SEARCH

SEARCH BY CITATION

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. References

While bacterial DNA and cytosine–guanosine-dinucleotide-containing oligonucleotides (CpG ODN) are well described activators of murine immune cells, their effect on human cells is inconclusive. We investigated their properties on human peripheral blood mononuclear cells (PBMC) and subsets thereof, such as purified monocytes, T and B cells. Here we demonstrate that bacterial DNA and CpG ODN induce proliferation of B cells, while other subpopulations, such as monocytes and T cells, did not proliferate. PBMC mixed cell cultures, as well as purified monocytes, produced interleukin-6 (IL-6), IL-12 and tumour necrosis factor-α upon stimulation with bacterial DNA; however, only IL-6 and IL-12 secretion became induced upon CpG ODN stimulation. We conclude that monocytes, but not B or T cells, represent the prime source of cytokines. Monocytes up-regulated expression of antigen-presenting, major histocompatibility complex class I and class II molecules in response to CpG DNA. In addition, both monocytes and B cells up-regulate costimulatory CD86 and CD40 molecules. The activation by CpG ODN depended on sequence motifs containing the core dinucleotide CG since destruction of the motif strongly reduced immunostimulatory potential.


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. References

Yamamoto, Tokunaga and colleagues were the first to observe that DNA fractions within bacille Calmette–Guérin (BCG) preparations had antitumour activity towards mouse tumours, augmented natural killer (NK) cell cytotoxicity and induced interferon (IFN) release from spleen cells.1[2]–3 Murine studies have shown that bacterial DNA, but not vertebrate DNA, activates NK cells and is mitogenic for B cells.4, 5 Furthermore, cytosine–guanosine-dinucleotide-containing single-stranded oligodeoxynucleotides (CpG ODN) could mimic these effects.6 Using CpG ODN-induced B-cell proliferation as a measure, Krieg et al. iteratively determined that the immunostimulatory activity was restricted to 12–20 base sequences containing CpG dinucleotides with selective flanking bases, the motif 5′-Pu-Pu-CpG-Pyr-Pyr-3′ being biologically active.7 CpG dinucleotides are suppressed in vertebrate DNA and often methylated.8 Since methylation of CpG ODN or bacterial DNA curtails its immunostimulatory activity,7, 9 it has been assumed that immune cells sense unique unmethylated CpG base sequences of pathogen-associated DNA through a non-self pattern recognition system.10

Murine immune cells of both the innate and adaptive immune systems are responsive to bacterial DNA and CpG ODN. These compounds directly stimulate antigen-presenting cells (APC), such as macrophages and dendritic cells, to release various cytokines, such as tumor necrosis factor-α (TNF-α), interleukin-1 (IL-1), IL-6, IL-10, IL-12, and granulocyte–macrophage colony-stimulating factor (GM-CSF) (refs. 11[12][13][14][15][16]–17; G.B.L. unpublished data). APC also up-regulate antigen-presenting major histocompatibility complex (MHC) molecules and costimulatory molecules such as B7.1, B7.2 and CD40.18, 19 In addition, CpG DNA enhances NK cell-mediated cytotoxicity and release of IFN-γ, while B cells proliferate and secrete IL-6 and IL-10 (refs. 7,20,21; G.B.L. unpublished data). Purified T cells however, appear unresponsive to direct stimulation with CpG ODN.19, 22In vivo mouse models have shown that CpG ODN serve as a potent adjuvant for both humoral and cellular immune responses to antigen with a T helper type 1 (Th1) bias.17, 19, 23[24]–25 These observations were extended to show that CpG ODN trigger protective and curative Th1 responses in lethal leishmaniasis and were ablative in murine asthma models.26, 27 The potential clinical therapeutic applications of CpG ODN in the areas of vaccines and immunomodulation are therefore intriguing.

There are studies to suggest that human cells may also be responsive to bacterial DNA. The MY-1 fraction from BCG as well as Escherichia coli DNA have been demonstrated to augment NK cell cytolytic activity from human peripheral blood mononuclear cells (PBMC).20, 28 Branda et al. showed that a phosphorothioated human immunodeficiency virus (HIV) rev-antisense oligomer induced B-cell proliferation from PBMC, however, the result was not linked to CpG.29 Liang et al. also reported that various ODN induced B-cell proliferation, but postulated that CpG may not be needed.30 Roman et al. demonstrated that a CpG ODN and not its control GpG ODN induced the release of IFN-α, IFN-γ and possibly IL-12 from PBMC, yet cationic lipid was used to transfect the ODN directly into the cells.17 Studies directly accessing the immune-activating potential of bacterial DNA or CpG ODN towards human immune cells are lacking.

