SEARCH

SEARCH BY CITATION

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Transposon Tn1546 confers resistance to glycopeptide antibiotics in enterococci and encodes two D,D-peptidases (VanX and VanY) in addition to the enzymes for the synthesis of D-alanyl-D-lactate (D-Ala-D-Lac). VanY was produced in the baculovirus expression system and purified as a proteolytic fragment that lacked the putative N-terminal membrane anchor of the protein. The enzyme was a Zn2+-dependent D,D-carboxypeptidase that cleaved the C-terminal residue of peptidoglycan precursors ending in R-D-Ala-D-Ala or R-D-Ala-D-Lac but not the dipeptide D-Ala-D-Ala. The specificity constants kcat/Km were 17- to 67-fold higher for substrates ending in the R-D-Ala-D-Ala target of glycopeptides. In Enterococcus faecalis, VanY was present in membrane and cytoplasmic fractions, produced UDP-MurNAc-tetrapeptide from cytoplasmic peptidoglycan precursors and was required for high-level glycopeptide resistance in a medium supplemented with D-Ala. The enzyme could not replace the VanX D,D-dipeptidase for the expression of glycopeptide resistance but a G237D substitution in the host D-Ala:D-Ala ligase restored resistance in a vanX null mutant. Deletion of the membrane anchor of VanY led to an active D,D-carboxypeptidase exclusively located in the cytoplasmic fraction that did not contribute to glycopeptide resistance in a D-Ala-containing medium. Thus, VanX and VanY had non-overlapping functions involving the hydrolysis of D-Ala-D-Ala and the removal of D-Ala from membrane-bound lipid intermediates respectively.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Transposon Tn1546 and related elements mediate resistance to the glycopeptide antibiotics vancomycin and teicoplanin by the production of peptidoglycan precursors ending in the depsipeptide D-alanyl-D-lactate (D-Ala-D-Lac) instead of the dipeptide D-Ala-D-Ala (Fig. 1) (Arthur et al., 1996a; Walsh et al., 1996). The substitution leads to a 1000-fold reduction in the affinity of vancomycin for peptidoglycan precursors (Bugg et al., 1991). Extensive replacement of D-Ala-D-Ala by D-Ala-D-Lac in the assembly pathway of peptidoglycan precursors is necessary and sufficient for high-level resistance to vancomycin and teicoplanin (Arthur et al., 1996b). This requires high-level production of the VanH D-Lac dehydrogenase, VanA D-Ala:D-Lac ligase and VanX D,D-dipeptidase (Fig. 1). The latter enzyme hydrolyses D-Ala-D-Ala produced by the host D-alanine:D-alanine ligase Ddl (Reynolds et al., 1994; Wu et al., 1995).

image

Figure 1. . A. Metabolism of peptidoglycan precursors in glycopeptide-resistant enterococci harbouring Tn1546. B. Map of transposon Tn1546 indicating the position of the relevant restriction sites used for plasmid construction. Closed and open arrowheads labelled IRL and IRR indicate the left and right inverted repeats of the transposon respectively. The circles labelled PR and PH indicate the promoters located upstream from vanR and vanH respectively (Arthur et al., 1997). C. Inserts in recombinant plasmids. The inserts are represented by solid bars. The deletion generated by the construction of the vanYMΔ1-45 gene is indicated by an interruption in the bars and the symbol Δ. The arrow labelled aphA-1 indicates the position of the kanamycin resistance gene cassette (Arthur et al., 1992b) used for insertional inactivation of vanX at the HincII or SacII sites. Inserts were introduced into the multiple cloning site of the shuttle vector pAT78 upstream of the cat chloramphenicol acetyltransferase reporter gene to generate transcriptional fusions (Arthur et al., 1992b). Plasmid pAT622 was constructed by replacing the cat gene of pAT610 with the aac(6′)-aph(2′′) gentamicin resistance gene (Arthur et al., 1994).

Download figure to PowerPoint

Resistance to glycopeptides is inducible by vancomycin and teicoplanin and regulated by the VanR–VanS two-component regulatory system (Arthur et al., 1992b). The VanR response regulator is required for the activation of two promoters, PH and PR, that mediate transcription of the resistance (vanH vanA vanX ) and regulatory (vanR vanS) genes respectively (Arthur et al., 1997). Purified VanR binds to DNA at both promoters, and the affinity is increased by phosphorylation (Holman et al., 1994). The VanS histidine protein kinase catalyses ATP-dependent autophosphorylation at a histidine residue and transfer of the phosphate group to an aspartate of VanR (Wright et al., 1993). VanS also stimulates VanR–phosphate dephosphorylation (Wright et al., 1993). This phosphatase activity is thought to be required for negative regulation of the PH and PR promoters in the absence of glycopeptides (Arthur et al., 1997).

Tn1546 also encodes two accessory proteins, VanY and VanZ, that are not required for, but contribute to, high-level resistance to vancomycin and teicoplanin respectively (Arthur et al., 1996b). VanZ confers low-level teicoplanin resistance in the absence of the other resistance proteins by an unknown mechanism (Arthur et al., 1995). VanY is a membrane-associated D,D-carboxypeptidase that hydrolyses the C-terminal D-Ala or D-Lac residue of peptidoglycan precursors but lacks transpeptidase activity (Al-Obeid et al., 1990; Wright et al., 1992; Arthur et al., 1994; Handwerger, 1994). The enzyme contributes to vancomycin resistance in media containing high concentrations of D-Ala, probably because this amino acid penetrates into the cytoplasm and stimulates synthesis of the pentapeptide UDP-MurNAc-L-Ala-γ-D-Glu-L-Lys-D-Ala-D-Ala (Arthur et al., 1994). VanY also contributes to resistance in strains expressing vanH, vanA and vanX at a low level (Arthur et al., 1996b).

In this study, we report the purification of a soluble fragment of VanY, determination of the role of divalent cations for D,D-carboxypeptidase activity and kinetic analysis for various substrates ending in D-Ala or D-Lac. Enterococcal strains producing a soluble fragment of VanY were constructed to evaluate the role of the putative membrane anchor in resistance. Finally, isogenic strains producing either the VanX or VanY D,D-peptidases and mutants derived from these strains were characterized to determine whether VanX is essential for resistance and is a potentially useful target for the development of antimicrobial agents.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Purification of a soluble fragment of VanY

The baculovirus expression system was chosen for the production of VanY, as D,D-carboxypeptidases are ubiquitous in bacterial hosts commonly used for high-level expression of cloned genes (Summers and Smith, 1987). Purification of the D,D-carboxypeptidase led to a 33 kDa protein (Fig. 2) containing the N-terminal sequence NSGTSE that occurs once (positions 46–51) in the deduced sequence of the vanY gene. Thus, the purified protein corresponds to a proteolytic fragment of VanY with a calculated Mr of 29 434 that was designated VanYΔ1-45. The proteolytic cleavage removed the N-terminal cluster of hydrophobic amino acids (positions 4–17) that may correspond to a membrane anchor (Arthur et al., 1992a).

image

Figure 2. . SDS–polyacrylamide gel (12%) analysis of VanYΔ1-45 purification. Lanes: 1, molecular mass markers (kDa); 2, osmotically lysed extract; 3, pooled active fractions from anion exchange chromatography column; 4, pooled active fractions from hydrophobic interaction chromatography column desalted and concentrated by ultrafiltration.

