes in the circulation produce a large amount of MMP-9, migrate into vascular lesions due to a breakdown of the basement membranes, and may be involved in the pathogenesis of KD vasculitis. Since MMP-9 originally exhibits its gelatinolytic activity in local lesions, it remains unclear as to whether the serum MMP-9 levels may reflect the local activity in vascular tissue in vivo. However, if the circulating leucocytes secrete an excessive amount of MMP-9 which thus results in its migration into vascular tissue, the serum MMP-9 levels are considered to increase in the acute phase of KD. We studied herein the serum MMP-9 levels using a new assay system [12] and also investigated the expression of MMP-9 mRNA using reverse transcription-polymerase chain reaction (RT-PCR).

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. References

Patients and sample preparations

We studied 18 patients with KD, 10 patients with sepsis and 10 healthy children (HC). The patient profiles are shown in Table 1. All patients were hospitalized at the National Defense Medical College Hospital between May 1998 and July 2000. The KD patients were enrolled within 7 days of the onset of illness, with day 1 defined as the first day of fever, and all 18 met the diagnostic criteria for KD as established by the Japanese Kawasaki Disease Research Committee [21]. All patients were scheduled to receive both aspirin (30 mg/kg/day) and intravenous immunoglobulin (i.v. IG, 1 g/kg or 2 g/kg). No patients had a coronary aneurysm. Serial blood samples were obtained from all KD patients in the acute phase (before i.v. IG therapy on days 3–7), in the afebrile subacute phase (after completing i.v. IG therapy on days 9–13), and in the convalescent phase (days 21–35), when the C-reactive protein (CRP) of each patient was < 0·3 mg/dl. The sepsis group included six patients with Gram-negative sepsis (two with Escherichia coli and four with Haemophilus influenzae), and four patients with Gram-positive sepsis (Streptococcus pneumoniae in all). All these organisms were isolated from blood cultures. Blood samples were obtained from all sepsis patients in the acute phase during the febrile period. The HC group consisted of 10 healthy children serving as controls. Informed consent was obtained from the parents of all children. All serum samples were stored at − 70°C until analysed. The peripheral blood leucocytes (mononuclear cells and neutrophils) were immediately isolated by density gradient centrifugation using a Mono-Poly Resolving Medium, and were then washed with PBS containing 1% bovine serum albumin (BSA).

Table 1.  Patient characteristics and laboratory findings
 KDSepsisHealthy children (HC)
  • *

    P < 0·05 versus HC.

Number181010
Median age20 months18 months21 months
(range)(3 months−6 years)(1–24 months)(3 months−4 years)
Male/female10/85/55/5
WBC (/µl)14226 ± 1009*16040 ± 1623*6978 ± 394
Neutrophils (/µl)10931 ± 991*11982 ± 1078*3892 ± 368
Monocytes (/µl)602 ± 96*715 ± 91*354 ± 43
CRP (µg/dl)10·6 ± 1·4*12·9 ± 3·9*< 0·3

Assay for MMP-9 activity

The MMP-9 levels (free proMMP-9 and free MMP-9) in the sera were measured by the MMP-9 activity assay system [12] (Amersham Pharmacia Biotech Inc., Piscataway, NJ, USA). Briefly, diluted samples and free proMMP-9 as the standard were added to an anti-MMP-9-coated 96-well microplate, followed by incubation at 4°C overnight. After washing all wells four times, APMA was added and incubated at 37°C for 2 h, to convert free proMMP-9 to an active form MMP-9. The natural activation sequence in the prodetection enzyme was replaced using protein engineering, with an artificial sequence recognized by specific MMP-9, based on information provided by the manufacturers of this kit. After the modified prodetection reagent in 50 mm Tris HCL pH 7·6 was added to each well, the prodetection enzyme was activated by the active MMP-9 through a single proteolytic event. The MMP-9-activated detection enzyme was then measured using a chromogenic peptide substrate. The resultant colour was read at 405 nm in a microtitre plate spectrophotometer. After the standard curve was generated by plotting the absorbance405 against the standard of free proMMP-9 (ng/ml), the concentration of the active MMP-9 levels in the samples was determined by interpolating their absorbance405 values using a standard curve.