To elucidate the effects of DNA on human immune cells we tested bacterial DNA, CpG motif-containing ODN and their appropriate controls for activity on PBMC, monocytes, T and B cells. We used three CpG ODN sequences: 1668, a proven activator of murine immune cells;7, 15, 18 DSP30, a sequence described by Branda et al. and functionally defined by Liang et al.;29, 30 and 2006, a sequence provided by A. Krieg (University of Iowa). To investigate sequence-unspecific effects we also included an oligonucleotide without a sequence correlation to the CpG motifs used. As analysis parameters we monitored proliferation, cytokine release and cell surface activation markers. Our results demonstrate that B cells proliferate, monocytes release IL-6 and IL-12, and potentially TNF-α, and both cell types up-regulate costimulatory surface molecules in a CpG motif-dependent manner.

MATERIALS AND METHODS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. References

Reagents

Compound 406 was kindly provided by Professor Arthur J. Ulmer (Research Centre Borstel, Borstel, Germany). It is a non-signalling structural analog to lipopolysaccharide (LPS) and blocks its binding to CD14 by competition.31 Titration of 406 into the various assays confirmed its ability to block LPS as a stimulus, effective dose 1 μg/ml (data not shown). A concentration of 10 nm 1,2-O-tetradecanoyl phorbol-13-acetate (TPA; Calbiochem, Bad Soden, Germany) was used in combination with ionomycin (Calbiochem) at a concentration of 1 μm. Chloroquine (Sigma, Deisenhofen, Germany) was used at a concentration of 10 μg/ml. All ODN were used single-stranded, phosphorothioate-stabilized and synthesized by TibMolBiol (Berlin, Germany). The following ODN were used: 2006, TCGTCGTTTTGTCGTTTTG TCGTT (sequence provided by A. Krieg, University of Iowa); its control 2006K, TGCTGCTTTTGTGCTTTTGTGCTT; DSP30, TCGTCGCTGTCTCCGCTTCTTCTTGCC;30 its control DSP30K, TGCTGCCTGTCTCCCCTTCTTCTT GCC; 1668, TCCATGACGTTCCTGATGCT;1 its control, 1668K, TCCATGAGCTTCCTGATCCT; and the unrelated oligonucleotide AP1, GCTTGATGACTCAGCCGGAA.

Cell culture

Cells were cultivated in RPMI-1640 (Seromed, Berlin, Germany) supplemented with 50 μm 2-mercaptoethanol, 2 mm l-glutamine, 100 U/ml penicillin G, 100 μg/ml streptomycin 10 mm HEPES and 10% fetal calf serum (FCS) (Seromed). For proliferation assays FCS was replaced by human serum.

Cell preparation and purification

PBMC were isolated from citrate-stabilized buffy coats by centrifugation over Ficoll–Hypaque gradient. Briefly, 15 ml of the buffy coat were diluted 1:1 with phosphate-buffered saline (PBS), underlayed with 15 ml Ficoll–Hypaque solution, 1·077 g/l (Biochrom, Berlin, Germany) and centrifuged for 30 min at 1000 g. The cells at the interface were harvested and washed four times with Hanks’ balanced salt solution (HBSS).

Monocytes were purified by plastic adherence. Briefly, PBMC (10×106/well) were incubated in RPMI-1640/10% FCS in six-well plates (Falcon, Heidelberg, Germany) for 2 hr at 37°. After decanting the medium, the cells were washed with PBS/2% FCS and incubated for an additional hour. The washing step was repeated and the adherent cells were harvested with a cell scraper. The monocytes were found to be over 90% pure as analysed by flow cytometry.