Download figure to PowerPoint

Optimal conditions for D,D-carboxypeptidase activity

Determination of D-Ala released from the pentapeptide L-Ala-γ-D-Glu-L-Lys-D-Ala-D-Ala (1 and 10 mM) indicated that VanYΔ1-45 was active in bis-Tris 100 mM (pH 7.0) in the absence of any added cofactor. However, bovine serum albumin (BSA) at 0.1% was systematically added to the buffers used for enzyme dilution and determination of activity, because incubation of diluted samples of VanYΔ1-45 in the absence of BSA resulted in a time-dependent decrease in activity (data not shown). D,D-carboxypeptidase activity was similar at pH 7.0 in 100 mM Tris, bis-Tris, phosphate or HEPES buffer. The addition of NaCl (up to 100 mM) to bis-Tris buffer (100 mM, pH 7.0) had no effect, whereas NaCl at 500 mM reduced the activity by approximately 50%. The optimal pH for activity was 7.5 (Fig. 3). All subsequent kinetic analyses were performed in bis-Tris 100 mM, pH 7.0, containing 0.1% BSA. This suboptimal pH was chosen, as the rate of spontaneous hydrolysis of depsipeptides increases with increasing pH (Wu et al., 1995).

image

Figure 3. . Effect of pH on VanYΔ1-45 D,D-carboxypeptidase activity at 37°C. The highest level of activity obtained at pH 7.5 was defined as 100%.

Download figure to PowerPoint

Effect of metal cations on D,D-carboxypeptidase activity

VanYΔ1-45 (550 nM) was incubated at 37°C with EDTA (0, 1, 4 and 20 mM) for various periods of time (0–120 min), and residual D,D-carboxypeptidase activity was determined after a 200-fold dilution of the enzyme EDTA mixture. Time-dependent inactivation of the enzyme occurred at all EDTA concentrations but not in the control devoid of EDTA (data not shown). Inactivation was complete (> 95%) after 60 min with 4 mM and 20 mM EDTA. The effect of ZnCl2, MgCl2, CaCl2 and KCl was analysed for preincubations of 120 min in the absence or in the presence of EDTA at 4 mM (Table 1). The activity of VanYΔ1-45 preincubated in the absence of EDTA was not stimulated by metal cations, and ZnCl2 was inhibitory at concentrations greater than 0.4 mM. D,D-carboxypeptidase activity was not detectable in the enzyme preparation treated with EDTA unless ZnCl2, MgCl2 or CaCl2 was added to the reaction. KCl had no effect. ZnCl2 (0.08 mM) and CaCl2 (10 mM) restored enzyme activity fully. These results indicate that VanYΔ1-45 requires divalent cations for activity.

Table 1. . Effect of metal cations at various concentrations on the activity of VanYΔ1-45 preincubated in the presence or absence of EDTA.a a. VanYΔ1-45 (550 nM) was preincubated for 120 min without EDTA (− EDTA) or with 4 mM of EDTA (+ EDTA), and residual activity was determined after a 200-fold dilution of enzyme and EDTA. The substrate was L-Ala-γ-D-Glu-L-Lys-D-Ala-D-Ala at 10 mM.b. This value was taken as 100% of activity.ND, not detectable.Thumbnail image of

Substrate specificity of VanYΔ1-45

Kinetic characterization of VanYΔ1-45 D,D-carboxypeptidase activity using pentapeptide L-Ala-γ-D-Glu-L-Lys-D-Ala-D-Ala as a substrate revealed a catalytic constant kcat of 290 s−1, a Km Michaelis constant of 9.6 mM and a kcat/Km specificity constant of 30 mM−1 s−1 (Table 2). Comparison of three pairs of substrates ending in residue X, where X was either D-Ala or D-Lac, showed that the specificity constants (kcat/Km) were higher for peptides than for depsipeptides with a 67-fold difference for Nα-acetyl-L-Lys-D-Ala-X, 18-fold for Nα,Nε-diacetyl-L-Lys-D-Ala-X and 17-fold for UDP-MurNAc-L-Ala-γ-D-Glu-L-Lys-D-Ala-X. The difference between the Nα-acetyl-L-Lys-D-Ala-X esterase and peptidase activities resulted predominantly from a difference in Km. For the other substrates, kcat and Km could not be compared, as the Km was much greater than the highest concentration of D-Lac-ending substrates that could be tested. These results indicate that VanYΔ1-45 preferentially hydrolyses peptidoglycan precursors ending in the target of glycopeptides.

Table 2. . Kinetic parameters for the hydrolysis of peptides and depsipeptides by VanYΔ1-45.a a. Estimates of Km, kcat, kcat/Km and their standard deviations were obtained by least-squares-fit methods as described in Experimental procedures.b. Estimates of Km and kcat were based on concentrations that did not exceed or did not significantly exceed Km.c.Km was much greater than the highest concentration of substrate that could be tested, and kcat could not be determined (ND).Thumbnail image of

The specificity constant was 14-fold higher for Nα-acetyl-L-Lys-D-Ala-D-Ala than for Nα,Nε-diacetyl-L-Lys-D-Ala-D-Ala, mostly because of a difference in Km. The kcat/Km was also higher (fourfold) for Nα-acetyl-L-Lys-D-Ala-D-Lac than for Nα,Nε-diacetyl-L-Lys-D-Ala-D-Lac. These observations indicate that peptidoglycan precursors containing a lysine residue with a free ε amino group are preferentially hydrolysed by VanYΔ1-45.

Incubation of 3.6 μM VanYΔ1-45 with 100 mM D-Ala-D-Ala did not result in any detectable release of D-Ala in 80 min. Under the same conditions, hydrolysis of L-Ala-γ-D-Glu-L-Lys-D-Ala-D-Ala (64 mM) could be detected with a 104-fold lower enzyme concentration, indicating that the dipeptide was not a substrate of VanYΔ1-45.

Tetrapeptide UDP-MurNAc-L-Ala-γ-D-Glu-L-Lys-D-Ala (12 mM) was incubated with VanYΔ1-45 (3.6 μM) for 2 h. Release of D-Ala was not detected, indicating that the enzyme did not produce any tripeptide UDP-MurNAc-L-Ala-γ-D-Glu-L-Lys from the tetrapeptide. Thus, VanYΔ1-45 had no L,D-carboxypeptidase activity.

Tetrapeptide UDP-MurNAc-L-Ala-γ-D-Glu-L-Lys-D-Ala (3–17 mM) had no effect on the hydrolysis of L-Ala-γ-D-Glu-L-Lys-D-Ala-D-Ala (2 mM), UDP-MurNAc-L-Ala-γ-D-Glu-L-Lys-D-Ala-D-Ala (4 mM), UDP-MurNAc-L-Ala-γ-D-Glu-L-Lys-D-Ala-D-Lac (4 mM) or Nα,Nε-diacetyl-L-Lys-D-Ala-D-Ala (8 mM). The hydrolysis of D-Ala- or D-Lac-ending precursors at the same concentrations was not affected by the presence of D-Lac (10 and 20 mM) or D-Ala (1–21 mM) respectively. These results indicate that VanYΔ1-45 was not inhibited by the hydrolysis products of the peptides or depsipeptides.

The velocity of hydrolysis of L-Ala-γ-D-Glu-L-Lys-D-Ala-D-Ala (8 mM), Nα,Nε-diacetyl-L-Lys-D-Ala-D-Ala (20 mM) and UDP-MurNAc-L-Ala-γ-D-Glu-L-Lys-D-Ala-D-Lac (10 mM) was proportional to the VanYΔ1-45 concentration in the 1.1–22, 11–220 and 49–1000 nM ranges respectively. This control was performed to establish that different multimeric forms of VanYΔ1-45 with different specific activities did not exist in the range of enzyme concentrations used to compare the different substrates.

