SEARCH

SEARCH BY CITATION

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Background

Bacterial transfer-messenger RNA (tmRNA, 10Sa RNA) is involved in a trans-translation reaction which contributes to the degradation of incompletely synthesized peptides and to the recycling of stalled ribosomes. However, its physiological role in the cell remains elusive. In this study, an efficient system for controlling the expression of the gene for tmRNA (ssrA), as well as a tmRNA gene-defective strain (ssrA::cat), were constructed in Bacillus subtilis. The effects of tmRNA on the growth of the cells were investigated under various physiological culture conditions using these strains.

Results

The cells were viable in the absence of ssrA expression under the usual culture conditions. However, the growth rate of cells without tmRNA expression, relative to that of the expressed cells, decreased with elevating temperature (> 45 °C), and at 52 °C, the highest temperature for growth of the wild-type, cells grew depending on the expression level of tmRNA. Furthermore, the transcription level of the ssrA from the authentic promoter at a high temperature (51 °C) was about 10-fold higher than that at a lower temperature (37 °C). tmRNA-dependent growth and an increase in tmRNA amount were also observed in cells under other stresses, such as high concentrations of ethanol or cadmium chloride. It is also shown that alanylated tmRNA rather than tmRNA-mediated proteolysis is required for growth at high temperature.

Conclusion

The expression of tmRNA gene (ssrA) is required for the efficient growth of B. subtilis under several strong stresses. The transcription of ssrA increases under several stressful conditions, suggesting that it is a stress-response gene. Alanyl-tmRNA, probably via its ability of recycling stalled ribosomes via trans-translation, is involved in the stress tolerance of bacteria.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Bacterial tmRNA (transfer-messenger RNA, also known as 10Sa RNA or SsrA RNA) contains both a tRNA-like structure in the 5′- and 3′-end sequences and an internal reading frame encoding a ‘tag’ peptide ( Komine et al. 1994 ; Ushida et al. 1994 ; Tu et al. 1995 ). It has been shown that tmRNA is employed in a trans-translation reaction process to add a C-terminal peptide tag to the incomplete nascent protein product translated from a broken mRNA lacking a stop codon ( Keiler et al. 1996 ; Himeno et al. 1997 ). The tag is the target for specific proteases ( Keiler et al. 1996 ; Gottesman et al. 1998 ; Herman et al. 1998 ). Therefore, tmRNA plays crucial roles in the degradation of incompletely synthesized peptides and in the recycling of stalled ribosomes (reviewed in Muto et al. 1996 , 1998). The wide distribution of tmRNA in the eubacterial kingdom also suggests its importance for the cell ( Williams 1999). However, mutant Escherichia coli cells defective in the structure gene for tmRNA (ssrA) are viable under usual culture conditions, showing that tmRNA is not essential for cell growth ( Oh & Apirion 1991; Kirby et al. 1994 ; Komine et al. 1994 ; Tu et al. 1995 ). Thus, the precise physiological roles of tmRNA and trans-translation remain elusive.

In the present study, we constructed an inducible system of ssrA in B. subtilis strain AMHG in order to investigate the physiological roles of tmRNA. A system for establishing the inducible gene expression in B. subtilis using the Escherichia coli lac repressor gene (lacI) and a hybrid promoter-operator (spac-I) has been developed ( Yasura & Henner 1984; Henner 1990; Vagner et al. 1998 ). Using this system, the authentic promoter of ssrA was replaced by an inducible spac promoter (Pspac) so as to regulate the expression level of tmRNA in the cell. Several mutant strains defective in ssrA or in any of the specific functions of tmRNA were also constructed. The effects of tmRNA on the growth of the cells were investigated under various physiological culture conditions. The results showed that the presence of tmRNA is required for efficient growth under several strong stresses.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Construction of induction system for tmRNA