B cells were isolated from tonsils by negative selection using a MACS separation kit (Miltenyi, Bergisch Gladbach, Germany). Fresh tonsils were cut into small fragments and pushed through a mesh. The single cell suspension was centrifuged at 1000 g for 15 min over Ficoll–Hypaque solution. The cells at the interface were harvested and washed twice with HBSS. The negative selection was done according to the manufacturer’s instructions. The purity was determined by flow cytometry and found to be over 95%.

Proliferation assays

PBMC (1×105/well) or B cells (5×104/well) were incubated in quadruplicates for 4 days at 37° in 96-well plates (Falcon, Heidelberg, Germany) with or without oligonucleotides at different concentrations or the combination of TPA and ionomycin. To indicated cultures, chloroquine was added. On day 4 the cells were pulsed with 1 μCi [3H]thymidine (6·7 Ci/mm) for 6 hr. Lysed cells were harvested onto filter papers and the [3H]thymidine incorporation into the DNA was measured.

Measurement of cytokine release

PBMC (5×106/ml) or monocytes (1×106/ml) were incubated at 37° in 24-well plates in the presence or absence of Escherichia coli (EC) DNA, calf thymus (CT) DNA, or ODN. The supernatants were transferred in duplicates to plates coated with antihuman IL-6, IL-12 after a period of 24 hr or TNF-α after 8 hr (Pharmingen, San Diego, CA). After overnight incubation, plates were washed and biotinylated polyclonal anti-IL-6, -IL-12, or -TNF-α serum (Pharmingen) was added for 1 hr. After additional washing, plates were incubated with streptavidin peroxidase conjugate (Sigma). For development o-phenylenediamine (Sigma) was used. To rule out LPS contamination as a stimulus the compound 406 was added at a concentration of 1 μg/ml as a control. At maximal stimulating doses of DNA the addition of 406 reduced the cytokine levels by no more than 10% (data not shown).

Expression of surface markers

Monocytes or B cells (1×106/ml) were cultured overnight at 37° in 24-well plates in the presence or absence of oligonucleotides. Cells were harvested, washed and preincubated with human immunoglobulin G (IgG; Miltenyi) for Fc-receptor blockade. Antibodies used for specific staining or isotype controls were fluorescein isothiocyanate (FITC) or phycoerythrin (PE)-conjugated anti-CD14, anti-CD19, anti-CD86, anti-CD40, anti-HLA-DR and anti-HLA-ABC (Pharmingen). For stainings of CD71 PBMC (1×106/ml) were cultured for 3 days with the indicated stimuli. On day 3 the cells were incubated with FITC-labelled anti-CD3 or anti-CD19 and biotin-labelled anti-CD71-antibody and counterstained after washing with streptavidin-PerCP (Pharmingen). Fluorescence-activated cell sorter (FACS) analyses were performed on a Coulter EPICS XL.

The stimulation index was calculated using the equation:

inline image

RESULTS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. References

Proliferation of human cells is CG dependent

Treatment of human PBMC with EC DNA lead to a dose-dependent proliferation (Fig. 1a). The mitogenic effects of bacterial DNA could be destroyed by DNaseI treatment and the cells were unresponsive to CT DNA, a vertebrate DNA used as a control. In addition, proliferation was not effected by the LPS inhibitor compound 406 (ref. 31 and data not shown). The mitogenicity of extracted prokaryotic DNA for mixed immune cell preparations has been amply shown in the mouse but this represents the first demonstration in human cells.

image

Figure 1. Proliferation of PBMC induced by EC DNA and CpG ODN. PBMC (1×105/well) were cultured on 96-well round bottom plates for 4 days with various concentrations of EC DNA, CT DNA, CpG ODN, or control GpC ODN. The data are reported as the mean c.p.m. of four replicates and are representative for at least three independent experiments. (a) The closed symbols represent cultures stimulated with EC DNA (●) or CT DNA (▴) and the open symbols represent cultures stimulated with DNaseI digested EC DNA (○) or CT DNA (▵). (b) The closed symbols represent cultures stimulated with the CpG ODN 2006 (●), DSP30 (▪), 1668 (▴) or the random oligonucleotide AP1 (▾) and the open symbols represent cultures stimulated with the respective GpC ODN controls 2006K (○), DSP30K (□) and 1668K (▵). Cultures stimulated with TPA (10 nm) and ionomycin (1 μm) incorporated a mean of 56221 c.p.m.