Construction and transcriptional analysis of enterococcal strains harbouring wild-type vanY or a truncated form of the gene

The vanYMΔ1-45 gene was constructed by replacing the first 45 codons and sequence upstream from vanY with an ATG preceded by a ribosome binding site. The deduced product of vanYMΔ1-45 is expected to be identical to proteolytic fragment VanYΔ1-45 obtained in the baculovirus expression system, except for the presence of an additional N-terminal methionine. Production of VanY and VanYMΔ1-45 in enterococci was analysed using two expression systems. In E. faecalis JH2-2, the regulatory and resistance genes are carried by the same multicopy plasmid vector, leading to constitutive cis-activation of the PH promoter (Figs 1 and 4) (Arthur et al., 1992b). In BM4311(vanRS), vanR and vanS are located in the chromosome, resulting in inducible trans-activation of the transcription of the plasmid-borne resistance genes. Regulation of VanX synthesis in the latter system is similar to that observed for the natural plasmid pIP816-1 (Fig. 4B) (Arthur et al., 1996b).

image

Figure 4. . Enzyme activity in extracts of E. faecalis strains harbouring various plasmids. Chloramphenicol acetyltransferase (A), VanX D,D-dipeptidase (B) and VanY D,D-carboxypeptidase (C and D) activities were determined in cytoplasmic and membrane fractions. Induction was performed with 50 μg ml−1 vancomycin for all strains except for the glycopeptide-susceptible strain BM4311(RS)/pAT613(ΔPHvanHAXY ) (1 μg ml−1). The results shown are the means and standard deviations from three independent experiments. Units of activity are nmol min−1 mg−1 protein.

Download figure to PowerPoint

The trans-activation system was used to determine whether vanY was transcribed from the PH promoter. Plasmid pAT613(ΔPH HAXY ) was constructed by deleting the EcoRI–AccI fragment carrying PH in pAT612(HAXY ) (Fig. 1). The deletion abolished synthesis of the VanX and VanY D,D-peptidases and expression of the chloramphenicol acetyl transferase gene (cat ) that was transcriptionally fused to the 5′ end of the vanZ gene (Fig. 4). These results and previous transcriptional analyses of Tn1546 (Arthur et al., 1992b; 1997) indicate that vanH, vanA, vanX, vanY and vanZ form an operon transcribed from the PH promoter.

Replacement of vanY by vanYMΔ1-45 in the cis- and trans-activation expression systems was not associated with any significant alteration in CAT or VanX activities under inducing and non-inducing conditions (Fig. 4A and B). As the vanX and cat genes are located immediately upstream and downstream, respectively, of the D,D-carboxypeptidase genes (Fig. 1), these results indicate that the operons comprising vanY or vanYMΔ1-45 are transcribed at similar levels.

D,D-carboxypeptidase activity in crude extracts from enterococci

D,D-carboxypeptidase activity was higher in membrane than in cytoplasmic fractions of strains harbouring the wild-type vanY gene 7.4- and 6.4-fold for non-induced and induced JH2-2/pAT382(vanRSHAXY ) respectively, 6.3-fold for induced BM4311(vanRS)/pAT612(vanHAXY ) and 5.6-fold for induced BM4110/pIP816-1(Tn1546 on a natural plasmid) (Fig. 4C and D). In contrast, D,D-carboxypeptidase activity was only detected in the cytoplasmic fractions of strains harbouring the vanYMΔ1-45 gene. The ratios of VanYMΔ1-45 to VanY activities in the cytoplasmic fractions ranged from 73% to 48% for the cis- and trans-activated systems (Fig. 4C). These results indicate that vanYMΔ1-45 encodes a functional D,D-carboxypeptidase located in the cytoplasm. Expression of vanY and vanYMΔ1-45 led to similar levels of D,D-carboxypeptidase activity in the cytoplasmic fractions.

Peptidoglycan precursor analysis

Cytoplasmic peptidoglycan precursors were extracted from strains after growth in the presence of vancomycin to induce transcription of the resistance genes and treatment with ramoplanin to obtain accumulation of the precursors after inhibition of the addition of N-acetylglucosamine to lipid intermediate I (Somner and Reynolds, 1990). JH2-2/pAT85(vanRSHAXΩaphA-1) and BM4311(vanRS)/pAT610(vanHA) were susceptible to glycopeptides and produced large amounts of the pentapeptide UDP-MurNAc-L-Ala-γ-D-Glu-L-Lys-D-Ala-D-Ala in addition to the pentadepsipeptide UDP-MurNAc-L-Ala-γ-D-Glu-L-Lys-D-Ala-D-Lac (Table 3). In these strains, D-Ala-D-Lac produced by VanA and D-Ala-D-Ala produced by Ddl competed for incorporation into peptidoglycan precursors (Fig. 1). Hydrolysis of D-Ala-D-Ala by VanX in JH2-2/pAT80(vanRSHAX ) and BM4311(vanRS)/pAT87(vanHAX ) led to a drastic reduction of UDP-MurNAc-pentapeptide synthesis and high-level resistance to glycopeptides (Table 3). The tetrapeptide UDP-MurNAc-L-Ala-γ-D-Glu-L-Lys-D-Ala was detected in JH2-2/pAT382(vanRSHAXY ) and BM4311(vanRS)/pAT612(vanHAXY ), indicating that the VanY D,D-carboxypeptidase hydrolysed cytoplasmic peptidoglycan precursors. The production of VanY was not associated with any increase in the level of vancomycin resistance, but the enzyme was required for high-level resistance to the combination of vancomycin and D-alanine. Production of cytoplasmic VanYMΔ1-45 in JH2-2/pAT611(vanRSHAXYMΔ1-45 ) and BM4311(vanRS)/pAT609(vanHAXYMΔ1-45 ) led to the accumulation of UDP-MurNAc-tetrapeptide in larger amounts than in the isogenic strains producing wild-type VanY. Thus, hydrolysis of soluble cytoplasmic precursors occurred to a greater extent in strains producing VanYMΔ1-45 than in those producing VanY. However, VanYMΔ1-45 did not confer resistance to the vancomycin–D-alanine combination.

Table 3. . Resistance phenotype and peptidoglycan precursors of E. faecalis strains harbouring various plasmids. a. The minimal inhibitory concentrations (MICs) of vancomycin (Vm) were determined in the absence (−D-Ala) or in the presence (+D-Ala) of D-Ala at 100 mM.b. Strains were grown in broth supplemented with vancomycin (4 μg ml−1) and spectinomycin (60 μg ml−1) except for JH2-2 (no antibiotic added); JH2-2/pAT85, BM4311/pAT610 and BM4311/pAT620 (0.5 μg ml−1 vancomycin and 60 μg ml−1 spectinomycin); BM4311/pAT87 (4 μg ml−1 vancomycin and 30 μg ml−1 spectinomycin); BM4311(vanRS; ddlG239D)/pAT620 (4 μg ml−1 vancomycin); and BM4311(vanRS; ddlG239D)/pAT622 (1 μg ml−1 vancomycin). Tri, tripeptide UDP-MurNAc-L-Ala-γ-D-Glu-L-Lys; Tetra, tetrapeptide UDP-MurNAc-L-Ala-γ-D-Glu-L-Lys-D-Ala; Pentadepsi, pentadepsipeptide UDP-MurNAc-L-Ala-γ-D-Glu-L-Lys-D-Ala-D-Lac; Penta, pentapeptide UDP-MurNAc-L-Ala-γ-D-Glu-L-Lys-D-Ala-D-Ala.ND, not detected.Thumbnail image of

Resistance to glycopeptides in the absence of VanX

The vanX gene of various plasmids was inactivated by deletion or insertion of the aphA-1 kanamycin resistance gene (Fig. 1). Strains BM4311(vanRS)/pAT620(vanHAXΩaphA-1YZ) and JH2-2/pAT619(vanRSHAXΩaphA-1YZ) were susceptible to glycopeptides, indicating that VanY cannot substitute for VanX (Table 4; data not shown). Spontaneous vancomycin-resistant mutants of BM4311(vanRS)/pAT610(vanHA) and BM4311(vanRS)/pAT620(vanHAXΩaphA-1YZ) were obtained on media containing 8 μg ml−1 vancomycin. The frequency of the mutants and the levels of vancomycin resistance were higher for the strain that harbours the complete set of van genes, suggesting that VanY contributes to vancomycin resistance in the mutants.