To control the expression of the tmRNA gene (ssrA) in B. subtilis strain AMHG, the authentic promoter of ssrA was replaced by an isopropylthio-β-galactoside (IPTG)-inducible spac-promoter-operator (Pspac), and the lacI gene was introduced in the chromosome according to the methods of Vagner et al. (1998 ) ( Fig. 1a). The constructed strain, designated as L1 (Pspac-ssrA), was cultured in LB-medium at 37 °C with different amounts of the inducer IPTG, and the tmRNA levels (relative to total RNA) were measured by Northern hybridization. As shown in Fig. 1b, no tmRNA was detected in the total RNA fraction prepared from L1 cells cultured without IPTG induction. The level of tmRNA in L1 cells without induction was less than 1/250 of that in fully induced cells (with 500 μm IPTG), as estimated by Northern hybridization with serially diluted RNA samples (data not shown). The amounts of tmRNA increased with increasing amounts of IPTG, and reached the fully induced level, which is about one-third the amount of that in the parental AMHG strain. We also constructed an ssrA-defective mutant (D1:ΔssrA), in which no tmRNA was detected by Northern hybridization ( Fig. 1b).

image

Figure 1 (a) Integration of pMUTIN-3′ΔssrA plasmid DNA into the B. subtilis genomic DNA. The shaded region corresponds to the plasmid DNA. Arrows show the directions of transcription of the genes. (b) Induction of tmRNA synthesis by IPTG. The integrated strain L1(Pspac-ssrA) was cultured in LB-medium containing different concentrations of IPTG at 37 °C. Parental AMHG cells and ssrA-deficient D1 (ΔssrA) cells were also cultured. The cells were harvested at mid-log phase (optical density at 600 nm (OD600) = 0.6), and total RNA was prepared by phenol extraction. The RNA (4 μg) was fractionated by 1.5% agarose gel elecrophoresis, and tmRNA was detected by Northern hybridization. (1) AMHG (2) D1(ΔssrA), and L1(Pspac-ssrA) cells cultured with IPTG (3) 0 (4) 5 μm (5) 50 μm (6) 1. 00 μm, and (7) 500 μm, respectively.

Download figure to PowerPoint

tmRNA is required for efficient growth under several stresses

Table 1 shows the growth rates of the L1 (Pspac-ssrA) cells with or without expression of tmRNA at various temperatures, from 27 °C to 53 °C, together with those of strain AMHG and D1 (ΔssrA). The growth rates of AMHG and D1 (ΔssrA) cells were comparable to those of L1 cells, both with and without IPTG induction, respectively. The L1 growth without IPTG induction was slightly, but significantly, lower than that with induction (500 μm IPTG) from 27 °C to 45 °C. The difference between the growth rates in the two cultures became obvious when the temperature was increased above 45 °C. At 52 °C, the highest temperature for the growth of strain AMHG, the L1 cells could not grow without IPTG, and the growth depended on the amount of IPTG added, showing that the growth depends on the amount of tmRNA in the cell ( Fig. 2a).

Table 1.  Growth rates of Bacillus subtitlis strains with and without tmRNA synthesis at different temperatures The cells were cultured in 25 mL of LB-medium with vigorous aeration, and the growth was monitored by measuring absorbance at 600 nm. L1 (Pspac-ssrA) cells were cultured in the absence (−IPTG) and the presence of 500 μm IPTG (+IPTG), respectively.*The values are the average of three independent measurements. Thumbnail image of
image

Figure 2 (a) tmRNA-dependent growth of B. subtilis strain L1 at a high temperature. The L1(Pspac-ssrA) cells cultured overnight at 37 °C without IPTG were diluted 100-fold in LB medium containing different amounts of IPTG as indicated and cultured at 52 °C with vigorous aeration. The growth was monitored by measuring the OD600. (b) tmRNA-dependent growth in the presence of ethanol and (c) cadmium chloride. The AMHG (open circles) and D1 (closed circles) cells were cultured in LB-medium at 37 °C, and ethanol (final concentration of 6.3%) or cadmium chloride (0.2.  m m) was added at early log-phase culture (0 time: indicated by arrows). Open squares show the growth of AMHG cells without the addition of ethanol or cadmium chloride.