Download figure to PowerPoint

Because prokaryotic DNA was mitogenic, we tested three CpG ODN and the reversed GpC ODN controls for PBMC mitogenicity. For all oligonucleotides tested, the maximum proliferative response was at a concentration of 2 μm (Fig. 1b). The rank order of mitogenicity for the CpG ODN was 2006>DSP30>1668. Inverting the CG to GC reduced the activating potential of the oligonucleotides two- to fourfold, however, it was notable that the residual activity of GpC ODN was above that of a non-sequence-related control oligonucleotide (AP1). Stimulation of PBMC with TPA and ionomycin led to a maximal proliferation yielding 56221 c.p.m. The TPA and ionomycin-stimulated cultures also expressed the proliferation marker CD71 on both B cells and T cells as determined by FACS analysis (data not shown). In contrast, CpG ODN-stimulated cultures exclusively increased CD71 on B cells.

Purified mouse B cells, but not T cells, respond to CpG ODN with polyclonal proliferation.7, 19, 22 Additionally, Branda et al. and Liang et al. have reported that purified human B cells respond to various ODN sequences.29, 30 Therefore we investigated whether T or B cells were responsible for PBMC proliferation. Purified human T cells did not proliferate in response to DNA correlating with the absence of CD71 up-regulation seen in PBMC (data not shown). However, EC DNA was mitogenic for purified tonsillar B cells in a dose-dependent fashion, displaying a similar titration curve to PBMC proliferation (Fig. 2a). Both DNaseI-digested and vertebrate DNA were negative for mitogenicity. As found in the case of PBMC, 2006 caused the strongest B-cell proliferation (Fig. 2b). Destroying the CG to GC reduced the proliferative response by 3·5–6-fold, while the treatment with the control oligonucleotide (AP1) showed no proliferation. It has been previously shown that CpG ODN activity is dependent on ODN uptake and endosomal maturation, which can be blocked by chloroquine.32, 33 While the proliferation induced by CpG ODN was completely suppressed by the addition of chloroquine, the TPA and ionomycin-induced proliferation was not (Fig. 2b). Thus, in an analogy to published reports which used murine spleen cells,7, 9 the CpG-dependent proliferation measured from human PBMC appeared due to B cells and is sensitive to chloroquine treatment.

image

Figure 2. EC DNA- and CpG ODN-induced tonsillar B-cell proliferation. Negatively purified B cells (50×103/well) were cultured for 4 days in 96-well round bottom plates with various concentrations of EC DNA, CT DNA, or 2 μm CpG ODN and their controls. The data are reported as the mean c.p.m. of four replicates and are representative for at least three independent experiments. (a) The closed symbols represent stimulation with EC DNA (●) or CT DNA (▴); and open symbols represent stimulation with DNaseI-digested EC DNA (○) or CT DNA (▵). (b) The black bars represent the CpG ODN, AP1 or a combination of TPA (10 nm) and ionomycin (1 μm) and the open bars represent control GpC ODN. Grey bars represent cultures with CpG ODN or TPA/ionomycin where chloroquine (10 μg/ml) was added. Control cultures without any stimulus incorporated a mean of 63 c.p.m.

Download figure to PowerPoint

IL-6, IL-12 and TNF-α release from PBMC

The release of cytokines in response to bacterial DNA is well documented in the mouse system.11[12][13][14][15][16]–17 The only report involving direct cytokine measurement in the human system is Roman et al.17 In this study, a CpG ODN transfected into PBMC by cationic lipid carriers induced IFN-α, IFN-γ and possibly IL-12 but not IL-2, TNF-α, or IL-4. We stimulated PBMC with EC DNA or CT DNA and monitored cytokine release. Figure 3(a) shows that PBMC produce IL-6, IL-12 and TNF-α in response to EC DNA. This cytokine release was not affected by the LPS inhibitor compound 406 (data not shown). This property is partially shared by CpG ODN which stimulated PBMC to secrete IL-6 and IL-12 but not TNF-α (Fig. 3b). The CpG ODN 2006 and DSP30 showed ≈4·5-fold higher induction over control ODN. The CpG ODN 1668, which is known powerfully to activate murine APCs,18 triggered poorly CpG-dependent cytokine release (Fig. 3b). We conclude that bacterial DNA and CpG ODN cause human PBMC to produce cytokines in a sequence-dependent manner, without the need for direct intracellular transfection techniques.