Table 4. . Characteristics of derivatives of BM4311(vanRS) harbouring various plasmids. a. Spontaneous mutants were selected on agar containing 8 μg ml−1 vancomycin.b. The minimal inhibitory concentrations (MICs) of vancomycin (Vm) were determined in the absence of D-alanine.c. Production of the VanX D,D-dipeptidase (X) and VanY D,D-carboxypeptidase (Y) was inducible by vancomycin (data not shown).d. The frequency corresponds to the number of colony-forming units (cfu) obtained on agar containing 8 μg ml−1 vancomycin divided by the number of cfu obtained on agar after 48 h of incubation.e. The range of MICs was determined for a minimum of 12 mutants.NA, not applicable.Thumbnail image of

The host D-Ala:D-Ala ligase gene (ddl ) of a mutant derived from BM4311(vanRS)/pAT620(vanHAXΩaphA-1YZ) was amplified and sequenced as described previously (Baptista et al., 1997). The ddl gene contained a mutation leading to a Gly(GGT) to Asp(GAT) substitution at position 239 of the ligase. This Gly residue is highly conserved in other ligases and corresponds to Gly-207 located in the loop connecting the B10β-strand to the H9α-helix in the Escherichia coliD-Ala:D-Ala ligase DdlB (Fan et al., 1994; Evers et al., 1996). The ddlG239D mutant required vancomycin or teicoplanin for growth when tested using the disk diffusion assay. This phenotype is indicative of impaired host D-Ala:D-Ala ligase activity, as ddl null mutants rely entirely on glycopeptide-inducible production of the D-Ala:D-Lac ligase for peptidoglycan synthesis (Fraimow et al., 1994; Rosato et al., 1995; Baptista et al., 1997). Accordingly, the UDP-MurNAc-L-Ala-γ-D-Glu-L-Lys-D-Ala-D-Ala pool dropped from 83% to 4% after acquisition of the ddlG239D mutation by BM4311(vanRS)/pAT620(vanHAXΩaphA-1YZ) (Table 3). The pool of D-Ala-D-Lac was limiting, because the ddlG239D mutant accumulated the tripeptide UDP-MurNAc-L-Ala-γ-D-Glu-L-Lys. Taken together, these observations indicate that the G239D substitution led to impaired D-Ala:D-Ala ligase activity. Thus, the VanX D,D-dipeptidase was not required for resistance if synthesis of D-Ala-D-Ala was reduced. Low-level UDP-MurNAc-pentapeptide synthesis in the ddlG239D mutants that did not produce VanX may originate either from the weak D-Ala:D-Ala ligase activity of VanA (Bugg et al., 1991) or from residual activity of the host ligase DdlG239D.

To compare the expression of the vanHA and vanHAXΩaphA-1YZ operons in a host harbouring the same ddl mutation, the cat gene of pAT620(vanHA) was replaced by the aac(6′)aph(2′′) gentamicin resistance gene (Fig. 1). The resulting plasmid pAT622(vanHA) was introduced into BM4311(vanRS; ddlG239D)/pAT620(vanHAXΩaphA-1YZcat ). Replacement of pAT620 by pAT622 was obtained in transformants selected on gentamicin, as these plasmids were incompatible. Plasmid pAT622(vanHA) conferred low-level vancomycin resistance to BM4311(vanRS; ddlG239D), indicating that the vanY gene of pAT620(vanHAXΩaphA-1YZcat ) was contributing to resistance in this host (Table 3).

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Characterization of VanY (Table 1) and VanX (Wu and Walsh, 1995; Wu et al., 1995) showed that Tn1546 encodes two metallo D,D-peptidases. The proteins do not display significant primary sequence similarity except for the presence of amino acid motifs SxHxxGxAxD and ExxH that may be involved in Zn2+ co-ordination and catalysis (McCafferty et al., 1997). These motifs are conserved in several enzymes involved in peptidoglycan metabolism, including the Streptomyces albus G D,D-carboxypeptidase-endopeptidase (McCafferty et al., 1997).

The host D-Ala:D-Ala ligase Ddl and VanX are most probably cytoplasmic enzymes acting on freely diffusible substrates. In contrast, VanY was proposed as being anchored to the membrane via an N-terminal cluster of hydrophobic amino acids (Al-Obeid et al., 1990; Arthur et al., 1992a; Wright et al., 1992). In agreement with this notion, VanYMΔ1-45 was found to be located exclusively in the cytoplasm (Fig. 4).

VanYΔ1-45 hydrolysed various tripeptides and pentapeptides but not dipeptide D-Ala-D-Ala (Table 2). In contrast, VanX hydrolyses dipeptides with free amino- and carboxy-termini exclusively (Reynolds et al., 1994). Thus, the substrate specificities of VanX and VanY do not overlap, indicating that the peptidases do not act in parallel but in series.

Analysis of E. faecalis strains producing VanX and VanY, alone or in combination, showed that VanY cannot replace VanX for the expression of glycopeptide resistance (Table 3). In the absence of VanX, dipeptide D-Ala-D-Ala was preferentially incorporated into peptidoglycan precursors, and the hydrolysis of D-Ala-D-Ala-ending precursors by VanY was not sufficient for resistance. The ddlG239D mutation reduced the level of synthesis of D-Ala-D-Ala and restored the resistance of the vanX null mutant. VanY contributed to resistance in this host background, indicating that residual D-Ala-D-Ala-ending precursors were hydrolysed efficiently by the D,D-carboxypeptidase.

Depsipeptide D-Ala-D-Lac is not a substrate of VanX, whereas VanY hydrolysed both peptide and ester bonds (Wright et al., 1992; Reynolds et al., 1994; Wu et al., 1995). Preferential hydrolysis of peptides by VanYΔ1-45 (Table 2) is compatible with the notion that VanY contributes to glycopeptide resistance by hydrolysing peptidoglycan precursors containing the D-Ala-D-Ala target of the antibiotics. However, D-Ala-D-Lac-ending precursors are also expected to be hydrolysed, albeit at a lower rate. Tetrapeptide production did not appear, in itself, to be deleterious for the bacterium, probably because this type of precursor can be incorporated into the wall and act as an acceptor in transpeptidation reactions. The extent of peptidoglycan cross-linking may be sufficient for cell wall integrity, provided that enough D-Ala-D-Lac-ending precursors are present to act as donors. Elimination of D-Ala-D-Ala-ending precursors is thought to be critical for resistance, as binding of glycopeptides to lipid intermediate II at the outer surface of the membrane is expected to sequester the lipid carrier, thereby preventing the incorporation of D-Ala-D-Lac-ending precursors into nascent peptidoglycan (Arthur et al., 1996b; Baptista et al., 1997). Thus, the elimination of pentapeptide by VanY, even at the expense of the formation of some tetrapeptide from pentadepsipeptide, may increase the level of glycopeptide resistance.