Download figure to PowerPoint

Growth was also measured under other stressful conditions using D1 (ΔssrA) and parental AMHG cells. tmRNA-dependent growth was observed in the presence of a high concentration of ethanol (6.3%) or cadmium chloride (0.2 m m) ( Fig. 2b and c). The growth rates in the presence of 5.5% or less of ethanol and in 0.15 m m or less of cadmium chloride did not significantly affect growth rates. Exposure of the cells to a high concentration of salt (2 m NaCl) or to a high osmotic pressure (15% sucrose) revealed little effect on the growth rates of the cells with or without ssrA; the recovery of growth after UV-irradiation or exposure to H2O2 (2 m m) was also unaffected by the presence or absence of tmRNA (data not shown).

tmRNA synthesis increases under several stresses

The amounts of tmRNA in the parental AMHG cells cultured at different temperatures were measured. Cells were cultured at various temperatures from 20 °C to 52 °C in LB-medium, and tmRNA from the mid-log phase cells was detected by Northern hybridization. As shown in Fig. 3a, the amount of tmRNA (relative to the total RNA) increased with temperature, while the amounts of 5S rRNA and scRNA (small cytoplasmic RNA: SRP RNA homologue) were almost unchanged ( Fig. 3c and d). The amount of RNase P RNA decreased slightly with elevated temperature ( Fig. 3b). The amounts of tmRNA in L1 (Pspac-ssrA) cells in the presence of IPTG did not change, regardless of the temperature, showing that the transcription efficiency of the Pspac promoter was not significantly affected by temperature ( Fig. 3e).

image

Figure 3. Northern hybridization of RNAs in the cells grown at different temperatures. The AMHG cells (a, b, c, d) or L1 cells with IPTG induction (e) were cultured in LB-medium at different temperatures from 20 °C to 52 °C, and total RNA was prepared from the log-phase cells. The total RNA (2 μg for tmRNA, RNase P and scRNA (small cytoplasmic RNA: SRP RNA homologue); 0.2 μg for 5S rRNA) was separated by agarose gel electrophoresis and detected by Northern hybridization with complementary DNAs for tmRNA ((a) and (e)), RNase P RNA (b), scRNA (c) or 5S rRNA (d) as probes.

Download figure to PowerPoint

Figure 4a shows the amounts of tmRNA in AMHG cells after a temperature shift from 37 °C to 51 °C. An apparent increase in tmRNA was observed from 5 min after the temperature shift. The amount of tmRNA increased about 10-fold after 90 min of the shift ( Fig. 4b), while no significant change was observed in the amounts of tmRNA in L1 cells cultured in the presence of IPTG ( Fig. 4c). The induction of tmRNA synthesis was also observed in cells after exposure to a high concentration of ethanol or cadmium chloride, although the induction levels (4–6-fold) were lower than that of heat-shock. On the other hand, osmotic shock (15% sucrose) or salt shock (2 m NaCl), which had little effect on tmRNA-dependent growth, caused only a slight induction of tmRNA synthesis ( Fig. 5).

image

Figure 4. Induction of tmRNA synthesis after temperature shift. (a) The AMHG cells were cultured at 37 °C and shifted to 51 °C at mid-log phase (0 time). A portion of the culture was taken at intervals (5, 15, 30, 60 and 90 min) and total RNA was prepared. Each RNA (2 μg) was separated by agarose gel electrophoresis, and tmRNA was detected by Northern hybridization. (b) The total RNA (1 μg/μL) was serially diluted, and 2 μL portions were dotted on a blotting membrane. tmRNA was detected by hybridization and quantified by densitometer. Induction ratios of tmRNA were calculated by dividing the values of the stressed cells by that of control cells (0 time). The averages of the values from three differently diluted samples were shown (standard deviations were shown by bars). (c) L1 cells with IPTG were cultured at 37 °C and shifted to 51 °C. Northern hybridization was performed as described above.

Download figure to PowerPoint

image

Figure 5 Induction of tmRNA synthesis under ethanol, cadmium, salt and osmotic stresses. The AMHG cells were cultured in LB-medium at 37 °C, and 6.3% ethanol (circle), 0.2 m m cadmium chloride (triangle), 2 m NaCl (square) or 15. % sucrose (diamond) was added at mid-log phase (OD600 = 0.6: 0 time). Cells were collected at intervals and total RNA was prepared. The total RNA (1 μg/μL) was serially diluted, and 2-μL portions were dotted on a blotting membrane. tmRNA was detected by hybridization, and quantified as described in the legend of Fig. 4.