image

Figure 3. EC DNA and CpG ODN induce cytokine release from PBMC. PBMC (5×106/ml) were cultured in 24-well plates with EC DNA, CT DNA, or 2 μm of CpG ODN or their controls. Supernatants were collected and assayed for TNF-α after 8 hr and IL-6 or IL-12 after 24 hr by ELISA. The data are reported as the mean of duplicates and are representative for at least three independent experiments. (a) The closed symbols represent stimulation with EC DNA (●), and open symbols with CT DNA (○). (b) The filled bars represent cultures stimulated with CpG ODN and open bars represent cultures stimulated with the respective GpC controls. ND represents not detectable.

Download figure to PowerPoint

To investigate the cellular source of cytokine release from PBMC, we treated purified monocytes and B cells with EC DNA or CpG ODN. No cytokine production by B cells was observed (data not shown). Monocytes dose dependently secreted IL-6, IL-12 and TNF-α in response to EC DNA but not in response to CT DNA (Fig. 4a). CpG ODN were also effective in inducing IL-6 and IL-12 but not TNF-α from purified monocytes, while the control GpC ODN were essentially negative. We conclude that monocytes are responsible for cytokine release from PBMC.

image

Figure 4. EC DNA or CPG ODN stimulates monocytes to produce cytokines. Monocytes (1×106/ml) were stimulated with EC DNA, CT DNA, or 2 μm of CpG ODN or their controls. The cytokine release was determined as in Fig. 3. (a) The closed symbols represent stimulation with EC DNA (●), and the open symbols with CT DNA (○). (b) The filled bars represent cultures stimulated with CpG ODN; and the open bars, those stimulated with the respective GpC controls. ND represents not detectable.

Download figure to PowerPoint

Oligonucleotides induce up-regulation of surface receptors on monocytes and B cells

Effective antigen presentation is a requirement for the initiation of a productive immune response. APC activation includes elevated antigen processing and presentation via MHC I and MHC II and up-regulation of cell surface costimulatory receptors like CD86 and CD40.18 To determine the effects of bacterial DNA or CpG ODN on these cell surface markers, purified populations of monocytes and B cells were stimulated. The mock stimulation was cells cultured with medium only. After stimulation the cells were stained with anti-CD86, anti-CD40, anti-HLA-DR, or a monoclonal antibody (mAb) against a monomorphic epitope of HLA-A, -B and -C. Example histograms of CD86-staining of monocytes cultured with medium (untreated), ODN 2006 and 2006K were overlayed in Fig. 5. A clear shift in the CD86 expression was apparent, yielding a stimulation index of 3·6 (see the Materials and Methods). Various stimuli were tested on B cells and monocytes and the stimulation indices are given in Table 1.

image

Figure 5. Example of surface receptor up-regulation by CpG ODN. Monocytes were cultured with medium alone (untreated), ODN 2006 (2006) or ODN 2006K (2006K) and stained on day 1 for CD86 expression.

Download figure to PowerPoint

Table 1.  . Effects of DNA and ODN on the expression of surface markers on monocytes and on B cells Thumbnail image of

EC DNA, but not CT DNA, induced marked CD86, CD40 and MHC class I and II expression on monocytes (Table 1). LPS was used as a positive control and served as a comparison. CpG ODN also induced up-regulation of all four markers. Up-regulation of CD86 and MHC class I and II was CpG dependent, however, the 1668 sequence was weak relative to that of 2006 or DSP30. CD40 became up-regulated, but also in response to control GpC ODN. On B cells a similar pattern of marker up-regulation was observed (Table 1), but the stimulation was generally weaker compared to the effects on monocytes, especially for MHC class I and HLA-DR. In addition, B cells, relative to monocytes, were more sensitive to the effects mediated by control GpC ODN. We conclude that both cell types were stimulated by oligonucleotides to up-regulate costimulatory molecules, yet monocytes additionally up-regulate MHC class I and II molecules and appear to be more restricted to CpG versus GpC than B cells. With regard to the cell surface markers tested, induction of CD40 appeared less dependent on the CpG motif for both monocytes and B cells.

DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. References

Our results show that prokaryotic DNA and CpG ODN are stimulatory for some human immune cells and that maximal responsiveness was dependent on their primary CpG sequence. The mixed cell population within human PBMC respond by cytokine secretion and proliferation (Figs 1 and 3). On further study, we showed that bacterial DNA and CpG ODN are mitogenic for B cells (Fig. 2), while T cells were non-responsive (not shown). In contrast, stimulated monocytes were identified as producers of IL-12, IL-6 and TNF-α. In addition, both B cells and monocytes up-regulate cell surface costimulation. The possibility that contaminating LPS influences the observed effects was eliminated by including the non-signalling LPS competitor 406 in control assays and through the use of DNaseI digested DNA, vertebrate DNA, or GpC ODN as negative controls. Overall these data demonstrate that, analogous to the mouse, human B cells and monocytes respond to bacterial DNA and CpG DNA.

Although a few studies have focused on the immunostimulatory potential of single-stranded DNA, only two have used a control ODN to determine CpG selectivity.17, 20 Yamamoto et al. clearly documented IFN production from PBMC when using the MY-1 bacterial DNA fraction and reproduced this result with ODN containing stimulatory hexamer palindromes.28 In retrospect all three ODN contained a CpG, however, only two were stimulatory and one was negative. The six-mer central palindrome was thought to be relevant and an explanation was not given for why one ODN was negative. Ballas et al. examined mouse and human NK cell cytotoxicity and by using CpG to GpC conversion claimed CpG dependency, however, multiple changes outside the CpG were always included.20 Branda et al. first documented B-cell mitogenicity by a rev-antisense sequence (containing three CpG).29 This sequence was also used by Liang et al. and named DSP30 (the nomenclature used here).30 Although both studies speculated that CpG motifs could be relevant, this question was not tested experimentally. Roman et al. used a sequence taken from the pUC19 vector, which contained the putative active motif AACGTT, as well as two other CpG.17 They controlled for CpG by converting C to G and clearly showed CpG dependence for production of IFN-α, IFN-γ and, to a lesser extent, IL-12 by PBMC. However, the target cells were transfected with the CpG ODN by DOTAP and the dependency of the results on this protocol have not been addressed. In accordance with our observations they did not observe TNF-α production upon CpG ODN stimulation, or cytokine production by T cells.

We consistently observed that the CpG ODN 1668 was not as active as DSP30 or 2006, implying that the CpG motif is not sufficient and that flanking sequences influence immune cell activation (Figs 1 and 3 and Table 1). Additionally, we have examined many other sequences and concluded that the presence of CpG was not sufficient for activity (M.B. unpublished data). Liang et al. claimed that mouse cells and human cells respond optimally to different sequences.30 This observation was not supported in the Ballas et al. or Roman et al. studies, although only one sequence was used in the comparisons between mouse and human. In our hands the CpG ODN 1668 is very active on mouse cells but poor in activating human cells. On the other hand, both DSP30 and 2006 are active on human cells but poor in activating murine immune cells (G.B.L. unpublished data). Thus, a difference in motif selectivity between mouse and human can be supported. At what level of cellular interaction this selectivity operates is not known.

Mouse B cells appear not to respond to immobilized CpG ODN, while human B cells reportedly can be stimulated by ODN covalently linked to Sepharose beads.7, 30 It has thus been postulated that human cells respond to ODN via surface receptors.30 More recent data suggest that chloroquine or quinacrine, known to inhibit endosomal maturation but not ODN surface interaction or uptake, efficiently block ODN-triggered human B-cell proliferation (Fig. 2b).32, 33 These data imply that CpG ODN must enter into the endosomal/lysosomal compartment before signalling can occur. We have determined that the CpG ODN 2006 is taken up by human monocytes with rapid and saturable kinetics, while uptake could not be demonstrated in T cells (M.B. unpublished data). It will be of use to analyse chloroquine-‘sensitive’ versus -‘insensitive’ CpG DNA-mediated signalling in human monocytes to dissect the signalling pathways initiated by cell surface receptors as opposed to intracellular receptors.