Production of VanY led to a 32-fold increase in the level of vancomycin resistance in media containing 100 mM D-Ala, as described previously (Arthur et al., 1994), but VanYMΔ1-45 had no effect (Table 3). As this difference cannot be attributed to a low activity of VanYMΔ1-45 in the cytoplasm or to low-level expression of vanH, vanA and vanX (Fig. 4; Table 3[link]), the hydrolysis of UDP-MurNAc-L-Ala-γ-D-Glu-L-Lys-D-Ala-D-Ala by VanY was not essential for resistance to the vancomycin/D-alanine combination. Hydrolysis of D-Ala-D-Ala-ending precursors by VanY should take place before the translocation of lipid intermediate II to the outer surface of the membrane, as glycopeptides are expected to inhibit pentapeptide hydrolysis. These observations suggest that the physiological substrates of VanY include the lipid intermediates I and II facing the inner surface of the membrane and that the putative membrane anchor of VanY is required to optimize interaction with these substrates. As acetylation of the ε amino group of Lys decreased D,D-carboxypeptidase activity (Table 2), VanY may hydrolyse peptidoglycan precursors preferentially before the addition of the amino acid involved in the formation of the interpeptide bridge (Billot-Klein et al, 1997).

Proteins encoded by Tn1546 are potential targets for developing an inhibitor that could restore the activity of glycopeptides against resistant enterococci. Partial inhibition of the resistant pathway may be sufficient for activity, as co-production of pentapeptide and pentadepsipeptide leads to susceptibility to the drugs (Arthur et al., 1996b). However, a successful strategy should also prevent the emergence of mutants resistant to the drug combination, and none of the proteins encoded by Tn1546 appear to be a safe target according to this criterion. Three out of the seven Tn1546-encoded proteins (VanS, VanY and VanZ) are not required for resistance (Arthur et al., 1996b; 1997). VanR and VanH are each essential for resistance, but spontaneous mutations can compensate for inactivation of the corresponding genes (Arthur et al., 1992b; unpublished results). Inhibition of the VanA ligase may probably be overcome by mutations in the host D-Ala:D-Ala ligase, as single amino acid substitutions in the E. coli DdlB ligase can result in a gain in D-Ala:D-Lac ligase activity (Park et al., 1996). Finally, we have shown in this report that a mutation in the E. faecalis ddl gene can compensate for the insertional inactivation of vanX (Tables 3 and 4). It thus appears that more than one product of the vanA gene cluster should be targeted for drug development. Structural similarity between the products of VanA (D-Ala-D-Lac) and Ddl (D-Ala-D-Ala) as well as between the substrates of VanX (D-Ala-D-Ala) and VanY (R-D-Ala-D-Ala) indicates that this approach may be feasible. In fact, phosphinate inhibitors that mimic the transition states in the D-Ala:D-Ala ligation reaction and D-Ala-D-Ala hydrolysis are potent inhibitors, not only of the D-Ala:D-Ala and D-Ala:D-Lac ligases but also of VanX (Shi and Walsh, 1995; Wu and Walsh, 1995).

In conclusion, VanX and VanY have non-overlapping roles in the metabolism of peptidoglycan and in resistance. Hydrolysis of D-Ala-D-Ala by VanX drastically reduced UDP-MurNAc-pentapeptide synthesis, and the hydrolysis of D-Ala-D-Ala-ending precursors by VanY at later stages of cell wall synthesis could not compensate for the absence of VanX. Accordingly, a spontaneous mutation restoring resistance in a vanX null mutant was found to map in the host D-Ala:D-Ala ligase gene. Hydrolysis of UDP-MurNAc-pentapeptide by wild-type VanY in the cytoplasm did not appear to be critical for glycopeptide resistance, as the production of VanYMΔ1-45 led to the accumulation of large amounts of UDP-MurNAc-tetrapeptide and to a null resistance phenotype. We propose that VanY contains an N-terminal membrane anchor that optimizes interaction of the enzyme with the lipid intermediates I and II. Removal of D-Ala from the lipid intermediates may prevent translocation of precursors containing the target of glycopeptides at the cell surface and subsequent sequestration of the lipid carrier in conditions under which small amounts of D-Ala-D-Ala-ending precursors are produced in addition to D-Ala-D-Lac-ending precursors. In agreement with this hypothesis, VanYΔ1-45 was found to display striking differences from other D,D-peptidases. VanYΔ1-45 preferentially hydrolysed peptide bonds, whereas the rate of acylation of penicillin binding proteins is generally significantly higher for depsipeptides than for peptides (Rasmussen and Strominger, 1978). The activity of the exocellular Streptomyces albus G D,D-carboxypeptidase-endopeptidase is significantly enhanced by acetylation of the ε amino group of Lys, but VanYΔ1-45 displayed the opposite preference (Leyh-Bouille et al., 1970).

Experimental procedures

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Strains and growth conditions

Enterococcus faecalis JH2-2 and BM4311(vanRS) were used as hosts for recombinant plasmids (Arthur et al., 1992b). BM4110/pIP816-1 harbours Tn1546 as part of the natural plasmid pIP816-1 (Arthur et al., 1996b). Strains were grown at 37°C in brain–heart infusion (BHI) broth and agar (Difco) supplemented with spectinomycin (60 μg ml−1) to prevent loss of plasmids derived from pAT78. The minimum inhibitory concentrations (MICs) of glycopeptides were determined according to the method of Steers et al. (1959) with 105 cfu per spot on agar after 24 h of incubation.

Plasmid construction

Plasmid DNA isolation, digestion with restriction endonucleases (Boehringer), amplification of DNA by the polymerase chain reaction (PCR) with pfu DNA polymerase (Stratagene), ligation of DNA fragments with T4 DNA ligase (Pharmacia), nucleotide sequencing with T7 DNA polymerase (Pharmacia) and transformation of Escherichia coli JM83 with recombinant plasmids were performed according to standard methods (Ausubel et al., 1987). To construct the vanYMΔ1-45 gene, a portion of vanY was amplified by PCR using DNA of plasmid pAT383 (Arthur et al., 1992a) as a template and oligodeoxyribonucleotides Y1 (Unité de Chimie Organique, Institut Pasteur) and ‘sequencing 17-mer’ (Amersham) as primers. The sequence of Y1 (5′-ATCAGGATCC TGAAAGGAGACAGGAGCATGAATAGTGGGACTTCTGA) contained a BamHI site (italicized), a synthetic ribosome binding site followed by an ATG translation initiation codon (underlined) and 17 bases complementary to codons 46–51 of vanY. The amplified fragment was digested with BamHI (cutting site internal to the primer) and BglII (cutting site in vanY ) and cloned in pUC18 (Yanisch-Perron et al., 1985) to obtain pAT606. The nucleotide sequence of the insert in pAT606 was redetermined. The HindIII fragment carrying the 3′ extremity of vanY in pAT383 (Arthur et al., 1992a) was purified and cloned into pAT606 digested by HindIII to generate plasmid pAT607 containing the entire vanYMΔ1-45 gene.