Download figure to PowerPoint

Alanylated tmRNA is required for growth at high temperatures

To see whether tmRNA-mediated proteolysis of the tag-attached peptides is required for growth under the stresses, we constructed two strains containing mutant tmRNAs: first, strain M1 (Pspac-ssrA(AU)), in which the third base pair of the amino acid acceptor-stem (G-U), an identity determinant for alanyl-tRNA synthetase ( Hou & Schimmel 1988; McClain & Foss 1988), was changed to an A-U pair; the product tmRNA(AU) is defective both in alanylation and in trans-translation in E. coli ( Himeno et al. 1997 ); second, strain N1 (Pspac-ssrA(DD)), in which the sequence encoding the last two amino acids (alanine-alanine) of the tag peptide was replaced by that for aspartic acid-aspartic acid; the product tmRNA(DD) is expected to be active in the trans-translation reaction but defective in the degradation of tag-attached peptides ( Keiler et al. 1996 ; Gottesman et al. 1998 ). Both mutant genes were integrated in the genomic DNA under the control of Pspac-promoter as described in Fig. 1a, and thus the mutant tmRNAs could be inducible by IPTG ( Fig. 6 a). Figure 6b shows the growth curves of the cells expressing wild-type or mutant tmRNAs by IPTG induction at high temperature (52 °C). The M1(Pspac-ssrA(AU)) cells expressing tmRNA(AU) revealed a striking temperature sensitivity, demonstrating the requirement of alanylated tmRNA for the growth at high temperature. On the other hand, the N1(Pspac-ssrA(DD)) cells, which expressed tmRNA(DD), could grow at 52 °C, although the growth was a little slower than that of L1 cells expressing wild-type tmRNA, suggesting that the tmRNA-mediated proteolysis is only scarcely required for the growth at high temperature.

image

Figure 6 (a) Induction of tmRNA synthesis by IPTG. The strains L1(Pspac-ssrA), M1 (Pspac-ssrA(AU)) and N1(Pspac-ssrA(DD)) were cultured in LB-medium, with or without IPTG at 37 °C. tmRNA was detected by Northern hybridization as described in Fig. 1b. (b) Growth curves at 52 °C of the strain L1 (Pspac-ssrA), M1 (Pspac-ssrA(AU)) and N1 (Pspac-ssrA(DD)). The cells were cultured in LB-medium with IPTG at 52 °C, and the growth was monitored by measuring the OD6. 00. L1 (square); M1 (circle); N1 (triangle).

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

In the present study, we have first shown that tmRNA is required for the efficient growth of B. subtilis under conditions of high stress, such as high temperature or a high concentration of ethanol or cadmium chloride ( Fig. 2). Second, that the amount of tmRNA in the cells increases under these stresses ( Figs 345), and third, that alanine charged tmRNA rather than tmRNA-mediated proteolysis is required for the growth at high temperature.

Several ssrA-defective mutants of E. coli have been isolated in different laboratories ( Oh & Apirion 1991; Kirby et al. 1994 ; Komine et al. 1994 ; Tu et al. 1995 ). In all cases, the mutants are viable, showing that the RNA is not essential for growth under laboratory conditions, although a slower growth rate has been observed at high temperatures ( Oh & Apirion 1991; Komine et al. 1994 ). B. subtilis cells having defective or repressed ssrA are also viable ( Table 1). However, the growth rate at a high temperature (> 45 °C) is obviously lower in the absence than that in the presence of tmRNA in B. subtilis, and the growth rate depends on the amount of tmRNA in the cell at an extremely high temperature (52 °C) ( Fig. 2a). tmRNA-dependent growth was also observed in cultures containing 6.3% ethanol or 0.2 m m cadmium chloride, which are close to the maximum concentrations for the growth of parental B. subtilis AMHG cells ( Fig. 2b and c). These results suggest that tmRNA is required for efficient growth under these strong stresses, and this may explain why tmRNA genes have been conserved among most species in the eubacterial kingdom, despite the fact that it is not essential for normal growth, as the bacteria must have been exposed to various stresses during evolution. The trans-translation system works when a truncated mRNA lacking a stop codon is translated ( Keiler et al. 1996 ). The system may be important in supporting growth under stresses where the degradation of mRNA are likely to occur more frequently.