Reverse transcription-polymerase chain reaction (RT-PCR) of MMP-9 mRNA

The total RNA was extracted from the isolated mononuclear cells and neutrophils (104 cells) with the acid guanidium thiocyanate–phenol–chloroform method (Isogen kit, Nippon Gene, Toyama, Japan). First-strand cDNA was generated from the RNA samples using Ready-to-GoTM You-Prime First-Strand Beads (Pharmacia Biotech, Uppsala, Sweden). Two pairs of oligonucleotides primers were prepared for human MMP-9-specific sequences (sense: 5′ CGCAGACATCGTCATCCAGT 3′, antisense: 5′ GGATTGGC CTTGGAAGATGA 3′) [22] and (β−actin-specific sequences (sense: 5′ AACTGGGACGACATGGAGAA 3′, antisense: 5′ ATACCCCTCGTAGATGGGCA 3′) [23]. Semi-quantitative PCR was carried out with 1 μl of cDNA, 1 unit of Taq polymerase, 0·4 mm dNTP and 20 pmol of each 3′ and 5′ primers in the PCR buffer (total volume of 50 (L). Each sample was then subjected to 30 cycles of amplification consisting of 1-min denaturation at 94°C, 2-min primer annealing at 62°C and 3-min extension at 72°C. The PCR products were separated by 1·5% agarose and the gels were viewed by UV transillumination.

Statistical analysis

All data are expressed as the mean ± s.e. Any differences between the acute and convalescent phases in the same group were assessed by the Wilcoxon signed-rank test. Intergroup differences were analysed with the Mann–Whitney test. A P-value less than 0·05 was considered to be significant.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. References

Patient profiles and the laboratory findings

The laboratory findings in three groups (KD, sepsis and HC) are shown in Table 1. The mean counts of white blood cells (WBC), neutrophils and monocytes and mean CRP levels were significantly higher in the patients with KD and sepsis than in HC. However, no significant differences in these data were shown between the KD and sepsis groups.

MMP-9 levels in serum

The serum levels of MMP-9 were measured in the acute phases of KD and sepsis and HC (Fig. 1). The mean level of measured MMP-9 was significantly higher in the acute phase of KD (235·5 ± 38·1 ng/ml) than in the acute phase of sepsis (110·7 ± 35·6 ng/ml) and HC (40·8 ± 12·9 ng/ml).

image

Figure 1. Serum levels of MMP-9 in the KD, sepsis and HC groups.*, P < 0·01; **, P < 0·05. The horizontal bars indicate the means.

The time-course of serum MMP-9 levels in KD

The MMP-9 levels in the serum were measured in the time-course of KD (Fig. 2). The mean level of serum MMP-9 in the acute phase decreased significantly (P < 0·01) from the subacute (after i.v. IG therapy, 67·1 ± 17·4 ng/ml) through the convalescent phases (10·2 ± 4·8 ng/ml).

image

Figure 2. The time course of the serum MMP-9 levels in KD.*P < 0·01. The horizontal bars indicate the mean values.

Correlation between the serum MMP-9 levels and the laboratory data in the acute phase of KD

In the acute phase of KD, the serum levels of MMP-9 showed a significant correlation with the WBC counts (r = 0·488, P < 0·05) and the neutrophil counts (r = 0·549, P < 0·05), but not with the monocyte counts (r = 0·166, P = 0·51) and CRP levels (r = 0·067, P = 0·786) (Fig. 3). When TNF-α levels were measured in 12 of 18 KD patients, no significant correlation was seen between the serum MMP-9 and TNF-α levels. There were no significant correlations between the serum MMP-9 levels and either the WBC or the neutrophil counts in sepsis, subacute KD and convalescent KD.

image

Figure 3. Correlation between the serum MMP-9 levels and laboratory values (WBC, neutrophil, monocyte counts and CRP levels) in the acute phase of KD. Solid lines indicate the linear regression lines.

MMP-9 mRNA expression in circulating leucocytes from KD patients

Figure 4 demonstrates the profile of RT-PCR for representative cases of KD. The circulating leucocytes expressed an increased level of MMP-9 mRNA in the acute phase of KD. However, the expression level decreased from the subacute through the convalescent phases.

image

Figure 4. MMP-9 mRNA expression in the circulating leucocytes during the clinical course of KD.RT-PCR products using primers specific for MMP-9 and β-actin are displayed for three patients with KD. A, acute; S, subacute; C, convalescent; M, a molecular weigh marker (100 bp ladder).

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. References

In the present study, the mean level of the serum MMP-9 was significantly higher in the acute phase of KD than in the acute phase of sepsis and HC. In the time-course of KD, the serum MMP-9 levels decreased significantly from the subacute through the convalescent phases. The serum MMP-9 levels showed a significant correlation with the circulatory WBC and neutrophil counts. The expression of MMP-9 mRNA in the circulating leucocytes increased in the acute phase of KD and decreased from the subacute through the convalescent phases.