To facilitate further cloning of vanYMΔ1-45, the BamHI–PstI fragment of pAT607 carrying vanYMΔ1-45 was purified, treated with a DNA blunting kit and inserted in the SmaI site of pUC1813 (Kay and McPherson, 1987). The resulting plasmid, pAT608, was digested with XbaI, the fragment containing vanYMΔ1-45 was purified and cloned into the XbaI site of pAT80(vanRSHAX ) (Arthur et al., 1992b) and pAT87(vanHAX ) (Arthur et al., 1992b) to generate pAT611(vanRSHAXYMΔ1-45 ) and pAT609(vanHAXYM-Δ145 ) respectively (Fig. 1). Plasmids pAT382(vanRSHAXY ), pAT612(vanHAXY ) and pAT613(ΔPHvanHAXY ) were constructed by inserting the XbaI fragment of pAT383 (Arthur et al., 1992a) carrying the wild-type vanY gene into the XbaI site of pAT80(vanRSHAX ) (Arthur et al., 1992b), pAT87(vanHAX ) (Arthur et al., 1992b) and pAT618(ΔPH vanHAX ) (Arthur et al., 1992b) respectively. To obtain pAT610(vanHA), the vanX gene of pAT87(vanHAX ) (Arthur et al., 1992b) was deleted by digestion with SacII and XbaI, treatment with a DNA blunting kit and self-ligation. Plasmid pAT85(vanRSHAXΩaphA-1) is a derivative of pAT80(vanRSHAX ) carrying the aphA-1 kanamycin resistance gene inserted into the HincII site of vanX (Arthur et al., 1992b). Plasmid pAT619(vanRSHAXΩaphA-1YZ) was constructed by replacing the SacII fragment of pAT398(vanRSHAXYZ) (Arthur et al., 1995) carrying vanSHAX with the homologous fragment of pAT85 carrying vanSHAXΩaphA-1. Plasmid pAT620 (vanHAXΩaphA-1YZ) was obtained by inserting aphA-1 in the SacII site of the vanX gene of pAT621(vanHAXYZ).

D,D-carboxypeptidase production and purification

Plasmid pAT605 was constructed by inserting the vanY gene of pAT383 (Arthur et al., 1992a) under the control of the polyhedrin promoter of pVL1392 (Pharminogen) using BamHI and PstI. Insertion of vanY into the baculovirus genome by homologous recombination was obtained by co-transfection of Spodoptera frugiperda (Sf9) cells with AcMNPV viral DNA and plasmid pAT605 (Summers and Smith, 1987). Sf9 cells (approximately 5 × 109) were collected 3 days after infection with the recombinant baculovirus, washed twice in PBS by centrifugation at 500 × g for 5 min at 4°C, resuspended in 30 ml of water and incubated for 10 min at 4°C. The osmotically lysed extract was centrifuged (4000 × g for 10 min at 4°C), and the pellet was resuspended in 24 ml of bis[2-hydroxyethyl]iminotris[hydroxymethyl]methane (bis-Tris) 30 mM (pH 6.0) containing 0.6% CHAPS with frequent shaking for 1 h to solubilize VanY. The extract was centrifuged (15 000 × g for 10 min and 100 000 × g for 45 min at 4°C), and the supernatant was loaded on a 5 ml Q Sepharose column (Pharmacia) for anion exchange chromatography. Elution was performed in 30 mM bis-Tris (pH 6.0) with a linear 0–500 mM NaCl gradient. Active fractions were pooled, the pH was adjusted to 8.0, ammonium sulphate was added to a final concentration of 1.5 M and the fractions were loaded on a 1 ml butyl-Sepharose column (Pharmacia). Elution was performed in 30 mM Tris (pH 8.0) with a 1.5–0 M ammonium sulphate gradient. Active fractions were desalted and concentrated by ultrafiltration on a Centricon membrane with a cut-off of 10 kDa (Amicon).

Reagents for determination of D-Ala and D-Lac

D-alanine was determined using D-amino acid oxidase coupled to peroxidase for the indicator reactions using reagent A prepared by mixing 857 μl of deionized water, 1029 μl of Tris-HCl (50 mM), MgCl2 (4 mM), pH 7.0, 2880 μl of disodium pyrophosphate (100 mM, pH 8.3), 686 μl of flavin adenine dinucleotide sodium salt (0.2 mg ml−1; Sigma), 343 μl of peroxidase diluted 1000-fold in water (3.4 units μl−1, horseradish grade I; Boehringer), 34 μl of D-amino acid oxidase (55 units ml−1, hog kidney; Sigma) and 171 μl of orthodianisidine (5 mg ml−1; Sigma). D-lactate was determined using D-lactate dehydrogenase for the indicator reaction and L-alanine aminotransferase to remove pyruvate using reagent B prepared with 3150 μl of 100 mM bis-Tris, 100 mM L-glutamate (pH 7.0), 262 μl of 47 mM nicotinamide-adenine dinucleotide (Sigma), 52 μl of L-alanine aminotransferase (3.2 units μl−1, porcine heart; Sigma), 1104 μl of 100 mM bis-Tris (pH 7.0) and 52 μl of D-lactate dehydrogenase (8.3 units μl−1, Staphylococcus epidermidis; Sigma). Optical density was recorded at 37°C on a Uvikon 931 spectrophotometer (Kontron) at 460 or 341 nm for D-Ala or D-Lac determinations respectively.

Collection of kinetic data for purified VanYΔ1-45

VanYΔ1-45 was incubated with a substrate at 37°C in the various conditions described below. Aliquots were removed at various times (0–120 min), diluted in 100 mM bis-Tris (pH 7.0) to obtain a final volume of 160 μl and immediately frozen in a dry ice–ethanol bath. The diluted aliquots (160 μl) were unfrozen, 440 μl of reagent A or B was added immediately and the OD460 or OD341, respectively, was recorded as a function of time at 37°C. The amounts of D-Ala or D-Lac were deduced from standard curves obtained with known amounts of D-Ala (0, 5, 10, 20 and 40 nmol; Sigma) or D-Lac (0, 10, 20, 40 and 60 nmol; Sigma) treated under the same conditions.

Effect of pH on vanYΔ1-45 D,D-carboxypeptidase activity

MMHB buffers consisting of 100 mM each of malic acid, 2-(N-morpholino)-ethanesulphonic acid (MES), HEPES and boric acid adjusted to the pH values in the range of pH 4–10 with NaOH were prepared to determine the optimal pH for VanYΔ1-45. MMHB buffer (50 μl) was mixed with 15 μl of BSA (0.667% in H2O) and 10 μl of a 36 nM solution of VanYΔ1-45 prepared in buffer A (100 mM bis-Tris, pH 7.0, 0.1% BSA). The enzyme mixture (75 μl) was preincubated for 20 min at room temperature at the different pH values, 25 μl of L-Ala-γ-D-Glu-L-Lys-D-Ala-D-Ala (40 mM in H2O) was added, the mixture (100 μl) was transferred to 37°C and aliquots were removed for kinetic analysis as described above. The pH values were checked at the end of the reaction. Standard curves were obtained with solutions of D-Ala containing the same buffers adjusted to the same pH values.