B cells were more liberal in their responsiveness to the control ODN, especially with regard to the induction of cell surface marker changes (Table 1). This observation may be explained by the non-specific effects of ODN phosphorothioate modification.30 Alternatively, B cells may be more responsive to the postulated cell surface DNA receptors which may be less CpG dependent. Induction of cytokine release by monocytes on the other hand was strongly dependent on CpG motifs, a finding also noted in the rodent system (G.B.L. unpublished data).

Several recent studies have demonstrated a Th1-biasing effect of CpG ODN in the mouse.19, 23[24][25][26]–27 The demonstration that IL-12 is released by human monocytes supports the idea that CpG ODN may promote Th1-polarized immune responses in humans (Figs 3, 4). In addition, antigen-presenting MHC molecules and costimulatory molecules are up-regulated on mouse APC, such as dendritic cells.18 The present study is the first to demonstrate this adjuvant-like effect in human monocytes. If it turns out that bacterial DNA, and thereof derived CpG ODN, act as ‘natural adjuvants’ towards human DCs, there may be a justification to analyse the adjuvanticity of these novel compounds in primates and in clinical interventions.

References

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. References
  • 1
    Tokunaga T., Yamamoto H., Shimada S. et al. 1984 Antitumor activity of deoxyribonucleic acid fraction from Mycobacterium bovis BCG. I. Isolation, physicochemical characterization, and antitumor activity. J Natl Cancer Inst 72 955
  • 2
    Shimada S., Yano O. & Tokunaga T.1986 In vivo augmentation of natural killer cell activity with a deoxyribonucleic acid fraction of BCG. Jpn J Cancer Res 77 808
  • 3
    Yamamoto S., Kuramoto E., Shimada S. & Tokunaga T.1988 In vitro augmentation of natural killer cell activity and production of interferon-alpha/beta and -gamma with deoxyribonucleic acid fraction from Mycobacterium bovis BCG. Jpn J Cancer Res 79 866
  • 4
    Messina J.P., Gilkeson G.S. & Pisetsky D.S.1991 Stimulation of in vitro murine lymphocyte proliferation by bacterial DNA. J Immunol 147 1759
  • 5
    Yamamoto S., Yamamoto T., Shimada S. et al. 1992 DNA from bacteria, but not from vertebrates, induces interferons, activates natural killer cells and inhibits tumor growth. Microbiol Immunol 36 983
  • 6
    Tokunaga T., Yano O., Kuramoto E. et al. 1992 Synthetic oligonucleotides with particular base sequences from the cDNA encoding proteins of Mycobacterium bovis BCG induce interferons and activate natural killer cells. Microbiol Immunol 36 55
  • 7
    Krieg A.M., Yi A.K., Matson S. et al. 1995 CpG motifs in bacterial DNA trigger direct B-cell activation. Nature 374 546
  • 8
    Bird A.P.1986 CpG-rich islands and the function of DNA methylation. Nature 321 209
  • 9
    Klinman D.M., Yamshchikov G. & Ishigatsubo Y.1997 Contribution of CpG motifs to the immunogenicity of DNA vaccines. J Immunol 158 3635
  • 10
    Lipford G.B., Heeg K. & Wagner H.1998 Bacterial DNA as immune cell activator. Trends Microbiol 6 496
  • 11
    Stacey K.J., Sweet M.J. & Hume D.A.1996 Macrophages ingest and are activated by bacterial DNA. J Immunol 157 2116
  • 12
    Sato Y., Roman M., Tighe H. et al. 1996 Immunostimulatory DNA sequences necessary for effective intradermal gene immunization. Science 273 352
  • 13
    Halpern M.D., Kurlander R.J. & Pisetsky D.S.1996 Bacterial DNA induces murine interferon-gamma production by stimulation of interleukin-12 and tumor necrosis factor-alpha. Cell Immunol 167 72
  • 14
    Sparwasser T., Miethke T., Lipford G. et al. 1997 Bacterial DNA causes septic shock. Nature 386 336
  • 15