MMPs play an important role in the immune response of inflammatory lesions associated with extracellular matrix degradation. MMP-9 is a member of the MMP family enzymes which can degrade a variety of extracellular matrix components. Previous reports demonstrated that serum MMP-9 titres, as measured by antigenic ELISA, increased in patients with rheumatoid arthritis [24] and giant cell arteritis [6]. However, the serum antigenic levels of MMP-9 may not always reflect its potential activity, because the MMP-9 activity is known to be inhibited by binding to TIMPs [2]. The MMP/TIMP ratio has been proposed to be an indicator of the inflammatory process in several diseases [1,2]. In the present study, we measured directly the serum levels of free proMMP-9 and MMP-9 using a new assay system, which is specific and semiquantitative and can be applied to determine by assay the levels of active MMP-9 [12]. The results revealed that the serum MMP-9 levels increased more in the acute phase of KD than in either the acute phase of sepsis or healthy children. In addition, it also decreased from the subacute through the convalescent phases. These findings indicate that certain cells secrete a large and excessive amount of MMP-9 into the circulation during the acute phase of KD.

In the present study, a significant positive correlation was observed between the serum levels of MMP-9 and the circulating leucocyte counts, especially the neutrophil counts. Furthermore, the kinetics of the MMP-9 mRNA expression of circulating leucocytes was similar to that of the measured MMP-9 levels. The circulating leucocytes are thus considered to be one of the sources of elevated MMP-9 production in KD serum. MMPs secreted from leucocytes are thought to be involved in the migration of these cells through the basement membrane by ensuring the destruction of connective tissue [1,2]. MMP-9 is also reported to play a pivotal role in facilitating the extravasation and migration of neutrophils by breaking down the basement membrane [25]. The MMP-9 expression was located in the macrophages of the vascular lesions in patients with temporal arthritis, based on the findings of an immunohistochemical study [7]. Pathological observations revealed that neutrophils infiltrate cardiovascular lesions in the early stage of KD, followed by the infiltration of numerous lymphocytes and monocytes [19,20]. The circulating leucocytes from acute KD patients are also reported to produce large amounts of TNF-α[16] and elastase [17], which are thought to be associated with endothelial cell injury [26,27]. In particular, the elastase [17] and MMP-9 levels in serum were significantly higher in acute KD than in acute sepsis. Patients with sepsis generally have microvascular injury, but do not have panvasculitis including a split elastic lamina in a relatively large muscular artery which can often be seen in acute KD [19,20]. As a result, these proteases may play an important role in the vascular destruction of KD. Therefore, circulating leucocytes may injure endothelial cells and also migrate into the vascular wall, by producing an excessive amount of inflammatory mediators such as elastase, MMP-9 and TNF-α, and are thus suggested to contribute to the pathogenesis of KD vasculitis. To further elucidate the involvement of MMP-9 in KD vasculitis, a comparison of the serum MMP-9 levels between KD patients with and those without coronary artery lesions in a multicentre study and also an immunohistochemical study to better clarify the local MMP-9 activity are therefore called for in the future.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. References
  • 1
    Birkedal-Hansen H, Moore WG, Bodden MK et al. Matrix metalloproteinases: a review. Crit Rev Oral Biol Med 1993; 4:197250.
  • 2
    Guedez L, Lim MS, Stetler-Stevenson WG. The role of metalloproteinases and their inhibitors in hematological disorders. Crit Rev Oncog 1996; 7:20525.
  • 3
    Stetler-Stevenson WG, Liotta LA, Kleiner DE Jr. Extracellular matrix 6: role of matrix metalloproteinases in tumor invasion and metastasis. FASEB J 1993; 7:143441.
  • 4
    Katsuda S, Okada Y, Okada Y, Imai K, Nakanishi I. Matrix metalloproteinase-9 (92-kd gelatinase/type IV collagenase equals gelatinase B) can degrade arterial elastin. Am J Pathol 1994; 145:120818.
  • 5
    Okada Y, Morodomi T, Enghild JJ et al. Matrix metalloproteinase 2 from human rheumatoid synovial fibroblasts. Purification and activation of the precursor and enzymic properties. Eur J Biochem 1990; 194:72130.
  • 6
    Sorbi D, French DL, Nuovo GJ, Kew RR, Arbeit LA, Gruber BL. Elevated levels of 92-kd type IV collagenase (matrix metalloproteinase 9) in giant cell arteritis. Arthritis Rheum 1996; 39:174753.