Effect of EDTA and metal cations on the D,D-carboxypeptidase activity of VanYΔ1-45

All reagents were treated with Chelex 100 resin to remove trace amounts of metal. VanYΔ1-45 (550 nM) was incubated at 37°C in buffer A (100 mM bis-Tris, pH 7.0, 0.1% BSA) containing EDTA at 0, 1, 4 or 20 mM in a volume of 50 μl. Aliquots (5 μl) were removed after 0, 5, 10, 20, 30, 60, 90 and 120 min of incubation, added to 495 μl of buffer A and frozen in a dry ice–ethanol bath. One microlitre of various solutions of ZnCl2, MgCl2, CaCl2 or KCl was added to 19 μl of enzyme pretreated with EDTA, and the mixture was incubated for 30 min at 37°C. The substrate L-Ala-γ-D-Glu-L-Lys-D-Ala-D-Ala (15 μl of a 20 mM solution in buffer A) was added to 15 μl of the different enzyme preparations preincubated with EDTA and cations. The mixture was incubated at 37°C for 75 min, 130 μl of 100 mM bis-Tris was added and the samples were frozen before D-Ala determination as described above.

Determination of Km and kcat

Stock solutions of commercially available substrates were prepared in 100 mM bis-Tris (pH 7.0) and kept in aliquots at −20°C. Twelve substrate concentrations were tested in the range of 1–64 mM for L-Ala-γ-D-Glu-L-Lys-D-Ala-D-Ala (Sigma) and Nα-acetyl-L-Lys-D-Ala-D-Ala (Bachem); 2–80 mM for Nα-acetyl-L-Lys-D-Ala-D-Lac (Bachem), Nα,Nε-diacetyl-L-Lys-D-Ala-D-Ala (Sigma) and Nα,Nε-diacetyl-L-Lys-D-Ala-D-Lac (Sigma). UDP-MurNAc-L-Ala-γ-D-Glu-L-Lys-D-Ala-D-Ala and UDP-MurNAc-L-Ala-γ-D-Glu-L-Lys-D-Ala-D-Lac were prepared from Staphylococcus aureus and a vancomycin-resistant E. faecium, respectively, and tested in the range of 2–80 mM and 2–38 mM. Enzyme [E] and substrate [S] concentrations were determined by the Bradford method using the Bio-Rad protein assay with BSA as a standard and by amino acid analysis using norleucine as a standard respectively. The substrate concentrations and velocities (V ) were corrected to take into account conversion of substrates into products (Lee and Wilson, 1971). The catalytic and Michaelis constants kcat and Km were deduced from the equation V =kcat[E][S]/Km + [S] by using a computerized least-squares-fit method (Kaleidagraph). If Km was much greater than the highest concentration of substrate that could be tested, the ratio kcat/Km was obtained using the equation V = kcat[E][S]/Km. Linear regression analysis of [S]/V vs. [S] plots were also used to calculate Km and kcat (data not shown). Both methods gave essentially the same results.

Determination of enzyme activity in E. faecalis extracts

CAT, VanX and VanY activities in enterococcal fractions were determined using a continuous assay essentially as described previously (Arthur et al., 1992b; 1996b). Briefly, bacteria were cultured in broth (108 ml) to an optical density at 600 nm of 0.7, harvested and washed by centrifugation (5000 × g for 10 min at 4°C), resuspended in 2.2 ml of 0.1 M phosphate buffer (pH 7.0) containing lysozyme at a final concentration of 2 mg ml−1, incubated for 1 h at 37°C and lysed by sonication. The lysate was centrifuged (100 000 × g for 45 min at 4°C), and the supernatant was collected (cytoplasmic fraction). The pellet was resuspended in 2 ml of 0.1 M phosphate buffer (pH 7.0), centrifuged (100 000 × g for 45 min at 4°C) and resuspended in 2 ml of 0.1 M phosphate buffer (pH 7.0) (membrane fraction). Protein concentration was estimated by the Bradford method using the Bio-Rad protein assay with BSA as a standard. D,D-peptidase activity was determined by adding 75 μl of extracts appropriately diluted in 0.1 M phosphate buffer (pH 7.0) to 525 μl of reagent A containing D-Ala-D-Ala (7.5 mM) for VanX or L-Ala-γ-D-Glu-L-Lys-D-Ala-D-Ala (0.24 mM) and ZnCl2 (5.7 mM) for VanY. Activity was expressed as nmol of D-Ala produced min−1 mg−1 protein in the extract.

Analysis of peptidoglycan precursors

Extraction and analysis of peptidoglycan precursors were performed essentially as described previously (Messer and Reynolds, 1992; Reynolds et al., 1994). Enterococci were grown in broth supplemented with 0.5% yeast extract and appropriate antibiotics to mid-exponential phase (OD600 = 1), ramoplanin (9 μg ml−1) was added and incubation was continued for 0.5 mean generation time. Bacteria were harvested by centrifugation at 12 000 × g for 2 min at 4°C, resuspended in water and treated with 7% trichloroacetic acid for 15 min at 0°C in a final volume of 2 ml. The extract was centrifuged (48 000 × g for 1 min at 4°C), and the supernatant fraction containing the cytoplasmic peptidoglycan precursors was collected. Trichloroacetic acid was neutralized by the addition of solid sodium bicarbonate and salt removed from the extract by gel filtration of 0.5 ml samples on G 10 Sephadex (28 × 1 cm). The eluate was monitored at 252 nm, and cell wall precursors eluted immediately after the void volume of the column. Samples (20 μl) of the fraction containing the cell wall precursors were analysed by high-performance liquid chromatography on a C18 reverse phase column with 0.05 M ammonium acetate (pH 5.03) as the eluant at a flow rate of 0.2 ml min−1 and with the application of a methanol gradient (0–2.5%) in the same buffer between 5 and 45 min. Results were expressed as the percentages of total late peptidoglycan precursors represented by UDP-MurNAc-tripeptide, UDP-MurNAc-tetrapeptide, UDP-MurNAc-pentapeptide, and UDP-MurNAc-pentadepsipeptide that were determined from the integrated peak areas.

Footnotes
  1. Present address: Unité Mixte de Recherche 144, Institut Curie, 12 rue Lhomond, 75005 Paris, France