    Lipford G.B., Sparwasser T., Bauer M. et al. 1997 Immunostimulatory DNA: sequence-dependent production of potentially harmful or useful cytokines. Eur J Immunol 27 3420
  • 16
    Chace J.H., Hooker N.A., Mildenstein K.L., Krieg A.M. & Cowdery J.S.1997 Bacterial DNA-induced NK cell IFN-gamma production is dependent on macrophage secretion of IL-12. Clin Immunol Immunopathol 84 185
  • 17
    Roman M., Martin-Orozco E., Goodman J.S. et al. 1997 Immunostimulatory DNA sequences function as T helper-1-promoting adjuvants. Nat Med 3 849
  • 18
    Sparwasser T., Koch E.S., Vabulas R.M. et al. 1998 Bacterial DNA and immunostimulatory CpG oligonucleotides trigger maturation and activation of murine dendritic cells. Eur J Immunol 28 2045
  • 19
    Lipford G.B., Bauer M., Blank C., Reiter R., Wagner H. & Heeg K.1997 CpG-containing synthetic oligonucleotides promote B and cytotoxic T cell responses to protein antigen: a new class of vaccine adjuvants. Eur J Immunol 27 2340
  • 20
    Ballas Z.K., Rasmussen W.L. & Krieg A.M.1996 Induction of NK activity in murine and human cells by CpG motifs in oligodeoxynucleotides and bacterial DNA. J Immunol 157 1840
  • 21
    Yi A.K., Chace J.H., Cowdery J.S. & Krieg A.M.1996 IFN-gamma promotes IL-6 and IgM secretion in response to CpG motifs in bacterial DNA and oligodeoxynucleotides. J Immunol 156 558
  • 22
    Bendigs S., Salzer U., Lipford G.B., Wagner H. & Heeg K.1999 CpG-oligodeoxynucleotides costimulate primary T cells in the absence of APC. Eur J Immunol 291290
  • 23
    Davis H.L., Weeranta R., Waldschmidt T.J., Tygrett L., Schorr J. & Krieg A.M.1998 CpG DNA is a potent enhancer of specific immunity in mice immunized with recombinant hepatitis B surface antigen. J Immunol 160 870
  • 24
    Chu R.S., Targoni O.S., Krieg A.M., Lehmann P.V. & Harding C.V.1997 CpG oligodeoxynucleotides act as adjuvants that switch on T helper 1 (Th1) immunity. J Exp Med 186 1623
  • 25
    Sun S., Kishimoto H. & Sprent J.1998 DNA as an adjuvant: capacity of insect DNA and synthetic oligodeoxynucleotides to augment T cell responses to specific antigen. J Exp Med 187 1145
  • 26
    Zimmermann S., Egeter O., Hausmann S. et al. 1998 CpG oligodeoxynucleotides trigger protective and curative Th1 responses in lethal murine leishmaniasis. J Immunol 160 3627
  • 27
    Kline J.N., Waldschmidt T.J., Businga T.R. et al. 1998 Modulation of airway inflammation by CpG oligodeoxynucleotides in a murine model of asthma. J Immunol 160 2555
  • 28
    Yamamoto T., Yamamoto S., Kataoka T., Komuro K., Kohase M. & Tokunaga T.1994 Synthetic oligonucleotides with certain palindromes stimulate interferon production of human peripheral blood lymphocytes in vitro. Jpn J Cancer Res 85 775
  • 29
    Branda R.F., Moore A.L., Hong R., McCormack J.J., Zon G. & Cunningham-Rundles C.1996 B-cell proliferation and differentiation in common variable immunodeficiency patients produced by an antisense oligomer to the rev gene of HIV-1. Clin Immunol Immunopathol 79 115
  • 30
    Liang H., Nishioka Y., Reich C.F., Pisetsky D.S. & Lipsky P.E.1996 Activation of human B cells by phosphorothioate oligodeoxynucleotides. J Clin Invest 98 1119
  • 31
    Ulmer A.J., Feist W., Heine H. et al. 1992 Modulation of endotoxin-induced monokine release in human monocytes by lipid A partial structures that inhibit binding of 125I-lipopolysaccharide. Infect Immun 60 5145
  • 32
    Macfarlane D.E. & Manzel L.1998 Antagonism of immunostimulatory CpG-oligonucleotides by quinicrine, chloroquine, and structurally related compounds. J Immunol 160 1122
  • 33
    Häcker H., Mischak M., Miethke T. et al. 1998 CpG-DNA specific activation of antigen presenting cells requires stress kinase activity and is preceded by non-specific endocytosis and endosomal maturation. EMBO J 17 6230