The relative amounts of tmRNA in the B. subtilis AMHG strain, having the authentic promoter of ssrA, increase with elevating temperature ( Fig. 3). The temperature shift of the cells from 37 °C to 51 °C induces about a 10-fold greater amount of tmRNA ( Fig. 4). In the L1 strain, in which the authentic ssrA promoter is replaced by Pspac, no increase was observed at a high temperature ( Fig. 3e and 4c), showing that the increase in AMHG cells at a high temperature is due to an increase in the transcription of ssrA, rather than to a higher stability of tmRNA than those of the other RNAs. The induction of tmRNA synthesis was also observed under ethanol- or cadmium-stress ( Fig. 5). These results suggest that ssrA is a stress-inducible gene.

In B. subtilis, at least four different classes of stress-inducible genes have been identified, on the basis of their common regulatory characteristics ( Hecker et al. 1996 ; Derréet al. 1999 ): First, the genes including dnaK and groE involve a σA promoter and an inverted repeat (CIRCE; controlling inverted repeat of chaperone expression) (Class I); second, the majority of stress-inducible genes are induced at σB-dependent promoters (Class II); third, the genes clpC, clpP and clpE are σA promoter-dependent and controlled by CtsR which specifically binds to a direct-repeated consensus heptad sequence upstream of these genes (Class III): and fourth, the genes such as lonB, clpP, clpX, htpG, ahpC and ftsH are σA promoter-dependent but independent of both the CIRCE and CtsR binding elements (Class IV). The presumptive regulatory elements for the Class IV gene group are not known. The authentic ssrA promoter is a typical vegetative σA type, and neither a CIRCE element nor a CtsR binding sequence can be found in the upstream region of the gene ( Ushida et al. 1994 ). Thus, ssrA belongs to the Class IV-type gene in this classification. A primer extension analysis of the AMHG cells showed that the initiation of ssrA transcription predominantly occurs at the putative σA dependent promoter (−54 position from the 5′-end of the structure gene), and no other primary transcripts could be detected, even after exposure to a high temperature (52 °C) (data not shown). The several B. subtilis genes belonging to Class IV, such as clpP and clpX, are thought to be involved in stress tolerance ( Gerth et al. 1998 ). The induction of these genes and of ssrA may be coordinated, supporting the cell growth under stressful conditions.

tmRNA is involved in the degradation of incompletely synthesized peptides from truncated mRNA and in the recycling of stalled ribosomes through the trans-translation system ( Keiler et al. 1996 ; Muto et al. 1998 ). To specify which process in the trans-translation reaction is relevant to stress tolerance, we have made two strains having mutant tmRNAs: tmRNA(AU) and tmRNA(DD). All tmRNAs so far sequenced have G-U at the third base-pair position of the amino acid-acceptor stem ( Williams 1999), which is known as a major identity determinant of tRNAAla for alanyl-tRNA synthetase ( Hou & Schimmel 1988; McClain & Foss 1988), and tmRNA variants with an A-U or a G-C pair at this position cannot accept alanine ( Komine et al. 1994 ; Himeno et al. 1997 ; Huang et al. 2000 ). When the mutant tmRNA, having an A-U pair instead of the G-U pair at the third position of acceptor-stem (tmRNA(AU)), was expressed in B. subtilis, the cell could not grow at 52 °C ( Fig. 6), showing that alanylated tmRNA, rather than tmRNA itself, is required for the growth at high temperature. Since the aminoacylation of tmRNA is a prerequisite for the trans-translation reaction ( Himeno et al. 1997 ; Nameki et al. 1999 ), the result suggests a requirement of trans-translation reaction and/or proteolysis for the growth at high temperature. All the tag-peptides encoded in tmRNAs, including that of B. subtilis have a conserved C-terminal sequences with nonpolar amino acids, the consensus being alanine-leucine-alanine-alanine ( Williams 1999), which is shown to be a target for proteolysis by tail-specific proteases ( Keiler et al. 1996 ; Gottesman et al. 1998 ). The mutant tmRNA(DD) with changes in the C-terminal two amino acids of the tag (alanine-alanine) to polar amino acids (aspartic acid-aspartic acid), which is known as a faulty signal for proteolysis in E. coli ( Parsell et al. 1990 ; Keiler et al. 1996 ), should no longer provide a target for proteolysis. Interestingly, the cells expressing tmRNA(DD) could grow almost normally at 52 °C ( Fig. 6), indicating that proteolysis per se is not required for the growth at high temperature. Since tmRNA(DD) can accept alanine and direct trans-translation reaction, the above results strongly suggest that ribosome recycling is primarily important for stress tolerance in B. subtilis. It has been reported that tmRNA is essential for viability in a bacterium Neisseria gonorrhoeae, and that charged tmRNA, but not tmRNA-mediated proteolysis, is required for the growth ( Huang et al. 2000 ). This and our results support the idea that the major activity of tmRNA is the recycling of stalled ribosomes, rather than proteolysis ( Withey & Friedman 1999). The induction of tmRNA under several stressful conditions may reflect the increasing demand of this RNA due to the increase in stalling ribosomes.