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

We thank B. Badet, A. Chaffotte, F. Godeau, J. van Heijenoort and M.-R. Popoff for helpful discussions. This work was supported in part by a Bristol-Myers Squibb Unrestricted Biomedical Research Grant in Infectious Diseases.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  • 1
    Al-Obeid, S., Collatz, E., Gutmann, L. (1990) Mechanism of resistance to vancomycin in Enterococcus faecium D366 and Enterococcus faecalis A256. Antimicrob Agents Chemother 34: 252256.
  • 2
    Arthur, M., Molinas, C., Courvalin, P. (1992a) Sequence of the vanY gene required for production of a vancomycin-inducible D,D-carboxypeptidase in Enterococcus faecium BM4147. Gene 120: 111114.
  • 3
    Arthur, M., Molinas, C., Courvalin, P. (1992b) The VanS–VanR two-component regulatory system controls synthesis of depsipeptide peptidoglycan precursors in Enterococcus faecium BM4147. J Bacteriol 174: 25822591.
  • 4
    Arthur, M., Depardieu, F., Snaith, H.A., Reynolds, P.E., Courvalin, P. (1994) Contribution of VanY D,D-carboxypeptidase to glycopeptide resistance in Enterococcus faecalis by hydrolysis of peptidoglycan precursors. Antimicrob Agents Chemother 38: 18991903.
  • 5
    Arthur, M., Depardieu, F., Molinas, C., Reynolds, P., Courvalin, P. (1995) The vanZ gene of Tn1546 from Enterococcus faecium BM4147 confers resistance to teicoplanin. Gene 154: 8792.
  • 6
    Arthur, M., Reynolds, P., Courvalin, P. (1996a) Glycopeptide resistance in enterococci. Trends Microbiol 4: 401407.
  • 7
    Arthur, M., Depardieu, F., Reynolds, P., Courvalin, P. (1996b) Quantitative analysis of the metabolism of soluble cytoplasmic peptidoglycan precursors of glycopeptide-resistant enterococci. Mol Microbiol 21: 3344.
  • 8
    Arthur, M., Depardieu, F., Gerbaud, G., Galimand, M., Leclercq, R., Courvalin, P. (1997) The VanS sensor negatively controls VanR-mediated transcriptional activation of glycopeptide resistance genes of Tn1546 and related elements in the absence of induction. J Bacteriol 179: 97106.
  • 9
    Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A., et al (1987) Current Protocols in Molecular Biology. New York: John Wiley & Sons.
  • 10
    Baptista, M., Depardieu, F., Reynolds, P., Courvalin, P., Arthur, M. (1997) Mutations leading to increased levels of resistance to glycopeptide antibiotics in VanB-type enterococci. Mol Microbiol 25: 93105.
  • 11
    Billot-Klein, D., Shlaes, D., Bryant, D., Bell, D., Legrand, R., Gutmann, L., et al (1997) Presence of UDP-N-acetylmuramyl-hexapeptides and -heptapeptides in enterococci and staphylococci after treatment with ramoplanin, tunicamycin, or vancomycin. J Bacteriol 179: 46844688.
  • 12
    Bugg, T.D.H., Wright, G.D., Dutka-Malen, S., Arthur, M., Courvalin, P., Walsh, C.T. (1991) Molecular basis for vancomycin resistance in Enterococcus faecium BM4147: biosynthesis of a depsipeptide peptidoglycan precursor by vancomycin resistance proteins VanH and VanA. Biochemistry 30: 1040810415.
  • 13
    Evers, S., Casadewall, B., Charles, M., Dutka-Malen, S., Galimand, M., Courvalin, P. (1996) Evolution of structure and substrate specificity in D-alanine:D-alanine ligases and related enzymes. J Mol Evol 42: 706712.
  • 14
    Fan, C., Moews, P.C., Walsh, C.T., Knox, J.R. (1994) Vancomycin resistance: Structure of D-alanine:D-alanine ligase at 2.3 Å resolution. Science 266: 439443.
  • 15
    Fraimow, H.S., Jungkind, D.L., Lander, D.W., Delso, D.R., Dean, J.L. (1994) Urinary tract infection with an Enterococcus faecalis isolate that requires vancomycin for growth. Ann Intern Med 121: 2226.
  • 16
    Handwerger, S. (1994) Alterations in peptidoglycan precursors and vancomycin susceptibility in Tn917 insertions mutants of Enterococcus faecalis 221. Antimicrob Agents Chemother 38: 473475.
  • 17
    Holman, T.R., Wu, Z., Wanner, B.L., Walsh, C.T. (1994) Identification of the DNA-binding site for the phosphorylated VanR protein required for vancomycin resistance in Enterococcus faecium. Biochemistry 33: 46254631.
  • 18
    Kay, R. & McPherson, J. (1987) Hybrid pUC vectors for addition of new restriction enzyme sites to the ends of DNA fragments. Nucleic Acids Res 15: 2778.
  • 19
    Lee, H.-J. & Wilson, I.B. (1971) Enzymic parameters: measurement of V and Km. Biochim Biophys Acta 242: 519522.
  • 20
    Leyh-Bouille, M., Ghuysen, J.-M., Bonaly, R., Nieto, M., Perkins, H.R., Schleifer, K.H., et al (1970) Substrate requirements of the Streptomyces albus G Dd carboxypeptidase. Biochemistry 9: 29612970.
  • 21
    McCafferty, D.G., Lessard, I.A., Walsh, C.T. (1997) Mutational analysis of potential zinc-binding residues in the active site of the enterococcal D-Ala-D-Ala dipeptidase VanX. Biochemistry 36: 1049810505.
  • 22
    Messer, J. & Reynolds, P.E. (1992) Modified peptidoglycan precursors produced by glycopeptide-resistant enterococci. FEMS Microbiol Lett 94: 195200.
  • 23
    Park, I.-L., Lin, C.-H., Walsh, C.T. (1996) Gain of D-alanyl-D-lactate or D-lactyl-D-alanine synthetase activities in three active-site mutants of the Escherichia coli D-alanine-D-alanine ligase B. Biochemistry 35: 1046410471.
  • 24
    Rasmussen, J.R. & Strominger, J.L. (1978) Utilization of a depsipeptide substrate for trapping acyl-enzyme intermediates of penicillin-sensitive D-alanine carboxypeptidases. Proc Natl Acad Sci USA 75: 8488.
  • 25
    Reynolds, P.E., Depardieu, F., Dutka-Malen, S., Arthur, M., Courvalin, P. (1994) Glycopeptide resistance mediated by enterococcal transposon Tn1546 requires production of VanX for hydrolysis of D-alanyl-D-alanine. Mol Microbiol 13: 10651070.
  • 26
    Rosato, A., Pierre, J., Billot-Klein, D., Buu-Hoi, A., Gutmann, L. (1995) Inducible and constitutive expression of resistance to glycopeptides and vancomycin dependence in glycopeptide-resistant Enterococcus avium. Antimicrob Agents Chemother 39: 830833.
  • 27
    Shi, Y. & Walsh, C.T. (1995) Active site mapping of Escherichia coli D-Ala-D-Ala ligase by structure-based mutagenesis. Biochemistry 34: 27682776.
  • 28
    Somner, E.A. & Reynolds, P.E. (1990) Inhibition of peptidoglycan biosynthesis by ramoplanin, Antimicrob Agents Chemother 34: 413419.
  • 29
    Steers, E., Foltz, E.L., Graves, B.S., Riden, J. (1959) An inocula replicating apparatus for routine testing of bacterial susceptibility to antibiotics. Antibiot Chemother 9: 307311.
  • 30
    Summers, M.D. & Smith, G.E. (1987) A Manual of Methods for Baculovirus Vectors and Insect Cell Culture Procedures. Tex Agric Exp Stn Bull1555.
  • 31
    Walsh, C., Fisher, S., Park, I.-S., Prahalad, M., Wu, Z. (1996) Bacterial resistance to vancomycin: five genes and one missing hydrogen bond tell the story. Chem Biol 3: 2128.
  • 32
    Wright, G.D., Molinas, C., Arthur, M., Courvalin, P., Walsh, C.T. (1992) Characterization of VanY, a D,D-carboxypeptidase from vancomycin-resistant Enterococcus faecium BM4147. Antimicrob Agents Chemother 36: 15141518.
  • 33
    Wright, G.D., Holman, T.R., Walsh, C.T. (1993) Purification and characterization of VanR and the cytosolic domain of VanS: a two-component regulatory system required for vancomycin resistance in Enterococcus faecium BM4147. Biochemistry 32: 50575063.
  • 34
    Wu, Z. & Walsh, C.T. (1995) Phosphinate analogs of D-,D-dipeptides: slow-binding inhibition and proteolysis protection of VanX, a D-,D-dipeptidase required for vancomycin resistance in Enterococcus faecium. Proc Natl Acad Sci USA 92: 1160311607.
  • 35
    Wu, Z., Wright, G.D., Walsh, C.T. (1995) Overexpression, purification and characterization of VanX, a D,D-dipeptidase which is essential for vancomycin resistance in Enterococcus faecium BM4147. Biochemistry 34: 24552463.
  • 36
    Yanisch-Perron, C., Vieira, J., Messing, J. (1985) Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33: 103119.