  • 7
    Nikkari ST, Hoyhtya M, Isola J, Nikkari T. Macrophages contain 92-kd gelatinase (MMP-9) at the site of degenerated internal elastic lamina in temporal arteritis. Am J Pathol 1996; 149:142733.
  • 8
    Zhang Y, McCluskey K, Fujii K, Wahl LM. Differential regulation of monocyte matrix metalloproteinase and TIMP-1 production by TNF-alpha, granulocyte-macrophage CSF, and IL-1 beta through prostaglandin-dependent and -independent mechanisms. J Immunol 1998; 161:30716.
  • 9
    Pugin J, Widmer MC, Kossodo S, Liang CM, Preas HL II, Suffredini AF. Human neutrophils secrete gelatinase B in vitro and in vivo in response to endotoxin and proinflammatory mediators. Am J Respir Cell Mol Biol 1999; 20:45864.
  • 10
    Ogata Y, Itoh Y, Nagase H. Steps involved in activation of the pro-matrix metalloproteinase 9 (progelatinase B)-tissue inhibitor of metalloproteinases-1 complex by 4-aminophenylmercuric acetate and proteinases. J Biol Chem 1995; 270:1850611.DOI: 10.1074/jbc.270.31.18506
  • 11
    Ferry G, Lonchampt M, Pennel L, De Nanteuil G, Canet E, Tucker GC. Activation of MMP-9 by neutrophil elastase in an in vivo model of acute lung injury. FEBS Lett 1997; 402:1115.DOI: 10.1016/s0014-5793(96)01508-6
  • 12
    Verheijen JH, Nieuwenbroek NM, Beekman B et al. Modified proenzymes as artificial substrates for proteolytic enzymes: colorimetric assay of bacterial collagenase and matrix metalloproteinase activity using modified pro-urokinase. Biochem J 1997; 323:6039.
  • 13
    Kawasaki T. Acute febrile mucocutaneous syndrome with lymphoid involvement with specific desquamation of the fingers and toes in children. Clinical observation of 50 cases. Jpn J Allergy 1967; 16:178222.
  • 14
    Newburger JW, Takahashi M, Beiser AS et al. A single intravenous infusion of gamma globulin as compared with four infusions in the treatment of acute Kawasaki syndrome. N Engl J Med 1991; 324:16339.
  • 15
    Leung DYM, Cotran RS, Kurt-Jone E, Burns JC, Newburger JW, Pober JS. Endothelial cell activation and high interleukin-1 secretion in the pathogenesis of acute Kawasaki disease. Lancet 1989; 2:1298302.
  • 16
    Matsubara T, Furukawa S, Yabuta K. Serum levels of tumor necrosis factor, interleukin 2 receptor, and interferon-γ in Kawasaki disease involved coronary-artery lesions. Clin Immunol Immunopathol 1990; 56:2936.
  • 17
    Takeshita S, Nakatani K, Kawase H et al. The role of bacterial lipopolysaccharide-bound neutrophils in the pathogenesis of Kawasaki disease. J Infect Dis 1999; 179:50812.DOI: 10.1086/314600
  • 18
    Niwa Y & Sohmiya K. Enhanced neutrophilic function in mucocutaneous lymph node syndrome, with special reference to the possible role of increased oxygen intermediate generation in the pathogenesis of coronary thromboarteritis. J Pediatr 1984; 104:5660.
  • 19
    Amano S, Hazama F, Kubagawa H, Tasaka K, Haebara H, Hamashima Y. General pathology of Kawasaki disease. On the morphological alterations corresponding to the clinical manifestations. Acta Pathol Jpn 1980; 30:68194.
  • 20
    Naoe S, Shibuya K, Takahashi K, Wakayama M, Masuda H, Tanaka M. Pathological observation concerning the cardiovascular lesions in Kawasaki disease. Cardiol Young 1991; 1:21220.
  • 21
    Japan Kawasaki Disease Research Committee. Diagnostic guidelines of Kawasaki disease, 4th edn, revised. Tokyo, Japan: Kawasaki Disease Research Committee, 1984.
  • 22
    Konttinen YT, Ainola M, Valleala H et al. Analysis of 16 different matrix metalloproteinases (MMP-1 to MMP-20) in the synovial membrane: different profiles in trauma and rheumatoid arthritis. Ann Rheum Dis 1999; 58:6917.
  • 23
    Takeshita S, Kawase H, Yamamoto M, Fujisawa T, Sekine I, Yoshioka S. Increased expression of human 63-kD heat shock protein gene in Kawasaki disease determined by quantitative reverse transcription-polymerase chain reaction. Pediatr Res 1994; 35:17983.
  • 24
    Gruber BL, Sorbi D, French DL et al. Markedly elevated serum MMP-9 (gelatinase B) levels in rheumatoid arthritis: a potentially useful laboratory marker. Clin Immunol Immunopathol 1996; 78:16171.DOI: 10.1006/clin.1996.0025
  • 25
    Delclaux C, Delacourt C, D'Ortho MP, Boyer V, Lafuma C, Harf A. Role of gelatinase B and elastase in human polymorphonuclear neutrophil migration across basement membrane. Am J Respir Cell Mol Biol 1996; 14:28895.
  • 26
    Smedly LA, Tonnesen MG, Sandhaus RA et al. Neutrophil-mediated injury to endothelial cells. Enhancement by endotoxin and essential role of neutrophil elastase. J Clin Invest 1986; 77:123343.
  • 27
    Pober JS. Activation and injury of endothelial cells by cytokines. Pathol Biol (Paris) 1998; 46:15963.