Experimental procedures

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Bacterial strains and construction of mutants

B. subtilis strain AMHG (pur, met, his) and plasmid pDH88 were kindly provided by Dr N. Ogasawara of Nara Institute of Science and Technology; plasmid pMUTIN2 ( Vagner et al. 1998 ) by Dr K. Nakamura of University of Tsukuba.

Replacement of the ssrA gene promoter with a Pspac promoter-operator and integration of the lacI gene in the genome were performed using pMUTIN2 plasmid as described by Vagner et al. (1998 ). The DNA fragment (334 bp) from 40 bp upstream of the 5′-end (containing the HindIII site) to 66 bp upstream of the 3′-end of the tmRNA coding sequence (containing the BglII site) was amplified by polymerase chain reaction (PCR) using the synthesized DNA primers: (5′)TGA AAGCTTGATATTTTCTCCCGTATTTCC(3′) (HindIII site underlined) and (5′)TGC AGATCTATGGTTTCA CTCATCTTCTTG(3′) (BglII site underlined), respectively. The product was digested by HindIII and BglII to produce truncated ssrA, which lacks the authentic promoter and in which 65 bp from the 3′-end of the gene has been deleted. The 3′-truncated ssrA sequence (3′ΔssrA) was inserted in the HindIII-BamHI sites in the polylinker site of the plasmid pMUTIN2, which contains Pspac, lacZ, lacI and erythromycin-resistant (ermr) genes (see Fig. 1a). The resulting recombinant plasmid pMUTIN-(3′ΔssrA) was introduced into competent cells of B. subtilis strain AMHG, and ermr transformants via a single cross-over were selected on LB-agar plates containing 0.2 μg/mL of erythromycin. One of the transformants, designated as L1 (Pspac-ssrA) strain, was used throughout this work.

Two strains each containing inducible mutant tmRNA were also constructed: first, strain M1(Pspac-ssrA (AU)), in which the third base from the 5′-end was changed from G to A to produce tmRNA(AU), having an A-U pair at the third position of the acceptor stem; and second, strain N1(Pspac-ssrA(DD)), in which the sequence encoding the last two amino acids (alanine-alanine) of the tag peptide was changed to aspartic acid-aspartic acid to produce tmRNA(DD). Procedures to construct the strains were essentially the same as described above except that mutagenic origonucleotids were used as primers for PCR reaction. The primers containing mutations are (5′)CCCG GAATTC CCTT ATACCAAGGAGACGTT(3′) (EcoRI site underlined; mutation italic) for tmRNA (AU) and (5′)GGAA GAGCTCGCTGCGC TTATTAGTCTTCTAATGCTACGTTTT (3′) (SacI site underlined; mutation italic) for tmRNA(DD). Proper integration of each gene was confirmed by DNA sequencing of the PCR amplified fragment from the genomic DNA of the transformant. Induction of the tmRNA synthesis was accomplished by adding IPTG (at a final concentration of 500 μm) to the medium.

A tmRNA gene-defective mutant (ΔssrA) was constructed as follows: Plasmid pBCE032 containing B. subtilis tmRNA gene (ssrA) ( Ushida et al. 1994 ) was propagated in E. coli strain JM109, and the plasmid DNA was digested with ClaI, which cuts at the 322 nt position of ssrA. About a 1 kbp AccII-fragment including the chloramphenicol acetyltransferase gene (cat) of plasmid pDH88 DNA was inserted into the ClaI site within ssrA in plasmid pBSE032. The linearized plasmid DNA was introduced into competent cultures of B. subtilis strain AMHG for integration at the ssrA site by a double cross-over, and chloramphenicol-resistant transformant colonies were selected. One of them, named D1 (ΔssrA or ssrA::cat), was used for the experiments. Proper integration was confirmed by PCR amplification and by Southern hybridization of the genomic DNA. No tmRNA was detected by Northern hybridization analysis in the D1 (ΔssrA) cells (see Fig. 1b).

Media and culture conditions

Cells were cultured in Luria Bertani-medium (LB: 10 g bacto-tryptone, 5 g bacto-yeast extract, 10 g NaCl per litre). For transformation, cells are grown in minimum Cg-medium (14 g KH2PO4, 6 g K2HPO4, 1 g Na-citrate (2H2O), 2 g (NH4)2SO4, 0.1 g glutamic acid per litre) supplemented with 0.5% glucose, 20 mg/mL each of adenosine and guanosine, 50 mg/mL each of l-methionine and l-histidine, and 0.1% casamino acids (Difco). The late log-phase cells were diluted 10-fold in fresh Cg-medium supplemented with 0.5% glucose and shaken for 90 min at 37 °C. The competent cells (0.5 mL) were mixed with DNA solution (5 μg) and incubated for 90 min at 37 °C, and portions of the mixture were spread on LB-agar plates containing 0.2 μg/mL erythromycin or 5 μg/mL chloramphenicol.

RNA preparation and Northern hybridization

Total RNA from cells was prepared by phenol extraction as described in a previous paper ( Ushida et al. 1994 ). The total RNA (0.2–4 μg) was fractionated by 1.5% agarose gel electrophoresis in MOPS-buffer (20 m m 3-[N-Morpholino]-propane-sulphonic acid, 5 m m Na-acetate (pH 7.0), 1 m m Na2-EDTA) containing 5% formaldehyde, and blotted on to a Nylon membrane (Hybond N+: Pharmacia-LKB). The 3′-end of synthesized DNA fragments (25–27-mer) complementary to a part of each RNA sequence (cDNA) was labelled by digoxigenine (DIG) (Boehringer Mannheim Biochemica) and used as a hybridization probe. The sequence of cDNAs are: (5′)ACGAGATCGCCTCTCGGCTCGC AGCTC(3′) for tmRNA; (5′)TAGTGAGACTTCGTCACTGTGGCAC(3′) for RNase P RNA; (5′)GACCTGACATGGTTCATGAATTCCC(3′) for scRNA; and (5′)TGGGAACGGGTGTGACCTCTTCGCT (3′) for 5S rRNA. DIG-labelling and luminescent detection were performed according to the manufacturer's manual. To compare the relative amounts of tmRNA in the total RNAs isolated from different cultures, serial dilutions of total RNA were dotted on to the membrane, and hybridization was carried out as described above. The membranes were exposed to Fuji RX films, and the hybridized tmRNAs were quantified by personal densitometer.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

We thank the Gene Research Center of Hirosaki University. We also thank Kazutaka Sakaki and Hisashi Tomatsu for their help. This work was supported by a grant-in-aid for Scientific Research on Priority Areas from the Ministry of Education, Science, Sports and Culture of Japan and a grant (‘Research for the Future’ Program, JSPS-RFTF96100305) from the Japan Society for the Promotion of Science.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  • 1
    Derré, I., Rapoport, G., Msadek, T. (1999) CtsR, a novel regulator of stress and heat shock response, controls clp and molecular chaperone gene expression in gram-positive bacteria. Mol. Microbiol. 31, 117 131.
  • 2
    Gerth, U., Kruger, E., Derre, I., Msadek, T., Hecker, M. (1998) Stress induction of the Bacillus subtilis clpP gene encoding a homologue of the proteolytic component of the Clp protease and the involvement of ClpP and ClpX in stress tolerance. Mol. Microbiol. 28, 787 802.
  • 3
    Gottesman, S., Roche, E., Zhou, Y., Sauer, R.T. (1998) The ClpXP and ClpAP proteases degrade proteins with carboxy-terminal peptide tails added by the SsrA RNA-tagging system. Genes Dev. 12, 1338 1347.
  • 4
    Hecker, M., Schumann, W., Völker, U. (1996) Heat-shock and general stress response in Bacillus subtilis. Mol. Microbiol. 19, 417 428.
  • 5
    Henner, D.J. (1990) Expression of heterologous genes in Bacillus subtilis. Meth. Enzymol. 185, 199 201.
  • 6
    Herman, C., Thevenet, D., Bouloc, P., Walker, G.C., Díari, R. (1998) Degradation of carboxy-termianl-tagged cytoplasmic proteins by the Escherichia coli protease HflB (FtsH). Genes Dev. 12, 1348 1355.
  • 7
    Himeno, H., Sato, M., Tadaki, T., Fukushima, M., Ushida, C., Muto, A. (1997) In vitro trans-translation mediated by alanine charged 10Sa RNA. J. Mol. Biol. 268, 803 808.
  • 8
    Hou, Y.-M. & Schimmel, P. (1988) A simple structural feature is a major determinant of the identity of a transfer RNA. Nature 333, 140 145.
  • 9
    Huang, C., Wolfgang, M.C., Withey, J., Koomey, M., Friedman, D.I. (2000) Charged tmRNA but not tmRNA-mediated proteolysis is essential for Nisseria gonorrhoeae viability. EMBO J. 19, 1098 1107.
  • 10
    Keiler, K.C., Waller, P.R.H., Sauer, R.T. (1996) Role of peptide tagging system in degradation of protein synthesized from messenger RNA. Science 271, 990 993.
  • 11
    Kirby, J.E., Trempy, J.E., Gottesman, S. (1994) Excision of a P4-like cryptic prophage leads to Alp protease expression in Escherichia coli. J. Bacteriol. 176, 2068 2081.
  • 12
    Komine, Y., Kitabatake, M., Yokogawa, T., Nishikawa, K., Inokuchi, H. (1994) A tRNA-like structure is present in 10Sa RNA, a small stable RNA from Escherichia coli. Proc. Natl. Acad. Sci. USA 91, 9223 9227.
  • 13
    McClain, W.H. & Foss, K. (1988) Changing the identity of a tRNA by introducing a G-U wobble pair near the 3′ acceptor end. Science 240, 793 796.
  • 14
    Muto, A., Sato, M., Tadaki, T., Fukushima, M., Ushida, C., Himeno, H. (1996) Structure and function of 10Sa RNA: trans-translation system. Biochimie 78, 985 991.
  • 15
    Muto, A., Ushida, C., Himeno, H. (1998) A bacterial RNA that functions as both a tRNA and an mRNA. Trends Biochem. Sci. 23, 25 29.
  • 16
    Nameki, N., Tadaki, T., Muto, A., Himeno, H. (1999) Amino acid acceptor identity switch of Escherichia coli tmRNA from alanine to histidine in vitro. J. Mol. Biol. 289, 1 7.
  • 17
    Oh, B.-K. & Apirion, D. (1991) 10Sa RNA, a small stable RNA of Escherichia coli, is functional . Mol. Gen. Genet. 229, 52 56.
  • 18
    Parsell, D.A., Silber, K.R., Sauer, R.T. (1990) Carboxy-terminal determinants of intracellular protein degradation. Genes Dev. 4, 277 286.
  • 19
    Tu, G.-F., Reid, G.E., Zhang, J.-G., Moritz, R.L., Simpson, R.J. (1995) C-terminal extension of truncated recombinant proteins in Escherichia coli with a 10Sa RNA decapeptide. J. Biol. Chem. 270, 9322 9326.
  • 20
    Ushida, C., Himeno, H., Watanabe, T., Muto, A. (1994) tRNA-like structures in 10Sa RNAs of Mycoplasma caplicolum and Bacillus subtilis. Nucl. Acids Res. 22, 3392 3396.
  • 21
    Vagner, V., Dervyn, E., Ehrlich, S.D. (1998) A vector for systematic gene inactivation in Bacillus subtilis. Microbiol. 144, 3097 3104.
  • 22
    Williams, K.P. (1999) The tmRNA website. Nucl. Acids Res. 27, 165 166.
  • 23
    Withey, J. & Friedman, D.J. (1999) Analysis of the role of trans-translation in the requirement of tmRNA for λimmP22 growth in Escherichia coli. J. Bacteriol. 181, 2148 2157.
  • 24
    Yasura, D.G. & Henner, D.J. (1984) Use of Escherichia coli lac repressor and operator to control gene expression in Bacillus subtilis. Proc. Natl. Acad. Sci. USA 81, 439 443.